ID: 1144762758

View in Genome Browser
Species Human (GRCh38)
Location 17:17716766-17716788
Sequence GTCCAGCAGCACCACACAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 222}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144762758_1144762774 28 Left 1144762758 17:17716766-17716788 CCTCCTGTGTGGTGCTGCTGGAC 0: 1
1: 0
2: 1
3: 29
4: 222
Right 1144762774 17:17716817-17716839 CTTAGCGTGGGGCACTGGTGGGG 0: 1
1: 0
2: 0
3: 4
4: 119
1144762758_1144762761 -4 Left 1144762758 17:17716766-17716788 CCTCCTGTGTGGTGCTGCTGGAC 0: 1
1: 0
2: 1
3: 29
4: 222
Right 1144762761 17:17716785-17716807 GGACTCTGTTGTGGTCACCACGG 0: 1
1: 0
2: 1
3: 14
4: 132
1144762758_1144762765 15 Left 1144762758 17:17716766-17716788 CCTCCTGTGTGGTGCTGCTGGAC 0: 1
1: 0
2: 1
3: 29
4: 222
Right 1144762765 17:17716804-17716826 ACGGCCCCGTGGGCTTAGCGTGG 0: 1
1: 0
2: 0
3: 1
4: 37
1144762758_1144762763 5 Left 1144762758 17:17716766-17716788 CCTCCTGTGTGGTGCTGCTGGAC 0: 1
1: 0
2: 1
3: 29
4: 222
Right 1144762763 17:17716794-17716816 TGTGGTCACCACGGCCCCGTGGG 0: 1
1: 0
2: 1
3: 6
4: 49
1144762758_1144762766 16 Left 1144762758 17:17716766-17716788 CCTCCTGTGTGGTGCTGCTGGAC 0: 1
1: 0
2: 1
3: 29
4: 222
Right 1144762766 17:17716805-17716827 CGGCCCCGTGGGCTTAGCGTGGG 0: 1
1: 0
2: 0
3: 3
4: 36
1144762758_1144762773 27 Left 1144762758 17:17716766-17716788 CCTCCTGTGTGGTGCTGCTGGAC 0: 1
1: 0
2: 1
3: 29
4: 222
Right 1144762773 17:17716816-17716838 GCTTAGCGTGGGGCACTGGTGGG 0: 1
1: 0
2: 0
3: 9
4: 76
1144762758_1144762772 26 Left 1144762758 17:17716766-17716788 CCTCCTGTGTGGTGCTGCTGGAC 0: 1
1: 0
2: 1
3: 29
4: 222
Right 1144762772 17:17716815-17716837 GGCTTAGCGTGGGGCACTGGTGG 0: 1
1: 0
2: 1
3: 7
4: 143
1144762758_1144762767 17 Left 1144762758 17:17716766-17716788 CCTCCTGTGTGGTGCTGCTGGAC 0: 1
1: 0
2: 1
3: 29
4: 222
Right 1144762767 17:17716806-17716828 GGCCCCGTGGGCTTAGCGTGGGG 0: 1
1: 0
2: 0
3: 2
4: 51
1144762758_1144762771 23 Left 1144762758 17:17716766-17716788 CCTCCTGTGTGGTGCTGCTGGAC 0: 1
1: 0
2: 1
3: 29
4: 222
Right 1144762771 17:17716812-17716834 GTGGGCTTAGCGTGGGGCACTGG 0: 1
1: 0
2: 0
3: 8
4: 149
1144762758_1144762762 4 Left 1144762758 17:17716766-17716788 CCTCCTGTGTGGTGCTGCTGGAC 0: 1
1: 0
2: 1
3: 29
4: 222
Right 1144762762 17:17716793-17716815 TTGTGGTCACCACGGCCCCGTGG 0: 1
1: 0
2: 2
3: 4
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144762758 Original CRISPR GTCCAGCAGCACCACACAGG AGG (reversed) Intronic
900251862 1:1675099-1675121 TTCGGCCAGCACCACACAGGCGG - Intronic
900566726 1:3335990-3336012 GTCAGGCAGCCCCACAGAGGAGG + Intronic
900915716 1:5636987-5637009 GTGAAGCAGCACCACACATATGG - Intergenic
900975638 1:6014597-6014619 GGCAAGCAGCACCACAGAGAGGG + Intronic
902529416 1:17080987-17081009 GCTCTGCAGCACCATACAGGTGG + Intronic
902531548 1:17093919-17093941 CACCAGCTGCACCAGACAGGAGG - Intronic
902930383 1:19726939-19726961 GTTCAGATGCACCCCACAGGAGG - Intronic
903321149 1:22543866-22543888 GTGCAGAAGCAGCACACAGGAGG - Intergenic
904426565 1:30427628-30427650 GTTCAGCAGCACCACATTGTAGG + Intergenic
904496995 1:30892635-30892657 GCCCACCATCACCACAGAGGTGG - Intronic
905297632 1:36964184-36964206 GTACAGCAGCCCAACACAGTTGG - Intronic
906529626 1:46516098-46516120 GTCATGCAGCACTACACAGGGGG - Intergenic
907908247 1:58804654-58804676 GTGCAGCAGTAACACACAGGAGG + Intergenic
908079810 1:60564317-60564339 GTACAGCAGGAACACACAGCAGG + Intergenic
912711839 1:111955492-111955514 ATCCAGCAGAAGCACAGAGGAGG - Intronic
915716339 1:157948578-157948600 TGCCAGAAGCACCATACAGGTGG + Intergenic
915880371 1:159664796-159664818 GTTCAGCAGCACCATGCAGTAGG - Intergenic
915928467 1:160042194-160042216 GTGCACCTGTACCACACAGGGGG + Exonic
916389580 1:164316903-164316925 TTTCTGCAGCACCACTCAGGAGG + Intergenic
916468373 1:165094930-165094952 GTTCAGCAGCACCACAGCGTAGG + Intergenic
924952205 1:248895481-248895503 GTCTAACAGCACCAGACACGAGG - Intergenic
1063367694 10:5501001-5501023 GTCCCCCAGGACCACACAAGGGG + Intergenic
1067173416 10:43925760-43925782 GCCCAGCACCATCACACTGGGGG + Intergenic
1067304573 10:45049519-45049541 GTCCTGGAGCAACACACAAGAGG + Intergenic
1067944229 10:50680238-50680260 GGCCAGGAGCACCTCACATGGGG + Intergenic
1069914263 10:71777744-71777766 ATCCAGCAGCACCTCATAGTGGG - Intronic
1070584859 10:77756487-77756509 GTTCAGTAGCACCACACTGTAGG + Intergenic
1070865724 10:79707108-79707130 GGCCAGGAGCACCTCACATGGGG + Intronic
1070879516 10:79845239-79845261 GGCCAGGAGCACCTCACATGGGG + Intronic
1071227002 10:83542349-83542371 TTGCAGCAGGACCACAAAGGAGG - Intergenic
1071632626 10:87229329-87229351 GGCCAGGAGCACCTCACATGGGG + Intronic
1071646073 10:87361547-87361569 GGCCAGGAGCACCTCACATGGGG + Intronic
1072772096 10:98150713-98150735 GTTCAGCAGCACCACGCTGTAGG - Intronic
1073533827 10:104256371-104256393 GTCCAGGAGCATGACACAGCTGG + Intronic
1073774294 10:106768764-106768786 TTCCAGCTGCACCACACCAGGGG + Intronic
1074310132 10:112315238-112315260 ATCTAGCAGCCCCACATAGGGGG - Intergenic
1075167320 10:120080332-120080354 CTCCAGCAGCACCTCACACAAGG - Intergenic
1075225320 10:120623949-120623971 ATCCAGCAGCAGCACGCAGCTGG - Intergenic
1076347943 10:129793540-129793562 CTCCAGCAGAGCCACACATGTGG - Intergenic
1076583705 10:131531735-131531757 GGCCAGCAGCTCCACACGGCGGG - Intergenic
1077311906 11:1892584-1892606 CTCCCCCAACACCACACAGGAGG + Intergenic
1080662823 11:34311233-34311255 GTCCAGCTTCACCTCACAGGTGG - Intronic
1080716995 11:34812505-34812527 GTTCAGCAGCACCATACTGTAGG + Intergenic
1081636902 11:44727363-44727385 GTCCAGCAGCACCCCCGGGGCGG - Intronic
1082238589 11:49850567-49850589 AGCCAGCAGCACCACGCTGGGGG - Intergenic
1082243557 11:49893763-49893785 AGCCAGCAGCACCACGCTGGGGG + Intergenic
1083329939 11:61892750-61892772 TTCCATCAGAACCACCCAGGAGG + Intergenic
1084624140 11:70295151-70295173 GGCCAGCCGCCCCACCCAGGAGG - Intronic
1084793981 11:71491949-71491971 AGCCAGCACCACCACACAGGAGG - Intronic
1085397000 11:76211441-76211463 GTCCAGAAGCACCACACGCCTGG - Intergenic
1086697980 11:89865583-89865605 AGCCAGCAGCACCACGCCGGCGG + Intergenic
1086708182 11:89978905-89978927 AGCCAGCAGCACCACGCCGGCGG - Intergenic
1087411278 11:97792851-97792873 GTCCAGCATCACTACACTGTAGG - Intergenic
1088080554 11:105906724-105906746 GCCCAGCTGCACCTCACAGCAGG + Intronic
1088447734 11:109950215-109950237 GTCCAGAGGCTCCACACAGCAGG + Intergenic
1090797136 11:130144899-130144921 CCCCAGCTGCACCTCACAGGCGG + Intergenic
1092526305 12:9312235-9312257 GCCCACCATCACCACACACGTGG - Intergenic
1092865709 12:12759034-12759056 GTCCAGCTGAACCACACTGTAGG - Intronic
1093142663 12:15527549-15527571 GTTCAGCAGCACCATACTGTAGG + Intronic
1099434551 12:82627897-82627919 GTTCAGCAGCACCGCACTGTAGG + Intergenic
1101364359 12:104058000-104058022 GTTCAGCAGCACCACACTGTAGG - Intronic
1102132836 12:110546047-110546069 GTCCAGCACCACAATGCAGGCGG + Exonic
1103726703 12:123000787-123000809 GTTCAGCTGCTCCACACTGGAGG + Exonic
1104091649 12:125522672-125522694 GGCCAGCAGCACCTCACAGCTGG - Intronic
1104485944 12:129151251-129151273 GTCCAGCAACATGACTCAGGCGG + Intronic
1104729534 12:131097407-131097429 GTCCTGCAGCACCCCTCAAGTGG + Intronic
1106859770 13:33893162-33893184 GTTCAGCAGCACCACACCATTGG + Intronic
1107141098 13:36999326-36999348 ATCCCGCACCTCCACACAGGCGG + Exonic
1108165588 13:47689813-47689835 GTTCTGCAGCAGCACACTGGAGG + Intergenic
1108642996 13:52400236-52400258 TTCCAGCAGCAGCAGATAGGAGG + Intronic
1111058349 13:82979737-82979759 TTTCAACAGCACCACAAAGGTGG + Intergenic
1113919856 13:113901065-113901087 GTCCAGCAGCAGCAAAGGGGTGG + Intergenic
1115279675 14:31647575-31647597 GTTCAGCAGCACCACATTGTAGG - Intronic
1115787259 14:36840073-36840095 CCACAGCAGCAGCACACAGGTGG + Intronic
1121774058 14:96578599-96578621 GTCAAGAAGCACCGCACAGGAGG + Intergenic
1122785076 14:104159835-104159857 GTACTGCAGCCCCACAGAGGAGG - Intronic
1122838107 14:104441250-104441272 TTCCAGCTGCAACACAAAGGTGG + Intergenic
1122870225 14:104635056-104635078 GGGCAGTAGCCCCACACAGGAGG + Intergenic
1124721053 15:32110989-32111011 AACCAGCACCACCCCACAGGAGG - Intronic
1127739844 15:61892261-61892283 GTTCAGCAGCACAACACTGTGGG + Intronic
1128344663 15:66845798-66845820 GTCCAGCATCTTCTCACAGGAGG - Intergenic
1128726260 15:69990743-69990765 GTGCAGCAGCAACTCAGAGGAGG - Intergenic
1130460999 15:84158127-84158149 GGACAGCAGCAGCACCCAGGAGG - Intergenic
1134036792 16:11037224-11037246 GCCCACCAGGAGCACACAGGGGG - Intronic
1134826377 16:17287673-17287695 CTCCAGGAGCCCCACACAGTGGG - Intronic
1135626458 16:23999249-23999271 GTGAAGCAGAAACACACAGGCGG + Intronic
1136541974 16:30932760-30932782 GCACAGCAGGACCACTCAGGAGG + Intronic
1136551088 16:30983002-30983024 GCCCAGCAGCTCCACTGAGGTGG + Intronic
1138113207 16:54340557-54340579 GTGCACCAGCCCCACACACGGGG - Intergenic
1139047175 16:63076056-63076078 GTTCAGCAGCACCACAGTGTAGG - Intergenic
1139157761 16:64464911-64464933 GACCAGCAGCAGTTCACAGGAGG - Intergenic
1142892186 17:2951039-2951061 GTGCAGCAGAAACACACAGGAGG - Intronic
1142900836 17:3010557-3010579 GTCCAGCAGCTAAATACAGGTGG + Intronic
1144762758 17:17716766-17716788 GTCCAGCAGCACCACACAGGAGG - Intronic
1145397688 17:22507997-22508019 GCACAGCAGCACAGCACAGGAGG - Intergenic
1145933310 17:28701051-28701073 GGCCAGCACCACCCCACAGTCGG + Exonic
1148403438 17:47388031-47388053 GTTCAGCAGTACCACACTGTAGG - Intronic
1148865905 17:50628453-50628475 CTGCAGTAGCACCAGACAGGTGG - Intergenic
1149636273 17:58172488-58172510 GTCCAGCAGCACCATGCTGTAGG + Intergenic
1150474566 17:65465137-65465159 GTCCATCAACAACAGACAGGTGG - Intergenic
1151682956 17:75631296-75631318 TTCTAGCAGCAGCACACATGGGG - Intronic
1151856790 17:76727183-76727205 GTGCAGCAGCACCCGCCAGGAGG + Exonic
1152060857 17:78074142-78074164 GCACCTCAGCACCACACAGGGGG + Intronic
1153847198 18:9060745-9060767 GGGCATCAGCACCACACAGAAGG + Intergenic
1154191148 18:12231826-12231848 GAAGAGCAGCACCACGCAGGTGG + Intergenic
1154353119 18:13603697-13603719 GTGCTGCAGGAGCACACAGGAGG - Intronic
1155113702 18:22742621-22742643 GTTCAGCAGCACCACACTGTAGG + Intergenic
1155978007 18:32152761-32152783 GTTCAGCAGCACCACACTGTAGG - Intronic
1156922112 18:42534432-42534454 GACCAGCAGCACCCAACAGAAGG - Intergenic
1157111211 18:44821932-44821954 CTCCAGCAGCACCACACAAGAGG - Intronic
1157643147 18:49238638-49238660 GTGCAACAGCACCACCAAGGGGG + Intronic
1158781998 18:60663139-60663161 GTCCAGCAGTGCCACCCGGGGGG - Intergenic
1159301445 18:66575660-66575682 GTACAGCATCAGCACACAAGGGG + Intronic
1159643685 18:70892349-70892371 GGCCAGCAGCACCAGAAAGAGGG + Intergenic
1159822329 18:73161465-73161487 GTCCAGCAGCAGGACACATGGGG + Exonic
1161988930 19:7673009-7673031 GGCCACCAGCATCAGACAGGGGG - Intergenic
1162932673 19:13965221-13965243 GTACAGTAACACCACAAAGGGGG + Intronic
1164547512 19:29181224-29181246 GGCCACCTGCACCACACTGGCGG + Intergenic
1166217482 19:41345002-41345024 GTGCCACAGGACCACACAGGTGG - Intronic
1166751161 19:45164567-45164589 GACAAGCAGCATCACACTGGGGG + Intronic
1167374252 19:49102680-49102702 GTCCAGCAGCTCTCCAGAGGTGG + Intronic
1168701456 19:58442027-58442049 GGCCAGCAGCACCTCCCAGAGGG - Intergenic
925100147 2:1237465-1237487 GTCAATCAGAAGCACACAGGTGG + Intronic
926295412 2:11565281-11565303 GGCCAGCACCACCACACACCAGG - Intronic
928475058 2:31617307-31617329 GTCCTGATGCAGCACACAGGAGG + Intergenic
934784460 2:96995039-96995061 TTCCTGTAGAACCACACAGGAGG - Intronic
934991461 2:98924748-98924770 GTCCAGCACCTCCACCCAGCAGG + Intronic
935242745 2:101192508-101192530 GTCCAGCATCTCCTCTCAGGGGG - Intronic
938344404 2:130556958-130556980 GACCAGCAGCAGGACACAGAGGG - Intergenic
938345429 2:130563764-130563786 GACCAGCAGCAGGACACAGAGGG + Intergenic
939847586 2:147267534-147267556 ATTCAGCAGCACCACACTGTAGG - Intergenic
941360610 2:164546856-164546878 GTTCAGCAGCACCACACGATAGG + Intronic
942717983 2:178915919-178915941 GTCCATCTGCATCACTCAGGGGG + Intronic
948163657 2:235844757-235844779 GACCAGCAGGACCAGCCAGGTGG - Intronic
949034821 2:241811559-241811581 GTCCAGCACCCCCAGACAGAGGG - Intronic
1169532178 20:6497090-6497112 ATCCAGGAGCACCTCACAGAGGG - Intergenic
1170863492 20:20130774-20130796 GTTCAGCAGCACCACACTGTAGG - Intronic
1170889005 20:20363898-20363920 GGCCGCCAGCACCTCACAGGTGG + Intergenic
1172053801 20:32140133-32140155 GTCGAGCAGATCCACACTGGAGG + Intronic
1172181530 20:33006773-33006795 ATCCAACAGGACCACAGAGGTGG - Intergenic
1172611368 20:36255304-36255326 GTCCAGTAGAACCCCCCAGGGGG + Intronic
1173482030 20:43409324-43409346 GTTCATCATCACCACACGGGAGG + Intergenic
1173522397 20:43709749-43709771 GGCCAGGAGCCCCAGACAGGTGG - Intronic
1175520180 20:59597774-59597796 ACCCTGCAGCAACACACAGGAGG - Intronic
1178264891 21:31133647-31133669 CAGCAGCTGCACCACACAGGTGG - Intronic
1178317198 21:31576584-31576606 TTCCAGCAGCATCATACAAGTGG + Intergenic
1178331109 21:31692415-31692437 GTCCAGCTGCCCCACCCAGAGGG + Exonic
1178617886 21:34149563-34149585 GTCCTGCAGCACTACACTTGGGG - Intergenic
1179804959 21:43831540-43831562 GCTCAGCAGCACCACAGACGCGG + Intergenic
1179943436 21:44654477-44654499 GCACAGCAGAGCCACACAGGGGG + Exonic
1180149312 21:45939681-45939703 GTCCAGGAGCGACCCACAGGTGG - Intronic
1181752868 22:25001795-25001817 GGCCAACAGGACCACACAGCAGG - Intronic
1182706900 22:32288428-32288450 GTCCACCATCACCTCACTGGTGG - Intergenic
1183693218 22:39403166-39403188 GACCATCAGCTCCACAAAGGCGG - Intronic
1184395222 22:44231542-44231564 GTCCACCATCACCTCACTGGTGG - Intergenic
1184978031 22:48076942-48076964 GTCCTTCACCACCACTCAGGTGG + Intergenic
1185009970 22:48307339-48307361 TTCCTGCAGCACCACAGACGTGG - Intergenic
1185373720 22:50472544-50472566 GTGAAGCAGTAGCACACAGGAGG - Intronic
950682015 3:14592114-14592136 ATCCAGCAGCTCCACATAGAGGG + Intergenic
950725017 3:14911651-14911673 TTCCAGCACCAGCACACACGAGG - Intronic
952972684 3:38662633-38662655 GTTCAGCAGCAACACACTGTAGG + Intergenic
954681339 3:52347594-52347616 GTCCATGAGCACCACACGAGAGG - Intronic
955221937 3:57030200-57030222 GTCCACCAGAGCCACACACGGGG + Intronic
959679826 3:109082040-109082062 GTTCAGCAGCATCACACTGCAGG + Intronic
961639399 3:128355410-128355432 TTACAGGAGCACCACACAGGCGG + Intronic
962763309 3:138538286-138538308 GTTCAGCAGCACCACACTGTAGG + Intronic
964537124 3:157735175-157735197 GTTCAGCAGCTTCACACAGTAGG + Intergenic
965867386 3:173221343-173221365 GTTCAGCAGCACCATATAGTAGG - Intergenic
967969546 3:194988805-194988827 TTCCAGCAGCCCCACAAAGAAGG - Intergenic
968134474 3:196211199-196211221 GACCAGCAGCACCACATTGAAGG + Exonic
969248831 4:5954121-5954143 GGACAGCAGCAGCACACAGTAGG + Intronic
971797346 4:31244696-31244718 ATTCAGCAGCACCACACTGTAGG + Intergenic
973701033 4:53537653-53537675 TGCCAGGAGCCCCACACAGGTGG + Intronic
977987859 4:103405851-103405873 GTTTAGTAGCAGCACACAGGTGG + Intergenic
980066209 4:128191628-128191650 GTTCAGCAGGACCACACTGTAGG - Intronic
980178428 4:129375280-129375302 GTCCCGCGGCAGCACCCAGGTGG + Intergenic
983655622 4:170080587-170080609 GTTCAGCAGCACCACACTGCAGG + Intronic
985574832 5:669247-669269 GTCCAGCAGCATCCCCCAGGGGG + Intronic
985761549 5:1751696-1751718 ATCCAGCAGCAGGAGACAGGAGG - Intergenic
985952213 5:3230993-3231015 GCCCAGAAGCACCACAGAGCGGG - Intergenic
985968984 5:3360551-3360573 ATGCAGCAGGATCACACAGGAGG - Intergenic
986721627 5:10564460-10564482 GGCCAGCAGCACCATGCCGGCGG - Exonic
989335790 5:40315364-40315386 TTCCAGCATCACAACAAAGGAGG + Intergenic
991011596 5:61888409-61888431 GTTCAGCAGCACCACACTTTAGG + Intergenic
992411543 5:76510457-76510479 GCCAGGCAGCAGCACACAGGTGG + Intronic
992654976 5:78900202-78900224 ATTCAGCAGCACCACACTGTAGG - Intronic
995582098 5:113613083-113613105 TGCTAGCAGCACCACACATGTGG - Intergenic
995854089 5:116574658-116574680 GGCCAGCATCACCACACCCGCGG - Exonic
996750132 5:126879911-126879933 GCCCAGCAGTGCCACACAGCTGG + Intronic
999412402 5:151363277-151363299 GTTCAGCAGCACCACACTGTAGG - Intergenic
1003079623 6:3010744-3010766 GTTCAGCAGCACCACACTGTAGG + Intronic
1007510561 6:42371451-42371473 ATTAAGCAGCCCCACACAGGAGG + Intronic
1007703446 6:43777647-43777669 GTCCAACATCACCATGCAGGTGG + Exonic
1007983976 6:46188889-46188911 CACCAGCAGCATCACAGAGGGGG + Intergenic
1010584435 6:77641483-77641505 GCCCAGCAGCAGCATCCAGGTGG + Intergenic
1013147017 6:107403771-107403793 GTCCAGCAGCTGCACACAGCAGG + Intronic
1014130789 6:117829862-117829884 CTTCAGCAGCACCACACAGTAGG + Intergenic
1016187973 6:141221388-141221410 GTCCAGGGGCAGCACACAGCAGG + Intergenic
1016615356 6:146041622-146041644 GTTCAGCAGCACCACATTGTAGG - Intronic
1017186425 6:151605412-151605434 GTTCAGCAGGACCACACTGTAGG - Intronic
1017934132 6:158989534-158989556 GTTCAGCAGCACCACATTGTAGG - Intronic
1019304775 7:328051-328073 GACCAGCATCACCCCACAAGAGG - Intergenic
1020996988 7:15278122-15278144 GTCCCACAGCTCTACACAGGAGG + Intronic
1021771830 7:24010811-24010833 GTTCAGCAGCACCACACTGTAGG - Intergenic
1023734130 7:43219942-43219964 CCCCAGCAGCACCACACTGGAGG - Intronic
1024724696 7:52179466-52179488 GTCTGGCAGCATCCCACAGGAGG + Intergenic
1027562561 7:79750832-79750854 GGCCAGCACCTCCACACCGGTGG + Intergenic
1027825727 7:83113140-83113162 TTACAGCAGCCCCACACAGAAGG + Intronic
1028241390 7:88425384-88425406 GTCCATCCGCAGCACAAAGGTGG + Intergenic
1029517295 7:101033318-101033340 GTCTGTCAGCACCACACTGGTGG + Exonic
1032011894 7:128352347-128352369 GTCCAGCAGCGCCAGGCAGGGGG + Exonic
1034400471 7:150858443-150858465 GGCCACCAGGACCACACGGGCGG + Intronic
1035615313 8:995788-995810 CCCCAGCATCACCAAACAGGGGG - Intergenic
1036728754 8:11243395-11243417 GTGCAGGAGCCCCACAAAGGAGG + Intergenic
1037662210 8:20937609-20937631 GCCCACCACCTCCACACAGGAGG - Intergenic
1039791087 8:40875991-40876013 CTCCACCAGCACCACAGAAGAGG + Intronic
1042891551 8:73617275-73617297 ATGCAGCAGCACCACACCTGAGG + Exonic
1042908500 8:73799664-73799686 GTCAGGAAGCACCACACAGGAGG + Intronic
1044191515 8:89324227-89324249 GTCCAGTAGGAGCACACTGGAGG - Intergenic
1045654268 8:104370737-104370759 GCACAGCAGCAGCACACAGAAGG - Intronic
1047343519 8:124005409-124005431 GTCCAGAAGCAGCACACAGCAGG - Intronic
1048308012 8:133297063-133297085 CTCCAGCGGCACCGCACGGGCGG + Exonic
1048902375 8:139051094-139051116 GGCCAGCCCCTCCACACAGGTGG - Intergenic
1048969940 8:139639839-139639861 GACCAGCACCACTACACAGCTGG + Intronic
1049177406 8:141202378-141202400 GGCCAGCTGCCCCACCCAGGAGG - Intergenic
1049815731 8:144598462-144598484 GGCCAGCAGGACCAGACAGACGG + Intronic
1053613765 9:39742976-39742998 AGCCAGCCACACCACACAGGAGG + Intergenic
1053871805 9:42500933-42500955 AGCCAGCCACACCACACAGGAGG + Intergenic
1054239750 9:62599421-62599443 AGCCAGCCACACCACACAGGAGG - Intergenic
1054553882 9:66633948-66633970 AGCCAGCCACACCACACAGGAGG - Intergenic
1056557048 9:87698277-87698299 GTGCAGCAACACCACAGAGATGG - Intronic
1057216073 9:93229606-93229628 TCCCAGCAGCGCCACACAGTAGG - Intronic
1057570942 9:96203923-96203945 GGCCAGCAGCTCCAGTCAGGGGG + Intergenic
1058670509 9:107357200-107357222 GGCCAGCAGCACTAGCCAGGAGG + Intergenic
1058851128 9:109013146-109013168 GTCCCGGAGCCCCACACAGGCGG + Intronic
1059750492 9:117242861-117242883 TTCCTGCAGAACCACACAGAGGG - Intronic
1059969816 9:119654392-119654414 GTCCACCAAGACCACACAGATGG + Intergenic
1060166955 9:121425315-121425337 GTTCAGCAGCACCACGCTGTGGG + Intergenic
1062427139 9:136511246-136511268 GGCCAGCACCACCTCACACGTGG + Exonic
1185724922 X:2411942-2411964 GGACAGAAGCACCACACTGGAGG + Intronic
1187082971 X:16010753-16010775 GTACAACAGTACCACAGAGGAGG - Intergenic
1188903135 X:35759739-35759761 GTTCAGTAGCACCACACTGTAGG - Intergenic
1190498193 X:51047997-51048019 GTTTAACAGCACCACACAGTGGG + Intergenic
1190508151 X:51149158-51149180 GTTTAGCAGCACCACACAGTAGG - Intergenic
1190558672 X:51665160-51665182 ATCCAGCAGGAGCACACAGATGG - Intergenic
1192521931 X:71809823-71809845 GTTCAGCAGCGCCACACTGTAGG - Intergenic
1193605812 X:83566938-83566960 CTGCAGCAGCACCACAGAAGGGG - Intergenic
1194714611 X:97275338-97275360 GGCCAGCTGCCCCACCCAGGAGG - Intronic
1194714636 X:97275386-97275408 GGCCAGCCGCCCCACCCAGGAGG - Intronic
1196882779 X:120213718-120213740 GTTTAGCAGCACCACACTGTAGG + Intergenic
1196987106 X:121286368-121286390 GTTCGGCAGCACCACACGGTAGG - Intergenic
1197260612 X:124313209-124313231 GTTCAGCAGCACCACACTGCAGG + Intronic
1201359010 Y:13126500-13126522 CTCCAGCAACAGCACACACGGGG - Intergenic