ID: 1144759280

View in Genome Browser
Species Human (GRCh38)
Location 17:17698306-17698328
Sequence GGTGGGACTCAACTCTTGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 66}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144759280_1144759285 5 Left 1144759280 17:17698306-17698328 CCACTCAAGAGTTGAGTCCCACC 0: 1
1: 0
2: 1
3: 7
4: 66
Right 1144759285 17:17698334-17698356 TCAAGAACAGCAAGGAATGATGG 0: 1
1: 0
2: 0
3: 37
4: 466
1144759280_1144759287 22 Left 1144759280 17:17698306-17698328 CCACTCAAGAGTTGAGTCCCACC 0: 1
1: 0
2: 1
3: 7
4: 66
Right 1144759287 17:17698351-17698373 TGATGGGAAAATCCCTGCTTTGG 0: 1
1: 0
2: 0
3: 11
4: 172
1144759280_1144759289 24 Left 1144759280 17:17698306-17698328 CCACTCAAGAGTTGAGTCCCACC 0: 1
1: 0
2: 1
3: 7
4: 66
Right 1144759289 17:17698353-17698375 ATGGGAAAATCCCTGCTTTGGGG 0: 1
1: 0
2: 1
3: 17
4: 234
1144759280_1144759286 6 Left 1144759280 17:17698306-17698328 CCACTCAAGAGTTGAGTCCCACC 0: 1
1: 0
2: 1
3: 7
4: 66
Right 1144759286 17:17698335-17698357 CAAGAACAGCAAGGAATGATGGG 0: 1
1: 0
2: 0
3: 19
4: 255
1144759280_1144759283 -3 Left 1144759280 17:17698306-17698328 CCACTCAAGAGTTGAGTCCCACC 0: 1
1: 0
2: 1
3: 7
4: 66
Right 1144759283 17:17698326-17698348 ACCAGTACTCAAGAACAGCAAGG 0: 1
1: 0
2: 1
3: 18
4: 140
1144759280_1144759288 23 Left 1144759280 17:17698306-17698328 CCACTCAAGAGTTGAGTCCCACC 0: 1
1: 0
2: 1
3: 7
4: 66
Right 1144759288 17:17698352-17698374 GATGGGAAAATCCCTGCTTTGGG 0: 1
1: 0
2: 0
3: 11
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144759280 Original CRISPR GGTGGGACTCAACTCTTGAG TGG (reversed) Intronic
903602078 1:24549861-24549883 GGTGGGACTAGACTCTGGAGGGG + Intergenic
907347598 1:53795770-53795792 GTTGGGACTAAACTCTTGCAAGG - Intronic
916358475 1:163939608-163939630 GGTGGGAGTCACCTCTTCACAGG - Intergenic
922592561 1:226788612-226788634 GGTGGGAATCAACCCTGGACAGG - Intergenic
924074335 1:240317548-240317570 TGAGGCACTCAACACTTGAGTGG - Intronic
1065277526 10:24099893-24099915 GGTGGGAATCATCTCTGCAGTGG - Intronic
1068403845 10:56564491-56564513 GGTGTGGCTCATCTCTTCAGTGG - Intergenic
1070203724 10:74234111-74234133 GGTCTGACTCAACCCTTAAGGGG - Intronic
1079274880 11:19026026-19026048 GGTGAGACACATCTCGTGAGAGG - Intergenic
1082789086 11:57335190-57335212 GCTGGGCCCCAACTCCTGAGTGG + Exonic
1083764816 11:64836691-64836713 GGTGGGACTCAGCCCTGGGGGGG + Intronic
1085060296 11:73439744-73439766 GGAGGTACTCAACACTTTAGAGG + Intronic
1085478999 11:76806316-76806338 GGTGGGACTCACCTCTCCACAGG - Intergenic
1088263728 11:107970137-107970159 GGTGGGACTCAACTTGGAAGCGG + Intergenic
1096745100 12:53721649-53721671 GTTGGGACTCATCTCTCAAGTGG + Intronic
1100414850 12:94361368-94361390 GGTGGTCCTCTACTCTTGGGAGG - Intronic
1114793518 14:25685729-25685751 GGTGGGAATCAACCCTGGAGCGG - Intergenic
1118562128 14:67097192-67097214 GGATGCACGCAACTCTTGAGGGG + Intronic
1124878518 15:33619781-33619803 CCTGGGTCTCAACTCTAGAGGGG - Intronic
1127390880 15:58504173-58504195 GGTGGGCCTAGAATCTTGAGGGG - Intronic
1131403498 15:92145157-92145179 GGTGGGGCTAAGCTCTTCAGTGG - Intronic
1132044931 15:98555551-98555573 AAGGGAACTCAACTCTTGAGGGG - Intergenic
1134033646 16:11012963-11012985 GGTGGGAGCCAACTCTGGACAGG + Intronic
1142969657 17:3602820-3602842 GCTGGGGCTCGAATCTTGAGAGG - Intergenic
1144124537 17:12190173-12190195 GCTGCAACTCAACTCTTTAGAGG - Intergenic
1144759280 17:17698306-17698328 GGTGGGACTCAACTCTTGAGTGG - Intronic
1158264129 18:55640897-55640919 GGATGGACTCAACACTAGAGTGG + Intronic
1161115661 19:2495265-2495287 GGTGGGACTCTACACTGCAGAGG - Intergenic
1164436728 19:28236778-28236800 GGTGGGCAGCCACTCTTGAGGGG + Intergenic
1165738592 19:38192829-38192851 GGTGGGACCCAACCCTGGGGAGG - Intronic
1166551476 19:43668729-43668751 GGTGGGACTAGACTCTTGAGGGG - Intronic
931609544 2:64083773-64083795 AGAGGAACTCCACTCTTGAGTGG - Intergenic
932266060 2:70367780-70367802 GGCAGGACTCAACTCTGGAGGGG + Intergenic
939868418 2:147501114-147501136 TTTGGAACTCAACTCTTCAGGGG + Intergenic
940222908 2:151372131-151372153 GGTGGTACCCTACTCCTGAGAGG - Intronic
941063672 2:160876713-160876735 GTTGGCTCTCAACTCTGGAGAGG + Intergenic
941519192 2:166517768-166517790 GGGGAGACTCAACTATTTAGTGG - Intergenic
943655880 2:190508473-190508495 GGTGGAACTGAGCTCATGAGAGG - Exonic
944007055 2:194922143-194922165 GGTGGGAGTCAACTCCAGAGAGG - Intergenic
945024315 2:205605888-205605910 GCTGGGACTGAGCTCCTGAGAGG - Intronic
1169547481 20:6665512-6665534 GTTGGGACCCAGCTTTTGAGTGG - Intergenic
1170028593 20:11919147-11919169 GGTGGGACTCAACGGTTGCCAGG + Exonic
1177557821 21:22714892-22714914 GGCGGGGCTCATCTCTGGAGGGG + Intergenic
950984084 3:17341600-17341622 GTTGGGATTCAATTCTTGGGAGG + Intronic
951139687 3:19146818-19146840 GGTGGGACACAAGGATTGAGGGG + Intergenic
956098594 3:65743823-65743845 GTTGGTTCTCAAGTCTTGAGTGG + Intronic
962847855 3:139287012-139287034 GGCTGGACCCAACTCTGGAGTGG - Intronic
966730853 3:183150246-183150268 GCAGGGACTCAACACTTGGGTGG + Intronic
967411608 3:189171889-189171911 GGTGGAACTCAACCCGTCAGAGG - Intronic
974685157 4:65217438-65217460 GGTGGGAGTGAACTCTGGATTGG + Intergenic
974699650 4:65424052-65424074 GGTGGGACTCACCATTAGAGTGG - Intronic
974818406 4:67035466-67035488 GGTGGCACTGAACTCTGGAGGGG - Intergenic
982507740 4:156241160-156241182 GATGGAAGGCAACTCTTGAGGGG + Intergenic
985863352 5:2492283-2492305 GGTGGGTCTCAACTATGGTGTGG - Intergenic
991981625 5:72237568-72237590 AGTAAGACTCAACTCTTGGGTGG + Intronic
998071586 5:139202024-139202046 GATGGGCCTCAAATGTTGAGTGG + Intronic
1000258379 5:159562245-159562267 GGTGGCCATCAACCCTTGAGGGG + Intergenic
1005392616 6:25349142-25349164 GGTGGGAACCAACTCTGGACAGG + Intronic
1017541715 6:155409355-155409377 GGTGGGACACAGCTAGTGAGTGG + Intronic
1027463572 7:78486338-78486360 TGTGGGACTCTACTCTTGGCAGG - Intronic
1029945147 7:104525108-104525130 TGAGGAGCTCAACTCTTGAGTGG - Intronic
1031910543 7:127512675-127512697 GGTGGGACTCAACTCTAGGCAGG + Intergenic
1034244542 7:149634662-149634684 TGTGGGACTCAACTCAAGTGTGG + Intergenic
1034732007 7:153396142-153396164 AGTGTGACTCAAATATTGAGAGG - Intergenic
1038726152 8:30084145-30084167 TGTGGGACTGAACTCTTTATAGG - Intergenic
1047534180 8:125704211-125704233 GGTGGGATGCAACTCTGGAGGGG - Intergenic
1049438799 8:142599821-142599843 CGTGGGTCTCAGCTCTAGAGAGG + Intergenic
1050808247 9:9711040-9711062 GGTGGGAACCAACTCTGGACAGG - Intronic
1052559027 9:30059998-30060020 GGTGGGACTAAACTAAGGAGAGG + Intergenic
1054746676 9:68860835-68860857 GCTGGGACTCACCTCTAGGGAGG - Intronic
1059488410 9:114645413-114645435 GGTCAGACTCATCTCTTGAATGG - Intronic
1061307127 9:129738577-129738599 GGAGGGACTCAAACCTTGGGAGG + Exonic
1187673052 X:21687398-21687420 GGCTGGACTCTACACTTGAGAGG + Intergenic
1189166609 X:38867116-38867138 GGTGGGAACCCACTCTTGACAGG + Intergenic
1199528499 X:148821027-148821049 GGTGGAATCCAACTTTTGAGGGG + Intronic