ID: 1144762873

View in Genome Browser
Species Human (GRCh38)
Location 17:17717262-17717284
Sequence AAGTTTGAGCCCTGGGAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 212}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144762862_1144762873 5 Left 1144762862 17:17717234-17717256 CCCCTTGGTGGCTTCCTGGCCCA 0: 1
1: 0
2: 3
3: 23
4: 229
Right 1144762873 17:17717262-17717284 AAGTTTGAGCCCTGGGAACAAGG 0: 1
1: 0
2: 1
3: 18
4: 212
1144762860_1144762873 9 Left 1144762860 17:17717230-17717252 CCAGCCCCTTGGTGGCTTCCTGG 0: 1
1: 0
2: 5
3: 44
4: 355
Right 1144762873 17:17717262-17717284 AAGTTTGAGCCCTGGGAACAAGG 0: 1
1: 0
2: 1
3: 18
4: 212
1144762858_1144762873 11 Left 1144762858 17:17717228-17717250 CCCCAGCCCCTTGGTGGCTTCCT 0: 1
1: 1
2: 2
3: 99
4: 445
Right 1144762873 17:17717262-17717284 AAGTTTGAGCCCTGGGAACAAGG 0: 1
1: 0
2: 1
3: 18
4: 212
1144762859_1144762873 10 Left 1144762859 17:17717229-17717251 CCCAGCCCCTTGGTGGCTTCCTG 0: 1
1: 0
2: 1
3: 30
4: 384
Right 1144762873 17:17717262-17717284 AAGTTTGAGCCCTGGGAACAAGG 0: 1
1: 0
2: 1
3: 18
4: 212
1144762856_1144762873 18 Left 1144762856 17:17717221-17717243 CCACTGTCCCCAGCCCCTTGGTG 0: 1
1: 0
2: 10
3: 151
4: 1154
Right 1144762873 17:17717262-17717284 AAGTTTGAGCCCTGGGAACAAGG 0: 1
1: 0
2: 1
3: 18
4: 212
1144762853_1144762873 29 Left 1144762853 17:17717210-17717232 CCTCAGCCACACCACTGTCCCCA 0: 1
1: 0
2: 7
3: 222
4: 3534
Right 1144762873 17:17717262-17717284 AAGTTTGAGCCCTGGGAACAAGG 0: 1
1: 0
2: 1
3: 18
4: 212
1144762854_1144762873 23 Left 1144762854 17:17717216-17717238 CCACACCACTGTCCCCAGCCCCT 0: 1
1: 0
2: 19
3: 163
4: 1360
Right 1144762873 17:17717262-17717284 AAGTTTGAGCCCTGGGAACAAGG 0: 1
1: 0
2: 1
3: 18
4: 212
1144762864_1144762873 3 Left 1144762864 17:17717236-17717258 CCTTGGTGGCTTCCTGGCCCAGG 0: 1
1: 0
2: 4
3: 53
4: 361
Right 1144762873 17:17717262-17717284 AAGTTTGAGCCCTGGGAACAAGG 0: 1
1: 0
2: 1
3: 18
4: 212
1144762863_1144762873 4 Left 1144762863 17:17717235-17717257 CCCTTGGTGGCTTCCTGGCCCAG 0: 1
1: 0
2: 2
3: 31
4: 250
Right 1144762873 17:17717262-17717284 AAGTTTGAGCCCTGGGAACAAGG 0: 1
1: 0
2: 1
3: 18
4: 212
1144762868_1144762873 -9 Left 1144762868 17:17717248-17717270 CCTGGCCCAGGGGTAAGTTTGAG 0: 1
1: 0
2: 1
3: 13
4: 121
Right 1144762873 17:17717262-17717284 AAGTTTGAGCCCTGGGAACAAGG 0: 1
1: 0
2: 1
3: 18
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144762873 Original CRISPR AAGTTTGAGCCCTGGGAACA AGG Intronic
900781340 1:4619894-4619916 AAGTTTGAGGCCAGGCAAGATGG + Intergenic
901536866 1:9888223-9888245 GAGTTTGAGCCTGGGCAACAAGG + Intronic
902330665 1:15729753-15729775 TGGTTAGAGGCCTGGGAACAGGG - Intronic
903687510 1:25142711-25142733 AAGTTTGGGTCCAGGGACCACGG + Intergenic
904134318 1:28299544-28299566 AAGTTTGAGCCTGGGCAACATGG - Intergenic
905348405 1:37327566-37327588 AAGGGTGGGCCCAGGGAACATGG + Intergenic
908740713 1:67324554-67324576 GAGTTTGAGCCTGGGTAACATGG - Intronic
910132313 1:83922877-83922899 AAGTATGAGGGCTTGGAACAGGG + Intronic
910281013 1:85501708-85501730 AACTTTGATCCCTGGGAAAAGGG - Intronic
912505703 1:110154439-110154461 AAGTTAGTGCCCCGGGAAAAGGG + Intronic
912513581 1:110204367-110204389 AAGTTTGGGCCCTGGGTGGAGGG + Intergenic
912595748 1:110874187-110874209 AAGTATGAGGATTGGGAACAGGG + Intronic
913436094 1:118849368-118849390 AAGTTTGAGCCCTTGAATGAGGG + Intergenic
913547958 1:119888046-119888068 AAGTTGGAGCACTGGACACATGG - Intergenic
915515002 1:156407618-156407640 GAGGTTGAGCCCTGGGCACGGGG - Intronic
916687525 1:167160911-167160933 AAGTTCCACCCCTTGGAACAAGG + Intergenic
917185152 1:172345736-172345758 AACTGGGAACCCTGGGAACAGGG - Intronic
918016510 1:180638765-180638787 AAGATTGAGGACTTGGAACATGG + Intronic
918627747 1:186677743-186677765 ATGTTTGAGCCCTGGGGATCAGG + Exonic
919588726 1:199472257-199472279 AGGTTTGAGCCCAGATAACAGGG + Intergenic
920347378 1:205315057-205315079 AAGTTTGTGCTCTGGCATCAGGG + Intronic
922820227 1:228479487-228479509 CAGTGTGAGCCCTGGGAGCCTGG - Intergenic
923285858 1:232494465-232494487 TTGTTTCAGCCATGGGAACATGG + Intronic
923844877 1:237719056-237719078 GAGTTTGAGCCTGGGCAACATGG + Intronic
1065218819 10:23475518-23475540 AAGTTTTAGCCTGGGAAACATGG - Intergenic
1065455877 10:25906176-25906198 AAGTTTGAAGCCTGAGATCAGGG - Intergenic
1065764935 10:29020045-29020067 AAGTTTGTGCCCAGGGACAAAGG + Intergenic
1065893260 10:30138902-30138924 AAGTCTGAGGCCAGGGAGCAAGG + Intergenic
1067225710 10:44374479-44374501 AGGCCTGAGCCCTGGGTACAGGG - Intronic
1070486465 10:76936732-76936754 AAGGCAGAGCCCTGGGAAAAAGG + Intronic
1070991075 10:80732676-80732698 AAAGCTGAACCCTGGGAACAGGG + Intergenic
1071796114 10:89008060-89008082 AAATATGAACCCTAGGAACAGGG + Intronic
1072916252 10:99538972-99538994 AATTTTGTGCCCTGGGGTCAAGG - Intergenic
1074319142 10:112384706-112384728 GAGTTTGAGTCTGGGGAACACGG - Intronic
1080292357 11:30685099-30685121 TTGTTTGAGCCCAGGGACCATGG + Intergenic
1081295370 11:41380162-41380184 AAATTTGAGCCCCGTGAACAGGG + Intronic
1082057091 11:47827159-47827181 GAGTTTGAGACCAGGCAACATGG + Intronic
1083049338 11:59762961-59762983 AAGGTTGAGCCTGGGGAAGATGG - Intronic
1084519932 11:69656900-69656922 GAGTTTGAGAGTTGGGAACAAGG - Intronic
1085030224 11:73266577-73266599 AAGTTTTAGCCCCAGAAACAAGG - Intronic
1085539415 11:77253230-77253252 AGGTTTGAGCCTAGGGCACAGGG + Intronic
1086161591 11:83727721-83727743 AAGTTTAAGACTAGGGAACATGG + Intronic
1090876290 11:130791610-130791632 TGGATTCAGCCCTGGGAACATGG + Intergenic
1094218044 12:27965781-27965803 AAGTTTGAGGCTTTGGTACAAGG + Intronic
1096605232 12:52760309-52760331 AAGCTGGTGCCCTGGGAGCATGG - Intergenic
1097915072 12:65012683-65012705 CCATTTGAGCCCTGGGAAGAAGG + Intergenic
1098788622 12:74791484-74791506 AAGCTAGAGCCATGGGAGCAGGG + Intergenic
1103825129 12:123731889-123731911 AAAATTGAGCCCTGGGCCCAGGG - Intronic
1104527996 12:129542177-129542199 ATCGTGGAGCCCTGGGAACATGG - Intronic
1104729074 12:131095064-131095086 CTGAGTGAGCCCTGGGAACAGGG + Intronic
1105588976 13:21773531-21773553 AAGTTTGAGACCAGCCAACAGGG - Intergenic
1105957463 13:25297842-25297864 AAGTTTTAGCCTGGGCAACACGG + Intergenic
1107682107 13:42862776-42862798 AAGCTTAAGCCCTGGTTACATGG + Intergenic
1108119917 13:47173878-47173900 AAGTTGGAGCCCTCAGAAAAGGG - Intergenic
1108957543 13:56179767-56179789 GAGTTTGAGCCCGGGTAACATGG + Intergenic
1109338687 13:61026339-61026361 AGGTTTGGCCACTGGGAACATGG + Intergenic
1111267656 13:85838881-85838903 AGGTTTGAGCCTAGGGAACCTGG + Intergenic
1111768577 13:92567155-92567177 AATTTTTAGCACTGGGAACATGG - Intronic
1112850232 13:103696991-103697013 GAATTTCAGCCCAGGGAACAAGG + Intergenic
1113412824 13:110105321-110105343 CAGTCTGTGCCCTGGGAACAGGG - Intergenic
1113904755 13:113814045-113814067 AAGTGAGAGCCCTGGGGACTCGG - Exonic
1114465355 14:22918451-22918473 AAGATTGAGCCCTGGGACACTGG - Intronic
1114555814 14:23561713-23561735 AATATGGAGCCCTGGGCACATGG + Intronic
1116596370 14:46852305-46852327 AAGTGTGATCCCTGGGAAATGGG + Intronic
1117997655 14:61493033-61493055 AAGTTGGAGGCATGGGAAGAGGG + Intronic
1118401520 14:65383927-65383949 AAGTTGGAGCCATGGGAAAGGGG + Intergenic
1118838122 14:69490916-69490938 AAGTTTGTGCCCGGGGAAGAGGG + Intronic
1120576808 14:86192191-86192213 AAGTCTGAGGCCTGAGAACCAGG + Intergenic
1121089235 14:91169875-91169897 AATTTTCAGCCCTGGCACCAGGG - Intronic
1122138581 14:99648702-99648724 CAGTCAGAGCCCTGGGAGCATGG + Intronic
1122553753 14:102565144-102565166 GAGTTTGAGCCCGGCCAACATGG - Intergenic
1122773243 14:104106381-104106403 AAGGTGCAGCCGTGGGAACAGGG + Intronic
1122970802 14:105151428-105151450 CAGTGTGAGCCGTGGGAATAAGG + Intronic
1123956660 15:25342847-25342869 AGGTTAGAGCACTGGCAACAGGG + Intronic
1125341506 15:38680022-38680044 AAGTTTTAGTCATTGGAACAGGG + Intergenic
1127997901 15:64164552-64164574 GAGTTTGAGCCTGGGCAACATGG + Intergenic
1128305420 15:66595081-66595103 AAGTGTAAGCCCAGGAAACATGG + Intronic
1129059564 15:72849855-72849877 AAGTTAGAGCACAAGGAACATGG - Intergenic
1129639137 15:77355861-77355883 AAGTTACAGCCCTGGAAAAATGG + Intronic
1129681126 15:77659033-77659055 AGGTTGGAGCCCTGGGGGCAAGG + Intronic
1130555357 15:84918678-84918700 AGGTTTGGGCTCTGGGAGCAAGG - Intronic
1131377031 15:91933947-91933969 AAGTAAGAACCCTGGGGACAGGG - Intronic
1132393114 15:101453287-101453309 AGGTATGGGCCCTGGGCACATGG - Intronic
1136144963 16:28311123-28311145 AAAGCTGAGCCCTGGGAACCAGG + Intronic
1136488289 16:30587201-30587223 GAGTTTGAGACCAGGCAACATGG + Intergenic
1136547529 16:30964178-30964200 AAGCTTGTGTCCTGGGAGCAGGG - Exonic
1137353118 16:47731885-47731907 AAGGTTGAACCCTGGGAGAAAGG - Intergenic
1138142414 16:54580260-54580282 ATGTTTGAGCTCTGGGAAGTGGG - Intergenic
1141485316 16:84334902-84334924 GAGTTCGAGCCTTGGCAACATGG + Intergenic
1141766859 16:86064555-86064577 AAGTCTCGGCTCTGGGAACAAGG - Intergenic
1143715785 17:8767815-8767837 TAGATTGAGCTCTGGGGACATGG + Intergenic
1144378885 17:14673157-14673179 AAGATTGAGCCCTGTTATCATGG - Intergenic
1144762873 17:17717262-17717284 AAGTTTGAGCCCTGGGAACAAGG + Intronic
1148256430 17:46136732-46136754 AATTTTGAACCCTGGGAAGAAGG - Intronic
1150146997 17:62777515-62777537 GAGTTTGAGACCAGGCAACATGG + Intronic
1153071057 18:1105090-1105112 TAGTCTGAGATCTGGGAACAGGG + Intergenic
1155170309 18:23262353-23262375 ATCTGTGAGCCCTGGGAACCTGG - Intronic
1156175601 18:34541971-34541993 AAGTTTGTGCATGGGGAACAGGG + Intronic
1157281826 18:46351295-46351317 AAGTTTGAGGGCTGGGGGCAGGG + Intronic
1158588588 18:58761448-58761470 AAGTTTGAGACCTGGGCCCCAGG - Intergenic
1160464431 18:79064479-79064501 GAGTTGGAGCCCTGGGAGCAAGG - Intergenic
1160513553 18:79466049-79466071 AAGTGTGGCCCCTGGGCACAGGG + Intronic
1161224345 19:3136229-3136251 AGGCTTGAGTGCTGGGAACAGGG - Exonic
1161425435 19:4200243-4200265 AACATTGAGACCTGGGAGCAGGG - Intronic
1161908221 19:7173517-7173539 AAGTTTGAGACCAGCCAACATGG - Intronic
1163695929 19:18763429-18763451 AGGTTTGTAGCCTGGGAACAAGG + Intronic
1163785456 19:19272864-19272886 ATGTTTGTGGCCTGGGAAGAAGG - Intronic
1164889677 19:31812581-31812603 AGGTGTGTGCCTTGGGAACATGG - Intergenic
1166206784 19:41275286-41275308 TAGTTTGAGCCTGGGTAACATGG + Intronic
1168353909 19:55690744-55690766 AAGTTTGAGGGGTGGGGACAAGG + Intronic
925608250 2:5681260-5681282 AGATTTGGTCCCTGGGAACATGG + Intergenic
925955825 2:8963035-8963057 GAGTTTGAGCCTGGGCAACATGG + Intronic
926253468 2:11169617-11169639 GTGCTGGAGCCCTGGGAACACGG - Intronic
927509706 2:23636830-23636852 AAGTTTTAGCGCTCAGAACATGG + Intronic
928690438 2:33793215-33793237 ACGGTTGATCCCTTGGAACAAGG + Intergenic
931157777 2:59654811-59654833 TTGTGTGAGCCTTGGGAACAAGG + Intergenic
931469487 2:62524139-62524161 GAGTTTGAGCCTGGGCAACATGG - Intergenic
933700371 2:85251016-85251038 GAGTTAGAGGCCTGAGAACATGG + Intronic
933808952 2:86020344-86020366 GAGTTTGAGCCTGGGCAACATGG + Exonic
934750239 2:96789279-96789301 ACGTTTGAGCCCAGGGCAGAAGG + Intronic
934908277 2:98225583-98225605 AAGTTCTAACCATGGGAACAAGG + Intronic
937087037 2:119178489-119178511 GAGTTTGAATCCTGGGCACATGG - Intergenic
937344520 2:121116385-121116407 AGGTTGGAGGCCTGGGAGCAAGG + Intergenic
937976243 2:127583651-127583673 AGGTTGGAGTTCTGGGAACAGGG + Intronic
938584815 2:132679766-132679788 AATCTTGAGCACTGGGAAGATGG + Intronic
941832589 2:169978504-169978526 AGGTTTGAGCCCAGGGTGCAGGG + Intronic
942660422 2:178258299-178258321 AAGTTTGAGACCAGCCAACATGG - Intronic
943050756 2:182910455-182910477 CAGTTGGAGCCTTGGGAACAAGG + Intronic
943733361 2:191326889-191326911 AAGTTGTAGCCCTAGGAGCATGG + Intronic
944378589 2:199078400-199078422 AAGTTTTAGCCATTGCAACATGG + Intergenic
945003678 2:205378585-205378607 AACTTCCAGCCCTGGGAGCATGG - Intronic
945268142 2:207911526-207911548 AAGTTTGGGCCCTTGGATCTTGG - Intronic
945834506 2:214822755-214822777 AAGTTTAAGCCATGGGAAGGAGG + Intergenic
946241494 2:218358664-218358686 GAGTTTGAGCCTGGGCAACATGG + Intronic
947357437 2:229311641-229311663 ACTTTTGAGCCCAGGGAAGAAGG + Intergenic
1172641336 20:36442158-36442180 AGGTCTGGGCCCTGGGACCATGG - Intronic
1172782926 20:37447838-37447860 AAGATGGGGCCCTGGGGACATGG - Intergenic
1173208970 20:41017049-41017071 AAGTTTGACACCTGGGGGCAAGG + Intergenic
1174366660 20:50060712-50060734 AAGTATCAGCCCGGGCAACATGG - Intergenic
1180581838 22:16845547-16845569 AAGACTCAGCCCTGGGCACAGGG + Intergenic
1183444199 22:37842269-37842291 AAGACAGTGCCCTGGGAACAAGG + Intronic
1183953958 22:41368306-41368328 GAGTTGGAGCCCTGGGGACCTGG - Intronic
951056709 3:18155446-18155468 AAGTTCAACCCTTGGGAACAGGG - Intronic
951539820 3:23771819-23771841 AATTTTGAGTGCTGGGAAAATGG + Intergenic
952942867 3:38456598-38456620 AAGTCTGAGCCCAGGGTGCAGGG + Intronic
953095823 3:39775904-39775926 AAGTTTGATACCTGGCAACATGG - Intergenic
954925280 3:54228608-54228630 AAGTCAGAACCCTGAGAACAAGG + Intronic
954982820 3:54761643-54761665 TAGTTTGAGACCTGGGAGCAGGG - Intronic
956979073 3:74614949-74614971 CAGTTAGGGCCCTCGGAACACGG + Intergenic
959565151 3:107826079-107826101 CAGTTTGAGGCCTGGGATCACGG + Intergenic
962863407 3:139425511-139425533 AAGCTTGAGAGCTGGGAACAAGG + Intergenic
963116729 3:141736688-141736710 AAGTTTGAACTGGGGGAACATGG - Intergenic
963742616 3:149095731-149095753 AATATTGTGCTCTGGGAACAAGG + Intergenic
967989579 3:195121078-195121100 GTGTTTGGGCCCTGGGAGCATGG - Intronic
968946064 4:3664957-3664979 AAATTGGATCCCTGGGCACAGGG - Intergenic
971734504 4:30428917-30428939 AAATATGAGCCCTGGGCACTGGG - Intergenic
975071947 4:70152116-70152138 TAGTTTGCACCCTGGAAACAAGG + Intronic
976564289 4:86535803-86535825 AAATTTCAGCCCTGGGAATTTGG - Intronic
978525053 4:109656574-109656596 AAGTTTGAGCCCAGGTAACATGG - Intronic
978763975 4:112385374-112385396 AAGTTTGAGCCCAGCTCACAAGG + Intronic
980294054 4:130887143-130887165 AAGTTTTAGCCATGTAAACAGGG - Intergenic
981211113 4:142106479-142106501 AAATTTTAGCCCGGGCAACATGG - Intronic
982174892 4:152696310-152696332 CAGTTTTAGCCCTTGGAACTAGG - Intronic
984870723 4:184322705-184322727 AAGTTAAAGCCCTGGGCACAAGG + Intergenic
985782309 5:1877815-1877837 AACTTGGACTCCTGGGAACATGG - Exonic
986768345 5:10948673-10948695 AAGTCTGAGTCCTGGGACCAGGG + Intergenic
988262828 5:28910844-28910866 AAGTGTAAGCCCTGTGAAAAGGG - Intergenic
988366405 5:30305905-30305927 AAGTCTGAGCCCTGAGAAGCAGG - Intergenic
988775662 5:34476045-34476067 AAGTTTGAGCACTGCAACCAAGG + Intergenic
988994314 5:36700216-36700238 GATTTTGAGCCCTTGAAACATGG - Intergenic
992999561 5:82366965-82366987 GAGTTTGAGCCTGGGCAACATGG + Intronic
994724805 5:103422032-103422054 AAGTTTAAGCCTTTGGAAAAGGG + Intergenic
995177787 5:109198582-109198604 AAGTGTCAGCCCTGGGAGAAAGG - Intergenic
995402676 5:111759459-111759481 GAGTTTGAGACCGGGCAACATGG - Intronic
998026246 5:138819092-138819114 AGGTTTGGGCCCAGGGAGCAGGG + Intronic
1001266876 5:170280195-170280217 AAATCTGAGCCCAGGGAATAAGG - Intronic
1001422719 5:171599651-171599673 AACATTCAGCCTTGGGAACAAGG - Intergenic
1001777405 5:174338965-174338987 CATTTTGAGCCCTTCGAACATGG - Intergenic
1002360167 5:178664235-178664257 AAGTTTGAGACCAGGCAACATGG - Intergenic
1003331235 6:5130290-5130312 ACGTGTGAGCCCTGGGAATCTGG + Intronic
1004453760 6:15771861-15771883 AAGTTTGAGTCATGGGGAGAAGG + Intergenic
1004927120 6:20426710-20426732 AAGTTTAAGCCCTGGGCATGAGG - Intronic
1005492056 6:26356093-26356115 AAGTTTCAGGCCAGGGAAGACGG - Intergenic
1005608396 6:27499007-27499029 AATTTTGATACCTGGGAAAAGGG + Intergenic
1006334432 6:33413212-33413234 GGGCTGGAGCCCTGGGAACATGG - Exonic
1006791880 6:36706933-36706955 AATTTTAAGCCCGGGCAACATGG - Intronic
1007370724 6:41425456-41425478 AAGTCTCAGCCCTTAGAACAGGG - Intergenic
1007709244 6:43811387-43811409 AAGGCTGAGCCCTGGGCAGAGGG - Intergenic
1007832190 6:44647160-44647182 GAGTTTGAGCCTGGGCAACATGG - Intergenic
1007922921 6:45626890-45626912 AGGTTTGAGGTCTGGGAAGAGGG + Intronic
1008684035 6:53904134-53904156 AAAGTAGAGACCTGGGAACAGGG - Intronic
1010094335 6:72022333-72022355 AAGTTTGAACAAGGGGAACAGGG - Intronic
1014687911 6:124526636-124526658 ATTTTTGAGCCCAGGGAACCAGG + Intronic
1015811113 6:137163257-137163279 AAGTCTGAGCCCTGAGCAAAGGG - Intronic
1018474347 6:164124863-164124885 AACTTTGAGCCTTGGGATGAGGG + Intergenic
1019662145 7:2230585-2230607 AAGTTGGAGCCCTGGAAGCCTGG + Exonic
1020399200 7:7756028-7756050 AGCTTTGAGCCCTGGGAGCGGGG + Intronic
1021487513 7:21183556-21183578 GAGTTTGAGACCAGGCAACATGG - Intergenic
1021962284 7:25885014-25885036 ATGGTTGAGGCCTGGGAACTGGG - Intergenic
1023095920 7:36659617-36659639 AAGTTTGGGCCTTTGAAACATGG + Intronic
1024897942 7:54281786-54281808 AAGTTGGAGTGCTGGAAACAGGG + Intergenic
1025237105 7:57242012-57242034 GAGTTTGAGCCTGGGCAACATGG - Intergenic
1029461874 7:100699387-100699409 AGGTCTGAGCCCTGGGAGGATGG - Intergenic
1031485148 7:122316053-122316075 AAGTCTGAGCCCTGAGTACTTGG - Intergenic
1033264549 7:139873562-139873584 AGCTTTGAGCCAGGGGAACAGGG + Intronic
1035231173 7:157466906-157466928 TCTTTTGAGCCCTGGGAACCTGG + Intergenic
1036927613 8:12922370-12922392 AGGGTGGAGCCATGGGAACATGG + Intergenic
1037052568 8:14394534-14394556 AAGTTTGATTCCTGAGATCATGG + Intronic
1037274876 8:17167163-17167185 CAGTTTGAGCCCTCTGAGCAGGG + Intronic
1038945933 8:32360171-32360193 AGGTTTGGCCCCTGGAAACATGG - Intronic
1039182370 8:34880683-34880705 GACTTTGACCCCTGGGAGCATGG - Intergenic
1039231477 8:35453581-35453603 AAATTTGTATCCTGGGAACAGGG + Intronic
1039548611 8:38427878-38427900 AAGTTAGAGTAATGGGAACAGGG - Intronic
1039575446 8:38620136-38620158 AAGTTGGAACCATGGGAACGGGG - Intergenic
1040332027 8:46390595-46390617 AAGTTTCAGGCTTTGGAACATGG + Intergenic
1040468025 8:47713185-47713207 TAGTTTGATCCCTGGAAAAAGGG - Intronic
1042760890 8:72270350-72270372 AAGTTGCAGCCTTGGGAACTTGG - Intergenic
1045218600 8:100175005-100175027 ACGTTCCAGCCCTGGCAACATGG - Intronic
1047774745 8:128060522-128060544 GAGTTTAAACTCTGGGAACAGGG + Intergenic
1047966136 8:130048234-130048256 AATTTTGAGCCCTGACATCAGGG - Intergenic
1050021840 9:1292578-1292600 AAATTGGAGCCATGGGAACCTGG + Intergenic
1053130105 9:35609752-35609774 AAGTTGGAGGCCTGAGACCACGG - Exonic
1060662571 9:125413109-125413131 AAGACTGAGCCCATGGAACAGGG - Intergenic
1061651573 9:132054613-132054635 GAGTTTGAGACCTGGCAACATGG - Intronic
1061681661 9:132245474-132245496 AAATATGAGCTCTGGGGACAAGG - Intergenic
1062004654 9:134233148-134233170 CAGTTTGTGCCCGGGAAACAGGG + Intergenic
1185754000 X:2638251-2638273 AAATGTGGACCCTGGGAACAAGG - Intergenic
1192203632 X:69082444-69082466 AAATGTGGGCCCTGAGAACATGG + Intergenic
1192488547 X:71552588-71552610 GAGTTCAAGACCTGGGAACATGG - Intronic
1194638547 X:96375176-96375198 GAGTTTGAGCCCTGGAACCTTGG - Intergenic
1196814791 X:119656472-119656494 AGGTTTGAGCAATGGGAAGACGG + Intronic
1199293692 X:146133845-146133867 ACGCTTTAGCCCGGGGAACATGG - Intergenic