ID: 1144763944

View in Genome Browser
Species Human (GRCh38)
Location 17:17722925-17722947
Sequence TGGCGTCGGGGATCGCACCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 36
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 26}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144763944_1144763951 2 Left 1144763944 17:17722925-17722947 CCGCGGTGCGATCCCCGACGCCA 0: 1
1: 0
2: 0
3: 9
4: 26
Right 1144763951 17:17722950-17722972 AGGACTAACCCCCACCCGCCAGG 0: 1
1: 0
2: 0
3: 4
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144763944 Original CRISPR TGGCGTCGGGGATCGCACCG CGG (reversed) Intronic
901051585 1:6428309-6428331 TGGCGGTGGGGACCCCACCGCGG + Exonic
902482734 1:16720052-16720074 TGGCGGTGGGGATCCCACCGCGG - Intergenic
1072253612 10:93600830-93600852 TGGCGTCCGGGGGCGCACGGCGG + Intronic
1073875144 10:107914436-107914458 TGGGGTCGGGGAGCGAAGCGGGG - Intergenic
1076991716 11:279238-279260 TGGCGCCGGAGAACCCACCGCGG - Intronic
1102101347 12:110281260-110281282 TGGCGTCGGGGACGGCTCCGCGG - Intronic
1104270810 12:127280816-127280838 CGGCGGCTGGGAACGCACCGCGG - Intergenic
1123676434 15:22714605-22714627 AGCCGGCGGGGATCCCACCGCGG - Intergenic
1124328649 15:28788866-28788888 AGCCGGCGGGGATCCCACCGCGG - Intergenic
1133268571 16:4599528-4599550 GGGCACCGGGGATGGCACCGGGG - Intronic
1143125708 17:4639964-4639986 TGGGGTGGGGGGTCGCACAGCGG - Intronic
1144763944 17:17722925-17722947 TGGCGTCGGGGATCGCACCGCGG - Intronic
1152345437 17:79748177-79748199 GGGCGGCGGGGGTCGCACCCGGG + Intergenic
1166873872 19:45885819-45885841 TGGCGGCGCGGATCGCACGTCGG - Exonic
926289973 2:11520961-11520983 GGGCGTCTGGGATCCCACTGCGG + Intergenic
944367363 2:198938148-198938170 TGGCATCCGGGATTGCACCCTGG + Intergenic
946044560 2:216810472-216810494 GGGCGGCGAGGAACGCACCGGGG + Intergenic
947589858 2:231379440-231379462 TGGCCTCGGGCATCCCACCTGGG + Intergenic
1170889255 20:20364985-20365007 TGCCGTCGGGGAGCGCGCCGGGG - Intergenic
954838708 3:53493898-53493920 TGGCGTCGCGGAAGGCAACGGGG - Intergenic
963605870 3:147411183-147411205 TGACGCCCGGGATCCCACCGAGG - Intronic
968556194 4:1247675-1247697 TGGCGGCTGGGCCCGCACCGCGG - Intronic
969276286 4:6137920-6137942 TGGCGTTGGGGGTCCCACCATGG + Intronic
995530475 5:113087060-113087082 TGGCGGCAGGGCTGGCACCGGGG - Intronic
1004561955 6:16760534-16760556 TGGCCTCGGGGACCGCGCGGGGG - Intronic
1005742230 6:28802803-28802825 AGGTGTCGGGGATCGAACCGAGG + Intergenic
1029724914 7:102396431-102396453 GGGCCTCGGTGGTCGCACCGAGG - Exonic
1031317496 7:120274634-120274656 TGGCGGCGGGGGTGGCAGCGTGG + Exonic
1049798055 8:144505527-144505549 GGGCGGCGGGGAACGCAACGTGG - Intronic
1049798073 8:144505569-144505591 GGGCGGCGGGGAACGCACCGTGG - Intronic
1049798091 8:144505611-144505633 GGGCGGCGGGGAACGCACCGTGG - Intronic
1049798109 8:144505653-144505675 GGGCGGCGGGGAACGCACCGTGG - Intronic
1049798125 8:144505695-144505717 GGGCGGCGGGGAACGCACCGTGG - Intronic
1050537756 9:6645361-6645383 TGGCGGCGGGGACAGCGCCGCGG - Exonic
1062059268 9:134486243-134486265 TGGCAACGGGGATCGCACCCAGG + Intergenic
1062352780 9:136147402-136147424 TGGCGGAGGGGATGGCACAGGGG + Intergenic