ID: 1144759151

View in Genome Browser
Species Human (GRCh38)
Location 17:17697544-17697566
Sequence CATGTTCAGCACATCAATCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 264}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144759151_1144759154 10 Left 1144759151 17:17697544-17697566 CCGAGATTGATGTGCTGAACATG 0: 1
1: 0
2: 0
3: 15
4: 264
Right 1144759154 17:17697577-17697599 CTGGATTTGCTCTTGTGGTCTGG 0: 1
1: 0
2: 1
3: 10
4: 152
1144759151_1144759155 11 Left 1144759151 17:17697544-17697566 CCGAGATTGATGTGCTGAACATG 0: 1
1: 0
2: 0
3: 15
4: 264
Right 1144759155 17:17697578-17697600 TGGATTTGCTCTTGTGGTCTGGG 0: 1
1: 0
2: 1
3: 98
4: 1452
1144759151_1144759157 22 Left 1144759151 17:17697544-17697566 CCGAGATTGATGTGCTGAACATG 0: 1
1: 0
2: 0
3: 15
4: 264
Right 1144759157 17:17697589-17697611 TTGTGGTCTGGGTGTTACCTGGG 0: 1
1: 0
2: 2
3: 9
4: 149
1144759151_1144759152 -9 Left 1144759151 17:17697544-17697566 CCGAGATTGATGTGCTGAACATG 0: 1
1: 0
2: 0
3: 15
4: 264
Right 1144759152 17:17697558-17697580 CTGAACATGATTTATTTATCTGG 0: 1
1: 2
2: 1
3: 29
4: 236
1144759151_1144759153 5 Left 1144759151 17:17697544-17697566 CCGAGATTGATGTGCTGAACATG 0: 1
1: 0
2: 0
3: 15
4: 264
Right 1144759153 17:17697572-17697594 TTTATCTGGATTTGCTCTTGTGG 0: 1
1: 0
2: 1
3: 29
4: 412
1144759151_1144759156 21 Left 1144759151 17:17697544-17697566 CCGAGATTGATGTGCTGAACATG 0: 1
1: 0
2: 0
3: 15
4: 264
Right 1144759156 17:17697588-17697610 CTTGTGGTCTGGGTGTTACCTGG 0: 1
1: 0
2: 0
3: 14
4: 125
1144759151_1144759158 27 Left 1144759151 17:17697544-17697566 CCGAGATTGATGTGCTGAACATG 0: 1
1: 0
2: 0
3: 15
4: 264
Right 1144759158 17:17697594-17697616 GTCTGGGTGTTACCTGGGTGTGG 0: 1
1: 0
2: 0
3: 37
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144759151 Original CRISPR CATGTTCAGCACATCAATCT CGG (reversed) Intronic
904984195 1:34531178-34531200 CATGTCCAGCACCCCAATCTTGG - Intergenic
906638874 1:47429156-47429178 CATGTTCAGCTCATCATGCCAGG + Intergenic
907145848 1:52230497-52230519 CATGTTCTGCACATGTATCCTGG + Intronic
907489417 1:54799591-54799613 CGCATTCAACACATCAATCTTGG + Intronic
908423060 1:63978703-63978725 CATGTTCATCACAGCATTGTTGG + Intronic
909658297 1:78055098-78055120 CATGGCCGGCACATCAATCTAGG - Intronic
910076227 1:83282482-83282504 CATGTTCTGCACATGTATCCTGG - Intergenic
911036340 1:93553160-93553182 CATCTTCAGCACCTCAGTCTGGG + Exonic
913679726 1:121177928-121177950 TCTGTACAGCACATCAATTTGGG - Intronic
914031560 1:143965575-143965597 TCTGTACAGCACATCAATTTGGG - Intronic
914157885 1:145102383-145102405 TCTGTACAGCACATCAATTTGGG + Intronic
917223289 1:172754744-172754766 CATGTTCTGCACATGTATCCTGG + Intergenic
918353204 1:183679266-183679288 CATGTTCTGCACATGTATCCCGG - Intronic
919010714 1:191958642-191958664 CATGTTTAGCACAACAGACTTGG - Intergenic
919248391 1:195019096-195019118 CATGTTCTGCACATGTATCCCGG - Intergenic
920467035 1:206196463-206196485 TCTGTACAGCACATCAATTTGGG - Intronic
920744167 1:208610225-208610247 CATGTTCATCATCTCAATCATGG - Intergenic
921492513 1:215795479-215795501 CATATTCAAGACATCATTCTTGG - Intronic
921747692 1:218755983-218756005 ACTATTCAGCACATTAATCTGGG + Intergenic
922004694 1:221517955-221517977 CATGTTCAGCACCACAGCCTGGG + Intergenic
924887416 1:248234314-248234336 CATGTTCTGCACATGTATCCTGG - Intergenic
1063286505 10:4694393-4694415 CATTTTCACCCCTTCAATCTTGG + Intergenic
1063295945 10:4806423-4806445 CATGTTCTGCACATGTATCCTGG + Intronic
1063665870 10:8060283-8060305 CATGTTCAGTACATGAAAGTAGG + Intronic
1064176111 10:13076663-13076685 CATGTCCAGCACAGATATCTTGG - Intronic
1064626030 10:17262399-17262421 CATGTCCAGCACAGATATCTTGG - Intergenic
1065505232 10:26423851-26423873 CATGTCCAGCACAAATATCTTGG - Intergenic
1067078221 10:43199978-43200000 CATGACCAGCACAGCCATCTTGG + Intronic
1067535691 10:47108216-47108238 CATGTTCAGTCCATATATCTTGG - Intergenic
1068206077 10:53855852-53855874 CATGTTCTGCACATGTATCCCGG + Intronic
1068403364 10:56558474-56558496 CACGTTCAGCACATGTATCCTGG + Intergenic
1068523197 10:58100227-58100249 CATGTTCTGCACATGTATCCCGG - Intergenic
1068750064 10:60582233-60582255 CATGTTCTGCACATGTATCCTGG + Intronic
1072224784 10:93358914-93358936 CATGTACTGCACATGTATCTCGG + Intronic
1072426584 10:95335456-95335478 CATCTTCAGGAACTCAATCTGGG + Intronic
1073095903 10:100979660-100979682 AATTTTAAGCACATCAAGCTAGG + Intronic
1073869998 10:107852433-107852455 CATGTTCTGCACATGTATCCTGG + Intergenic
1074679984 10:115895779-115895801 CCTCTTCTGCACATCACTCTTGG - Intronic
1074872042 10:117584728-117584750 CATGTCCTGCACATGTATCTTGG - Intergenic
1075205402 10:120443619-120443641 CATGTTCTGCACATGTATCCTGG + Intergenic
1076515082 10:131040789-131040811 CATGTCCGGCACAAAAATCTTGG - Intergenic
1076559851 10:131354837-131354859 CATGTTCACAACATCAATTTGGG + Intergenic
1076582462 10:131520748-131520770 CATGTTCTGCACATATATCCCGG - Intergenic
1080559326 11:33448110-33448132 CATGTTCTGCACATGTATCCCGG - Intergenic
1081452328 11:43183446-43183468 GAATTTCAGCACATGAATCTTGG - Intergenic
1088034959 11:105300098-105300120 CATGTTCTGCACATGTATCCCGG + Intergenic
1091337186 11:134781174-134781196 CTTGTTCCTCACATCAAGCTTGG + Intergenic
1091605490 12:1948258-1948280 CACGTTCACCACATGAATGTTGG - Intronic
1092504138 12:9078091-9078113 CACGTTCTGCACATGTATCTCGG - Intronic
1093716186 12:22384607-22384629 CATGTTCTGCACATGTATCCCGG + Intronic
1093955672 12:25215407-25215429 TAAGTTCAGCACATTAATTTTGG - Intronic
1094368828 12:29713819-29713841 TATTTTCAGCACATGAATTTGGG - Intronic
1097422395 12:59396110-59396132 CATGTTCTGCACATGTATCCTGG + Intergenic
1099922731 12:88979219-88979241 CATTTTGAGCACATAAAACTGGG + Intergenic
1101000880 12:100356360-100356382 CATGTTCTGCACATGTATCCTGG + Intergenic
1101632756 12:106511504-106511526 CATGACCAGCACATATATCTTGG - Intronic
1102247728 12:111365852-111365874 CATGTTCTGCACATGTATCATGG + Intronic
1103308563 12:119987141-119987163 CATGTCCAGCACAGGTATCTTGG + Intergenic
1104246528 12:127047640-127047662 GATGTTCAGCACTCCAATCCTGG + Intergenic
1104520746 12:129472562-129472584 CATGTTCAGCACGTGTATCCCGG + Intronic
1104683692 12:130770483-130770505 CATTTCCAACACATGAATCTGGG - Intergenic
1105286735 13:19010588-19010610 CATCTTCAGGACATCAAATTAGG + Intergenic
1108336953 13:49453345-49453367 CATGTGCAGCAGCGCAATCTTGG + Intronic
1109044816 13:57396348-57396370 CATGTTCTGCACATGTATCCCGG - Intergenic
1109611509 13:64771376-64771398 CATGTTCTGCACATGTATCCTGG - Intergenic
1109679707 13:65734066-65734088 CATGTTCTGCACATGTATCCTGG + Intergenic
1110258419 13:73457883-73457905 CATGTTCTGCACATGTATCCTGG - Intergenic
1110568532 13:76980017-76980039 CACGTTCTGCACATGTATCTTGG + Intergenic
1111140334 13:84109785-84109807 CAAGATCAACACATCAAACTAGG - Intergenic
1112795843 13:103055843-103055865 CATGTTCAGCATAAATATCTTGG - Intronic
1113714248 13:112491932-112491954 GATGTACATCACATCAATCAGGG - Intronic
1114204309 14:20554301-20554323 CATGTTCATCTCATTGATCTTGG - Intergenic
1117660481 14:57999058-57999080 CATCTTCAGCTTATCAGTCTAGG + Intergenic
1120276343 14:82378034-82378056 CATGTTCTGCACATGTATCCCGG + Intergenic
1122180313 14:99949867-99949889 AATGTTCCACACATCCATCTTGG + Intergenic
1122395746 14:101428819-101428841 CATGTTCTGCACATGTATCCTGG - Intergenic
1123832746 15:24158468-24158490 CATGTGCAGCACAGCAGTGTCGG - Intergenic
1123839468 15:24233362-24233384 CATGTGCAGCACAGCAGTGTCGG - Intergenic
1123868400 15:24546668-24546690 CATGTGCAGCACAGCAGTGTCGG - Intergenic
1124853565 15:33364702-33364724 CTTCTCCAGCACATCAACCTGGG - Intronic
1127182225 15:56433390-56433412 CATGTTCTGCACATGCATCCTGG + Intronic
1127823307 15:62679976-62679998 CTAGTTCAGCACATCTATATGGG + Intronic
1128622809 15:69165794-69165816 CATCATGAACACATCAATCTTGG - Intronic
1129457256 15:75682589-75682611 CATGATCAGCACACCCACCTGGG + Exonic
1129726527 15:77904356-77904378 CATGATCAGCACACCCACCTGGG - Intergenic
1129985460 15:79916277-79916299 CATGTCCAGCACAAATATCTTGG + Intronic
1129986053 15:79920591-79920613 CATGTCCAGCACAAATATCTTGG + Intronic
1130746366 15:86658119-86658141 CATGATCAGCACAAAAATCCAGG + Intronic
1131028080 15:89162147-89162169 CGAGTTCAGCATATGAATCTTGG + Intronic
1131343920 15:91628545-91628567 CATGGTTTGCACATCATTCTAGG + Intergenic
1131903259 15:97112413-97112435 CATGTTCTGCACATGTATCCTGG + Intergenic
1133178891 16:4037500-4037522 TATGTTCATCACAGCAATGTTGG - Intronic
1133549244 16:6838039-6838061 CATGTTCTGCACATGCATCCCGG - Intronic
1138634828 16:58329866-58329888 CATGTTCTGCACATGTATCCCGG - Intronic
1140495692 16:75386099-75386121 CATGTTCTGCACATGTATCCCGG + Intronic
1144759151 17:17697544-17697566 CATGTTCAGCACATCAATCTCGG - Intronic
1144878275 17:18414523-18414545 TATGTTCTGCATATGAATCTTGG - Intergenic
1145153955 17:20529885-20529907 TATGTTCTGCATATGAATCTTGG + Intergenic
1149377334 17:56058486-56058508 CATGTTCTGCACATGTATCCTGG - Intergenic
1149515433 17:57277471-57277493 CATGTTCAGCACATCAGCATTGG - Intronic
1150984028 17:70175202-70175224 AATGTTCAGTTCATCAATGTGGG + Exonic
1153202610 18:2661308-2661330 CATGTTCTGCACATGTATCCAGG + Intronic
1153592287 18:6686315-6686337 CATGTTCAATACATAAATATTGG - Intergenic
1156035611 18:32764109-32764131 CATATTCAGCAAACTAATCTAGG - Intronic
1156519766 18:37712347-37712369 CATCTTCAGCTCCTCACTCTAGG - Intergenic
1158243044 18:55398954-55398976 AGTGTTCAGCACATCCATCGAGG - Intronic
1158716680 18:59886619-59886641 CATGTCCAGCACAAATATCTTGG + Intergenic
1159112940 18:64081534-64081556 TATGTGCAGCACATAAATCCAGG - Intergenic
1159262613 18:66034916-66034938 AATGTTTAGCACAACAATATAGG - Intergenic
1161831990 19:6612813-6612835 CATGTTCTGCACATGTATCCCGG - Intergenic
1164024254 19:21336186-21336208 CATGTCCAGCACAAATATCTTGG + Intergenic
1164177915 19:22793419-22793441 CAGGTTCTGCACATGTATCTCGG - Intergenic
1164402979 19:27915111-27915133 CATGTTCTGCACATGTATCCCGG - Intergenic
927635663 2:24814347-24814369 GATATGCAGCAAATCAATCTTGG - Intronic
927845113 2:26467362-26467384 CACCTTAAGCTCATCAATCTTGG + Exonic
928655119 2:33442766-33442788 GATGGTCAGCAAATCAAACTGGG + Intronic
928807115 2:35172825-35172847 CTTCTTCAGTACATCAATCTTGG - Intergenic
929241347 2:39656907-39656929 CATGTTCTGCACATGTATCCTGG + Intergenic
930565746 2:53018316-53018338 CATCTCCAGCACACCACTCTAGG + Intergenic
931164481 2:59732120-59732142 TATGTTGAACACATCAAGCTCGG + Intergenic
931365293 2:61613872-61613894 CATGTTCTGCACATGTATCCCGG - Intergenic
931930874 2:67132090-67132112 CATGTTCAGCACATGTATCCCGG - Intergenic
932330388 2:70895353-70895375 CAGATTCAGCACAGCAAACTTGG + Intergenic
933413542 2:81954844-81954866 CATGTTCTGCACATGCATCCAGG + Intergenic
936445433 2:112591017-112591039 CATGCTCAGCTCAGCACTCTGGG - Intergenic
937019408 2:118636542-118636564 TATGTTCTGCACATGTATCTCGG - Intergenic
938085466 2:128397266-128397288 CATCTTCAGCACCTCAGGCTTGG - Intergenic
938186421 2:129236224-129236246 CATTTTCAACACATGAAACTTGG - Intergenic
938989188 2:136610454-136610476 CATGTTCTGCACATGTATCCTGG + Intergenic
939470932 2:142618304-142618326 CATGTTCTGCACATGTATCCTGG + Intergenic
941277188 2:163504020-163504042 CATGTCCTGCACATGCATCTTGG + Intergenic
941510873 2:166407771-166407793 CATGTTCTGCACATGTATCCTGG - Intronic
941591213 2:167422724-167422746 CATTTCCAGAACATCAGTCTTGG - Intergenic
944759916 2:202804124-202804146 CATGTCCAGCACAAATATCTTGG - Intronic
944968410 2:204962442-204962464 CATGTTCAGCGCATCTCTGTGGG + Intronic
946475667 2:220004450-220004472 CATGTTCCTCACAACATTCTCGG - Intergenic
946713199 2:222526952-222526974 CATGTTCTGCACATGTATCTCGG + Intronic
946868805 2:224067356-224067378 CACGTTCTGCACATGTATCTTGG + Intergenic
947060532 2:226159816-226159838 CATCTACAGGACATAAATCTTGG + Intergenic
947439045 2:230101388-230101410 CATGTTCAGCACACATATCCTGG - Intergenic
1169199920 20:3703922-3703944 CAGGTGCAGCACACCAGTCTTGG + Exonic
1170329024 20:15188043-15188065 AAAATTCGGCACATCAATCTAGG + Intronic
1172878272 20:38179709-38179731 CACGTTCAGCACATGTATCCTGG + Intergenic
1173296258 20:41761299-41761321 CATGTTCTGCACATGTATCCTGG - Intergenic
1173827509 20:46057244-46057266 CATGTTGAGCAAAACAAGCTTGG - Exonic
1176097457 20:63350829-63350851 CATGTTCACCAGGTCGATCTTGG + Exonic
1177397365 21:20554738-20554760 GATGGTCAGCAAATCAAACTGGG + Intergenic
1177579787 21:23006215-23006237 CATGTTCTGCACATGTATCCTGG + Intergenic
1178018750 21:28384423-28384445 TATGTTGAGTAAATCAATCTTGG + Intergenic
1179808661 21:43856160-43856182 CACGTTCATCTCATCACTCTTGG + Intergenic
1180864720 22:19110588-19110610 CATGTTCTGCACATGCATCCTGG + Intronic
1180888807 22:19269909-19269931 CATGTTCTGCACATGTATCCTGG + Intronic
1182671516 22:32000006-32000028 CATGTTCAGCACATGTATCCCGG - Intergenic
1184949086 22:47827248-47827270 CATGTTCTGCACATGTATCCTGG + Intergenic
949653703 3:6191895-6191917 CATGTTCTGCACATGTATCCCGG - Intergenic
951490004 3:23259545-23259567 CATGTTCTGCACATGTATCCTGG + Intronic
951994555 3:28713040-28713062 CATGTTCTGCACATGTATCCTGG - Intergenic
952522114 3:34171857-34171879 CATGTTCTGCACATGTATCTTGG - Intergenic
952842027 3:37654722-37654744 CACGTTCAGCACATGTATCCTGG - Intronic
957504928 3:81107489-81107511 CATGTTCTGCACATGTATCCTGG + Intergenic
958007211 3:87827148-87827170 CATGTTCTGCACATGTATCCTGG - Intergenic
960735422 3:120774222-120774244 CAGGCTCAGCACATCAAGATGGG + Intronic
962625378 3:137220718-137220740 CATGTTCTGCACATGTATCCTGG + Intergenic
963589163 3:147234860-147234882 CATGTTCTGCACATGTATCCAGG - Intergenic
963805558 3:149718214-149718236 CATAATCACCACATCAAACTTGG + Intronic
964311173 3:155394807-155394829 CATGTTCTGCACATGTATCCTGG - Intronic
964859654 3:161187007-161187029 CATGTTCTGCACATGTATCCCGG + Intronic
965699988 3:171450840-171450862 CATGTTCAGCACCACATTCCTGG - Intronic
967058652 3:185851944-185851966 CATGATCTGCACTCCAATCTGGG + Intergenic
967376447 3:188808694-188808716 CATGTTCTGCACATGTATCCTGG - Intronic
967857078 3:194126316-194126338 CATGTTCTGCACATGTATCCCGG - Intergenic
972065117 4:34933309-34933331 CATGTTCTGCACATGTATCCTGG - Intergenic
973031633 4:45349068-45349090 CATGTTCTGCACATGTATCCTGG + Intergenic
973585202 4:52383719-52383741 CATGTTCTGCACATGTATCCTGG + Intergenic
974624736 4:64410636-64410658 GTTGTTCAGCACTTCAAACTTGG + Intergenic
975475276 4:74816139-74816161 CATGTTCTGCACATGTATCCCGG - Intergenic
975994783 4:80301766-80301788 CATGTTCTGCACATGTATCCTGG - Intronic
976032734 4:80776715-80776737 CATGTTCTGCACATGTATCCCGG + Intronic
976545357 4:86328981-86329003 CATGTTCTGCACATGTATCCCGG + Intronic
977205556 4:94161544-94161566 CATGTTCTGCACATGTATCCTGG - Intergenic
977439946 4:97052644-97052666 TATATTCAGGACATCAATTTTGG + Intergenic
978147358 4:105391309-105391331 CATGTTCTGCACATGTATCCTGG + Intronic
978840445 4:113206111-113206133 CATGTTCTGCACATGTATCCTGG - Intronic
978940869 4:114434773-114434795 CATGTTCACCACAGCAATGGTGG + Intergenic
979763266 4:124433728-124433750 CAGATACAGCACTTCAATCTCGG - Intergenic
980639579 4:135559019-135559041 CAGGTTTAGCACATCTATCTTGG + Intergenic
981424350 4:144586147-144586169 CATGTTCTGCACATGTATCCTGG - Intergenic
981881364 4:149616933-149616955 CATGTTCTGCACATATATCCTGG + Intergenic
982371330 4:154636982-154637004 CATGTTCTGCACATGGATCCTGG + Intronic
984234143 4:177135882-177135904 CATGTTCTGCACATGTATCCTGG + Intergenic
984733768 4:183091861-183091883 CAAGTTCATCACATTAAGCTTGG - Intergenic
986108768 5:4689173-4689195 CATGTTCTGCACATGTATCCCGG + Intergenic
987821971 5:22977034-22977056 CATATTCAAAACATCAATATAGG - Intergenic
990189674 5:53245325-53245347 CATGTTCTGCACATGTATCCTGG - Intergenic
992390181 5:76323979-76324001 CACGTTCTGCACATGTATCTCGG + Intronic
994683391 5:102918366-102918388 CATATTCAGCTAATAAATCTAGG - Intronic
994729229 5:103472189-103472211 CATGTTCTGCACATGTATCCCGG + Intergenic
995262711 5:110123927-110123949 CATGTTCTGCACATGTATCCTGG - Intergenic
995959600 5:117823779-117823801 CATGTTCTGCACATGTATCCCGG - Intergenic
995996987 5:118312430-118312452 CATGTTCTGCACATGTATCCCGG - Intergenic
996965200 5:129299816-129299838 CATGTTCTGCACATGTATCCCGG - Intergenic
997117737 5:131143991-131144013 CATGTTCTGCACATGTATCCCGG + Intergenic
998912685 5:146977404-146977426 CATGTTCTGCACATGTATCCCGG - Intronic
999531408 5:152467102-152467124 CAGGTTCAACTCATCCATCTTGG + Intergenic
999623344 5:153494015-153494037 GATGTTCACAATATCAATCTGGG - Exonic
1001789431 5:174443171-174443193 CATGTTCTGCACATGTATCCTGG + Intergenic
1003158174 6:3614082-3614104 CACGTTCTGCACATGAATCCCGG + Intergenic
1003496089 6:6664429-6664451 CATATTCCACACAACAATCTGGG - Intergenic
1009462056 6:63925552-63925574 CATGTTCTGCACATGTATCCTGG - Intronic
1010412470 6:75576037-75576059 CATGTTCTGCACATGTATCCCGG + Intergenic
1010568634 6:77450501-77450523 CGTGTTCAGTACATTAATGTGGG - Intergenic
1012038185 6:94169850-94169872 CATGTTCTGCACATGTATCACGG + Intergenic
1012057602 6:94433322-94433344 CATGTTCTGCACATGTATCCCGG + Intergenic
1012161039 6:95886380-95886402 CATGTTCTGCACATGTATCCTGG - Intergenic
1014422875 6:121267039-121267061 CATGTTCTGCACATGTATCCTGG + Intronic
1014787630 6:125636492-125636514 CATGTTCTGCACATTTATCCCGG + Intergenic
1015636358 6:135278863-135278885 CATGTTCTGCACATGTATCCCGG + Intergenic
1017400204 6:154052306-154052328 CATGTTCTGCATATGTATCTTGG + Intronic
1017591981 6:155987870-155987892 CATGTTCTGCACATGTATCCTGG - Intergenic
1017902432 6:158730051-158730073 CATATTCAGCACAAATATCTTGG - Intronic
1022686443 7:32601706-32601728 CATGTTCTGCACATGTATCCCGG + Intergenic
1023903045 7:44498983-44499005 CATTTCCAGCACATGAATTTGGG + Intergenic
1024018276 7:45338972-45338994 CACGTTCAGCACATGTATCCCGG + Intergenic
1026221391 7:68400699-68400721 CATGTTCAGAAAATAAATCTGGG - Intergenic
1027294001 7:76747775-76747797 CATGTTCTGCACATGTATCCTGG - Intergenic
1027747882 7:82100801-82100823 AAAGTTCAGGAAATCAATCTTGG - Intronic
1030159456 7:106492568-106492590 CTTGTTCAACACATCCAGCTAGG - Intergenic
1030257147 7:107522558-107522580 CATGTTCTGCACATGTATCCCGG + Intronic
1034235882 7:149568939-149568961 CATGTTTAGCACAAATATCTTGG - Intergenic
1035827792 8:2663171-2663193 CATATTCTGCACATGTATCTCGG - Intergenic
1037008084 8:13806592-13806614 CATGTTCTGCACATGTATCCCGG + Intergenic
1037307746 8:17523119-17523141 CATGTTCTGCACATGTATCCTGG + Intronic
1037685222 8:21133015-21133037 CATGTTCCGCACATGTATCTCGG - Intergenic
1039718493 8:40136504-40136526 CATGTTCTGCACATGTATCCCGG + Intergenic
1041768911 8:61451724-61451746 CATGGTCAACACATCATTATTGG - Intronic
1043197376 8:77313973-77313995 AATCTTCAGCAGATAAATCTAGG + Intergenic
1043311941 8:78871619-78871641 CATGTTCTGCACATGTATCCTGG - Intergenic
1044761600 8:95523209-95523231 CATGTTCAGAACATGCAGCTTGG + Intergenic
1046266158 8:111833038-111833060 CATGTTCAGTAAAGAAATCTGGG + Intergenic
1046449384 8:114368588-114368610 AATGTTCAGCACATTAGTCTGGG + Intergenic
1046943332 8:119952478-119952500 CACGTTCTGCACATGTATCTTGG - Intronic
1047163360 8:122407210-122407232 CATGTTCTGCACATGTATCCCGG + Intergenic
1049812951 8:144583943-144583965 CCTGTCCAGCACATCACTCAAGG + Intronic
1050141017 9:2515662-2515684 CACGTTCTGCACATGAATCCCGG - Intergenic
1050630605 9:7554715-7554737 CATGTTCTGCACATGTATCCCGG + Intergenic
1050865434 9:10491742-10491764 CATGTTCTGCACATATATCCCGG - Intronic
1052503938 9:29328608-29328630 CATGTTCTGCACATGTATCCCGG - Intergenic
1055851961 9:80642435-80642457 CATGTTTTGCACATGTATCTCGG + Intergenic
1057551406 9:96053474-96053496 CATGTCCACCAAATCAATGTGGG + Intergenic
1058562980 9:106249404-106249426 CAGGTGCAGCCCCTCAATCTTGG + Intergenic
1059055768 9:110977733-110977755 CATGTTCTGCACATGTATCCCGG + Intronic
1059891177 9:118806696-118806718 TATGTTCAGCAAATTAATGTAGG + Intergenic
1059961595 9:119570253-119570275 CATGTCCAGCACATGTATCCTGG + Intergenic
1202802298 9_KI270720v1_random:10952-10974 CATGTTCTGCACATTTATCCTGG - Intergenic
1187007768 X:15249038-15249060 CATATTGAGCACAGCAATCCTGG + Intronic
1187284754 X:17894272-17894294 CAGGTACACCTCATCAATCTTGG + Intergenic
1187290911 X:17952403-17952425 CATCTTCACCATCTCAATCTGGG + Intergenic
1188099398 X:26064610-26064632 CATGTTCTGCACATGTATCCTGG - Intergenic
1188546471 X:31313044-31313066 CACGTTCTGCACATGTATCTCGG + Intronic
1189979304 X:46493056-46493078 CATGTTCTGCACATGTATCCTGG + Intronic
1190375817 X:49787305-49787327 CATGTTCTGCACATGTATCCTGG + Intergenic
1191040309 X:56070749-56070771 CACGTTCTGCACATGTATCTTGG + Intergenic
1191721603 X:64233794-64233816 CATGTTCTGCACATGTATCCTGG + Intergenic
1192716980 X:73653314-73653336 CACGTTCAGCACATGTATCCTGG + Intronic
1193135472 X:77966802-77966824 CACGTTCTGCACATCTATCCTGG - Intronic
1193163527 X:78256759-78256781 CATTTTCAGGACATGAGTCTTGG - Intergenic
1194450465 X:94039658-94039680 GATGTTCTTCATATCAATCTGGG - Intergenic
1194706259 X:97179268-97179290 CATGTTCTGCACATATATCCCGG - Intronic
1195532180 X:105969503-105969525 AATGTTCAACACATGAATTTGGG + Intergenic
1195822292 X:108958631-108958653 CATGTTCTGCACATGTATCCTGG + Intergenic
1195823553 X:108972470-108972492 CATGTTCTGCACATGAATCCTGG + Intergenic
1197151898 X:123229227-123229249 AATGGAAAGCACATCAATCTGGG - Intronic
1197571286 X:128153761-128153783 CATGTTCTGCACATGTATCCTGG + Intergenic
1197680202 X:129374770-129374792 CATGTTCTGCACATGTATCCCGG - Intergenic
1198286110 X:135194082-135194104 CATGTGCTGCACATCCATGTTGG + Intergenic
1198632276 X:138653951-138653973 AGTGTACAGCACACCAATCTGGG - Intronic
1198833587 X:140777270-140777292 CACGTTCTGCACATGTATCTTGG + Intergenic
1198896122 X:141457025-141457047 CATGTTATCCACATCAAACTAGG - Intergenic
1199646056 X:149913622-149913644 ACTCTCCAGCACATCAATCTGGG + Intergenic
1199916418 X:152346408-152346430 CATCTCCAGGACATCAGTCTGGG + Intronic