ID: 1144760314

View in Genome Browser
Species Human (GRCh38)
Location 17:17703476-17703498
Sequence TCCCATAACCTTTTTGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 152}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144760314 Original CRISPR TCCCATAACCTTTTTGGGGT GGG Intronic
900254299 1:1689571-1689593 TTCCTGACCCTTTTTGGGGTAGG + Intronic
900263057 1:1742838-1742860 TTCCTGACCCTTTTTGGGGTAGG + Intronic
902824908 1:18966207-18966229 TCCCATAATCTGTTCTGGGTAGG - Intergenic
903577277 1:24346707-24346729 TCCCAAAGCCTCCTTGGGGTGGG + Intronic
904780026 1:32939431-32939453 TCCCAGCACCTTTTTTAGGTGGG - Intronic
905409031 1:37755648-37755670 TCCAACAACCTTTTTGAGGTAGG - Intronic
906630218 1:47361060-47361082 TCCCATGTTCATTTTGGGGTGGG + Intronic
907491492 1:54811688-54811710 TCCCATTCCCTTCTTGGGGATGG + Intronic
909037681 1:70612744-70612766 TCCCATATCCTTTGAGAGGTGGG - Intergenic
909077035 1:71061570-71061592 TTCCATATCCTTTTGGGGTTAGG - Intergenic
911529752 1:99030638-99030660 TCACATAGCTTTTTTGGGTTGGG + Intergenic
911529775 1:99030837-99030859 TCACATTGCTTTTTTGGGGTGGG + Intergenic
912070937 1:105808399-105808421 TTCCATAACCTTTTTGTACTTGG - Intergenic
912677116 1:111693231-111693253 TGCCATAACCATAATGGGGTGGG + Intronic
915926184 1:160021420-160021442 ACCCATAACCTTTGTGGGTGGGG + Intergenic
918165247 1:181938625-181938647 GCTCCTAACCTTTATGGGGTTGG - Intergenic
920497006 1:206462119-206462141 TCCCGTAACCTGTTTGGGGTTGG + Exonic
921601238 1:217109057-217109079 TCCCATTACATTTTTGTGGATGG - Intronic
923031905 1:230255780-230255802 TCCCATAACATTTTGGGGGGTGG - Intronic
924556950 1:245126518-245126540 TCTCATCACCATTTTGGGTTTGG + Intronic
1064636478 10:17373319-17373341 TCCCATATTCACTTTGGGGTGGG - Intronic
1067393869 10:45893270-45893292 GCCCATAATCTTTTTTGGGAGGG + Intergenic
1067862192 10:49862403-49862425 GCCCATAATCTTTTTTGGGAGGG + Intronic
1068639124 10:59382153-59382175 TCCCATAACATCTTTGTGTTTGG - Intergenic
1069263752 10:66432809-66432831 TCACATACCCTGTTGGGGGTTGG - Intronic
1071789587 10:88939996-88940018 TACCATAACATTTTTTGGGGTGG + Intronic
1072333985 10:94381080-94381102 TCCAATAGCCTTTTTGTGGAAGG - Intergenic
1072646187 10:97256313-97256335 TCCCAGAAACTTTTTAAGGTAGG - Exonic
1072698866 10:97625033-97625055 TCACAACAACTTTTTGGGGTGGG + Intronic
1073841318 10:107502235-107502257 TCCAATTCCATTTTTGGGGTTGG + Intergenic
1078631490 11:13008570-13008592 TCCCACAGCCTTTTTGGGAGAGG - Intergenic
1084228021 11:67729540-67729562 TCCCTTGACCTTTTTGGGAAGGG - Intergenic
1086663713 11:89453986-89454008 AACAATAACCTTTTTGGGGCTGG - Intronic
1086941359 11:92801583-92801605 TTCCATTACCTTTTCGGGCTGGG - Exonic
1092745764 12:11670999-11671021 TCCCATCACTTTTTTGGGGCAGG - Intronic
1094258757 12:28466346-28466368 TTCTATAAACTTTTTGGGCTTGG - Intronic
1095372370 12:41484494-41484516 TCCTATTACGTTTTTGGGGCAGG - Intronic
1099844453 12:88012071-88012093 TCCCATTTGTTTTTTGGGGTAGG + Intronic
1100121843 12:91377374-91377396 TCCCTTACCCTTTTTTTGGTGGG - Intergenic
1103417556 12:120753617-120753639 CCTCATAACATTGTTGGGGTCGG - Intergenic
1107000865 13:35543704-35543726 TCCCATCTCCTTTTTGGAGATGG + Intronic
1108826098 13:54414540-54414562 TCTCAGAACCTTTTTGCAGTCGG + Intergenic
1110054378 13:70946913-70946935 TCCCATGATTTTTTTGGGGGTGG - Intergenic
1113191395 13:107751177-107751199 TGCCTTACCCTTTTTGGAGTGGG + Intronic
1113634419 13:111910008-111910030 TCCCATCACCCTTTTGGTGAGGG - Intergenic
1113745300 13:112740561-112740583 TCCGATAACCTTTTAGAGGGAGG + Intronic
1114552927 14:23544485-23544507 TCCCAGTACTTCTTTGGGGTTGG + Intronic
1115133193 14:30077606-30077628 TCCATTAACCTGTTTGGGATAGG + Intronic
1118997100 14:70846561-70846583 TCCAGTTACCTTTGTGGGGTGGG + Intergenic
1127372237 15:58352351-58352373 TCCCATCACCATCTTGGTGTTGG + Intronic
1127464662 15:59232249-59232271 TTCCATAACCTTGTTTGGGGAGG - Intronic
1131530918 15:93190990-93191012 TCACAGAACCTTTCTGAGGTTGG - Intergenic
1131722535 15:95186429-95186451 TTCTATAACATTTTTGGGTTTGG - Intergenic
1139090696 16:63643374-63643396 TCCCAAAACTTTTTTTTGGTGGG + Intergenic
1141160050 16:81623204-81623226 AACCTTAACATTTTTGGGGTGGG - Intronic
1144760314 17:17703476-17703498 TCCCATAACCTTTTTGGGGTGGG + Intronic
1149157196 17:53646301-53646323 TCCTATAACCTTCTTGTGTTTGG + Intergenic
1151114701 17:71722539-71722561 CCCCATAAGGTTTCTGGGGTAGG + Intergenic
1152285653 17:79411258-79411280 TCCCAAAGGCATTTTGGGGTGGG + Intronic
1152722392 17:81929330-81929352 CCCCAGAATCTTCTTGGGGTGGG + Intergenic
1156282038 18:35648826-35648848 TTCCATAACTTTCTTGGGCTGGG - Intronic
1157801676 18:50626467-50626489 TCCCATAGCCTTGTTGGAGGCGG + Intronic
1157871765 18:51235968-51235990 ACACATGAACTTTTTGGGGTTGG + Intergenic
1158405733 18:57157650-57157672 ACCCATAACCAGTTTGGTGTGGG + Intergenic
1161579767 19:5074345-5074367 TCCCAGACTCTTTTTGGGGCAGG + Intronic
1162692639 19:12446710-12446732 TTCTATAACCTTCTTGTGGTTGG + Intronic
1163661545 19:18580892-18580914 TCCCATACCCTTACTGGGGAGGG + Intronic
1165211048 19:34236100-34236122 TCACATAACCTCACTGGGGTAGG - Intergenic
927309612 2:21615935-21615957 TTCTATAACCTTTTTGTGCTTGG + Intergenic
929330534 2:40675600-40675622 TCCCATACCCTTATTAGGGAGGG + Intergenic
930025205 2:47025381-47025403 TCCCCTGACCCTTTTGGAGTTGG + Intronic
931437877 2:62264682-62264704 TCACATGACCTCTTTGTGGTAGG - Intergenic
931540643 2:63325690-63325712 TCCCATACCCTTATTAGGGAGGG + Intronic
932278157 2:70467027-70467049 CCCCATACCCTTTTGGGGGAGGG + Intronic
935028172 2:99297171-99297193 TCCCTGAATCTTTTTGGTGTTGG - Intronic
936050305 2:109217690-109217712 TCCGAAGACCTTTTTGGGGGAGG + Intronic
940141494 2:150496226-150496248 GCCCATAACCCTTTAGGGCTGGG - Intronic
941179969 2:162247810-162247832 TCCCATAACTTTTGAGTGGTAGG + Intergenic
942433019 2:175935699-175935721 TAACATTACCTTATTGGGGTTGG + Intronic
1169519404 20:6354950-6354972 CCACCTAACCTTATTGGGGTGGG + Intergenic
1169993042 20:11524748-11524770 TCCCATAAAATTTATGGAGTAGG + Intergenic
1170775526 20:19371680-19371702 TTCCCTACCTTTTTTGGGGTGGG + Intronic
1171779577 20:29407256-29407278 TCCTATAACATTTTTGTAGTTGG - Intergenic
1176905778 21:14499032-14499054 TCTCAAAACATTCTTGGGGTAGG + Intronic
1184197429 22:42939550-42939572 TCCCATTCCCTCTGTGGGGTTGG - Intronic
951915568 3:27797635-27797657 TCCCAAAACTTTTTTGAGGAGGG - Intergenic
951955768 3:28251529-28251551 TAATATAACTTTTTTGGGGTGGG - Intronic
952140867 3:30477579-30477601 TCCCATAACTTATGTGGGGAAGG - Intergenic
952940797 3:38443006-38443028 TCCCATATCCTTATTAGGGAGGG - Intergenic
953622779 3:44547475-44547497 TCCCATACCCTTATTAGGGAGGG - Intergenic
954083089 3:48223920-48223942 TCCCAAAACCTGCGTGGGGTCGG - Intronic
956256226 3:67285828-67285850 TCTAATAACCTTCCTGGGGTGGG + Intergenic
957044706 3:75364606-75364628 TCCCTTGACCTTTTTGGGAAGGG - Intergenic
957076487 3:75606793-75606815 TCCCTTGACCTTTTTGGGAAGGG - Intergenic
957085557 3:75673353-75673375 TCCTATAACATTTTTGTAGTTGG + Intergenic
961274803 3:125718388-125718410 TCCCTTGACCTTTTTGGGAAGGG + Intergenic
961277722 3:125741019-125741041 TCCCTTGACCTTTTTGGGAAGGG + Intergenic
961876701 3:130028643-130028665 TCCCTTGACCTTTTTGGGAAGGG - Intergenic
963409063 3:144906410-144906432 TCCCATACCCTTATTAGGGAGGG - Intergenic
968988965 4:3895846-3895868 TCCCTTGACCTTTTTGGGAAGGG - Intergenic
969024651 4:4163490-4163512 TCCCTTGACCTTTTTGGGAAAGG - Intergenic
969729172 4:8943673-8943695 TCCCTTGACCTTTTTGGGAAAGG + Intergenic
970275067 4:14390610-14390632 ACCCATAACATTTTGGGGATAGG - Intergenic
970910771 4:21272218-21272240 TCCCAACAACTTTATGGGGTCGG - Intronic
971631914 4:29003554-29003576 TCCCCTACTCTTTTTGGTGTTGG - Intergenic
976697112 4:87928491-87928513 TCCCACAACATTTTTAGGCTTGG - Intergenic
977431490 4:96936257-96936279 TACCATAACCTTTTTTGGAAGGG + Intergenic
977554667 4:98476753-98476775 TCCCATAAGCTTCTTGAGGTTGG - Intronic
979545000 4:121930405-121930427 TCTGATAACCTTTCAGGGGTGGG - Intronic
983669816 4:170223133-170223155 TTCCATACACCTTTTGGGGTTGG - Intergenic
985444449 4:190014142-190014164 TCCTATAACATTTTTGTAGTTGG - Intergenic
986027818 5:3866794-3866816 TCCCAGAGCCTTCCTGGGGTGGG + Intergenic
986308610 5:6533985-6534007 TCCAAGAACCTTCTTGGGGTCGG + Intergenic
986933443 5:12854839-12854861 TCCCATACCCTTATTAGGGAGGG + Intergenic
988357938 5:30201061-30201083 TCCCATACCCTTATTAGGGAGGG + Intergenic
988651704 5:33159016-33159038 TCTCATAAGGTTGTTGGGGTGGG + Intergenic
989766359 5:45089180-45089202 TCCCTTCACTTTTTTGGGGGTGG + Intergenic
992081104 5:73234637-73234659 TCCGATGACCTTTCGGGGGTGGG - Intergenic
992772895 5:80065136-80065158 TTCCATCACCTTTTTAGGTTAGG - Intronic
996099085 5:119429401-119429423 TCCCATACCCTTATTGGGGAAGG - Intergenic
996133215 5:119807920-119807942 TCCTATAACCTTTTTGTACTTGG + Intergenic
996227797 5:121022601-121022623 TCCCCCAACCTTTATGGGGCAGG - Intergenic
998643518 5:144038314-144038336 TCACAATACCTTTATGGGGTGGG + Intergenic
1004659315 6:17696143-17696165 TCCCTTAACTTTTTTGGGGTTGG - Intronic
1005842975 6:29756447-29756469 TCCCTTAAGCTTTCTGGGGTGGG - Intergenic
1005931908 6:30490540-30490562 TCCCATCTCCTTCTTGGGCTAGG + Intronic
1006127277 6:31847477-31847499 TCCCATGACTTTTTTTGGGGGGG + Intergenic
1007199629 6:40095992-40096014 TCCCAGAAACTTTCTGGGTTTGG + Intergenic
1009836216 6:69004785-69004807 TAACATAACGATTTTGGGGTTGG + Intronic
1010264189 6:73849948-73849970 TTCCATAACCTTCTTGTGCTTGG + Intergenic
1010387925 6:75303684-75303706 TCCAGTAACCTTTCTGGGGCAGG - Intronic
1013249830 6:108322996-108323018 TTCCATAACCTTTACGGAGTTGG - Intronic
1013459280 6:110359205-110359227 TCCCACAACCCATTTGGGGTGGG + Intergenic
1013467563 6:110430752-110430774 TCACATAATCTTTTTGGAGCAGG + Intronic
1014888060 6:126806334-126806356 TCCCAACACCTTTATGGGGTAGG + Intergenic
1015094886 6:129403440-129403462 TCACAAAATCTTTCTGGGGTAGG - Intronic
1017591747 6:155985350-155985372 TCCCGAAAAGTTTTTGGGGTGGG - Intergenic
1024507644 7:50175781-50175803 TCCCATCACCATTGTGGGATCGG - Intergenic
1028258139 7:88626439-88626461 TCACTTAACTTTGTTGGGGTAGG + Intergenic
1030658955 7:112199018-112199040 TCACATAAACTTTAAGGGGTGGG + Intronic
1033045625 7:137959607-137959629 TCCCAAAACGTTTTTGGGAATGG - Intronic
1036596267 8:10215214-10215236 CTCCATAACCTTTTTGTGGGAGG - Intronic
1037432229 8:18825864-18825886 TCCCAGGACCTTTTTGCTGTAGG - Intronic
1038407369 8:27331948-27331970 TCTCATAACCTACCTGGGGTGGG - Intronic
1039002163 8:32993967-32993989 TCCTATAACCTTTTTGTACTTGG + Intergenic
1040527827 8:48240007-48240029 TCCCATACCCTTATTAGGGAGGG + Intergenic
1040667746 8:49653546-49653568 TCCCATACCCTTATTAGGGAGGG - Intergenic
1042443967 8:68862136-68862158 TCTCACAACGTCTTTGGGGTGGG + Intergenic
1043684202 8:83067037-83067059 TCCCATAACATTTGTGGACTAGG - Intergenic
1048872074 8:138807420-138807442 TTCCAGAAACTTTTAGGGGTTGG - Intronic
1050948519 9:11558276-11558298 TCCCATTAGCTCTTAGGGGTAGG + Intergenic
1051711988 9:19940572-19940594 TTCCACAAGCCTTTTGGGGTTGG - Intergenic
1052289227 9:26823520-26823542 TCCCTTAACCCCTTTGGGGTTGG + Intergenic
1054761526 9:69008721-69008743 GCCAATCACCTTTTTGGAGTTGG + Exonic
1059791616 9:117646795-117646817 TCCCATAATCTTTATGAGCTTGG + Intergenic
1060598534 9:124862449-124862471 CCCCAGAACCTTTATGGAGTTGG - Intronic
1062001184 9:134216524-134216546 TGGCTTAACCTTTTTGGTGTTGG - Intergenic
1062629074 9:137455548-137455570 TGCCCAAACCTATTTGGGGTGGG + Intronic
1187343212 X:18439982-18440004 ACCCATAACCTTTTTGCTGGTGG + Intronic
1189613130 X:42758120-42758142 TCCCAAAAGCTTTTAGGGGGTGG - Intergenic
1192059567 X:67809927-67809949 TCCTTTAACCTTTTTGGGGGGGG - Intergenic
1192213538 X:69142668-69142690 TCCCATTACCTTTTGGGAGGTGG + Intergenic
1193084024 X:77432381-77432403 ACCCAGAACCTTTTAGGGATTGG - Intergenic
1200014646 X:153149236-153149258 TCCCATTTCTTTCTTGGGGTGGG + Intergenic
1200024955 X:153250716-153250738 TCCCATTTCTTTCTTGGGGTGGG - Intergenic
1201407401 Y:13662895-13662917 TCCCACAACCTTATTAGGGAGGG - Intergenic