ID: 1144765111

View in Genome Browser
Species Human (GRCh38)
Location 17:17728341-17728363
Sequence CTTGGAGACCAGAGGGAAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 682
Summary {0: 1, 1: 1, 2: 3, 3: 70, 4: 607}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144765111 Original CRISPR CTTGGAGACCAGAGGGAAGA CGG (reversed) Intronic
900584152 1:3424492-3424514 CGTGGAGGCCAGATGGAGGAAGG + Intronic
900603172 1:3511855-3511877 CTTGGTGAGCAGAGGGTCGAGGG - Intronic
901412959 1:9097804-9097826 CTTGGAGGTCAGAAGGAAGATGG - Intergenic
901460913 1:9391149-9391171 CTTGGAGGCTAGAAGCAAGATGG - Intergenic
901479082 1:9511785-9511807 CTTGGAGATTAGAAGCAAGATGG - Intergenic
901702269 1:11051932-11051954 CTTGGAGGCTAGAAGCAAGATGG + Intergenic
902296010 1:15467495-15467517 ATTGGAGACCCGCGTGAAGACGG - Exonic
902298899 1:15487394-15487416 GTTGGAGACCCGCGTGAAGATGG - Exonic
902654537 1:17858484-17858506 AATGGAGACCAGTGGGAAGTTGG + Intergenic
902837801 1:19058143-19058165 TCTGGAGACCTGAGGGAAGGGGG + Intergenic
903406336 1:23099927-23099949 GTGAGGGACCAGAGGGAAGAGGG - Intronic
904397276 1:30230305-30230327 CTTGGAGAACAGAGGTGGGAGGG - Intergenic
904568890 1:31445733-31445755 CATTGAGACCAGAGGGAAAGAGG - Intergenic
904793947 1:33044843-33044865 CTTAGGGAAGAGAGGGAAGAAGG + Intronic
905004599 1:34699534-34699556 AGTGGAGACCAGAGTGCAGAGGG + Intergenic
905304312 1:37007003-37007025 CTTGCACAGCAGAGGGAAGACGG - Intronic
906084448 1:43119494-43119516 CTTTGAGAGCTGAGAGAAGAAGG - Intergenic
906591003 1:47023980-47024002 CTTGGGCACCAGAAGGTAGATGG + Exonic
906858182 1:49330909-49330931 CATGGAGAACAGAGGAAAGCAGG + Intronic
907289910 1:53407125-53407147 CATGGAGACCAGATGACAGAGGG + Intergenic
908472317 1:64456207-64456229 GTGGGAGACAAGAGGGCAGAGGG - Intergenic
908600021 1:65728452-65728474 CTTGCAGATCAGAGAGAAGAGGG - Intergenic
909175923 1:72358507-72358529 CTTGCAGACCAGAAGGGAGTGGG + Intergenic
909375777 1:74940060-74940082 TTTGAAGAACAGAGGCAAGAAGG + Intergenic
909538083 1:76760625-76760647 CCTGGGGAGCAGAGGGAAGTGGG + Intergenic
909685250 1:78340675-78340697 TTTGGATAACAGTGGGAAGATGG + Intronic
910309701 1:85809445-85809467 CTTGGAGGTCAGAAGTAAGATGG + Intronic
910438088 1:87226010-87226032 AGTGGAGACCTGAGGCAAGAGGG + Intergenic
911164618 1:94713725-94713747 CTGGGAGAACAGAGAGAATAAGG - Intergenic
911437287 1:97877255-97877277 GATGGTGACCAGTGGGAAGATGG + Intronic
911485221 1:98497194-98497216 CTTGGAGGTCAGAAGCAAGATGG - Intergenic
911691335 1:100838254-100838276 CTTGGAGATTAGAAGCAAGATGG - Intergenic
912020779 1:105107170-105107192 CTTGGAGATTAGAAGCAAGATGG - Intergenic
912452053 1:109773284-109773306 CTGGGAGACCATGGGGAGGACGG + Intronic
912530125 1:110314542-110314564 CCTGGAGCCCAGACGGAGGATGG + Intergenic
914930089 1:151923156-151923178 CTTGGAGGGTAGAGGCAAGATGG + Intergenic
915651261 1:157312645-157312667 CCTGGAGACCAAAGAGGAGAAGG - Intergenic
915822675 1:159042102-159042124 GCTGGACACCAGAGGGAAAATGG - Intronic
916755956 1:167770561-167770583 ATAGGAAACCAGAAGGAAGAGGG + Intronic
917071879 1:171160157-171160179 CTTGGAGATTAGAAGAAAGATGG + Intronic
918452486 1:184673056-184673078 CTTGGAGGTTAGAGGCAAGATGG - Intergenic
918690015 1:187468002-187468024 CTTGAAGGCCAAAGGAAAGATGG + Intergenic
919630364 1:199954871-199954893 GCTGGAGAGCAGAGGGAAGAGGG - Intergenic
919827936 1:201517231-201517253 CTTGGAGATTAGAAGCAAGATGG - Intergenic
919936291 1:202252850-202252872 CTTGAAAGTCAGAGGGAAGAAGG + Intronic
920067078 1:203276683-203276705 CCTGGAGACCTGAGGGACCAAGG + Intergenic
920602918 1:207347234-207347256 CATGGATACCAAAGGGAAAATGG + Intronic
920704536 1:208242050-208242072 CCTGGAGGTCAGAGGGGAGAGGG + Intronic
920805022 1:209224865-209224887 GTTGGAGCACAGAGGGCAGAGGG - Intergenic
921568063 1:216744732-216744754 CTAGAAGAACAGATGGAAGATGG - Intronic
921815970 1:219563789-219563811 CTTTGAGAAGAGAGGGGAGAAGG + Intergenic
922234336 1:223712258-223712280 TTTGCAGCCCATAGGGAAGAAGG - Intronic
922600685 1:226850090-226850112 CTTGGAGATTAGAAGCAAGATGG + Intergenic
923388185 1:233486680-233486702 CTTGAAAATCAGAAGGAAGATGG - Intergenic
923388424 1:233489235-233489257 CTTGGAGGTCAGAAGCAAGATGG - Intergenic
923875813 1:238045776-238045798 CTTGGGGAGAAGAGGGGAGAGGG + Intergenic
924712095 1:246537905-246537927 CATGGTGACAAAAGGGAAGATGG - Intergenic
1063306475 10:4907159-4907181 CTTGGAGGCCAGAAGGCAGTAGG - Intergenic
1063881679 10:10538254-10538276 CTGGCAGACCAGAGGGAGGCAGG - Intergenic
1063954594 10:11254825-11254847 CTCGGAGACGAGAGGGAAGGAGG + Intronic
1064837757 10:19553839-19553861 CTAGGAGACGAGAGAGAATAAGG - Intronic
1064858395 10:19797391-19797413 CTTGGAGGTCAGAAGCAAGATGG - Intergenic
1065145455 10:22763648-22763670 GATGGAGCCCAGAGGGCAGATGG + Intergenic
1065281574 10:24144319-24144341 CTTGTAGAGCAAAGGGCAGAGGG + Intronic
1065775028 10:29111716-29111738 CTTGGATATCAGAGGCAAAAAGG + Intergenic
1065880826 10:30036513-30036535 CTTGGAGGCCACTGAGAAGATGG - Intronic
1065901387 10:30211143-30211165 CTTGGAGAATAGAAGCAAGATGG + Intergenic
1065973589 10:30823889-30823911 GTGGGAGAACAGAGGAAAGATGG - Intronic
1066441722 10:35445679-35445701 TTTGGAAACCAGAGGGAAGGAGG + Intronic
1066668746 10:37814707-37814729 CTTGGAGGCCAGAAGGCAGTGGG - Intronic
1067038714 10:42936971-42936993 CTGGGAGACCATAGGGAAGTGGG + Intergenic
1068297884 10:55098565-55098587 CTTGGCAAATAGAGGGAAGATGG - Intronic
1068429985 10:56919269-56919291 AATGGAAACCTGAGGGAAGAAGG - Intergenic
1068531716 10:58196204-58196226 CTTGGCAACCAGTGGGAAGATGG + Exonic
1068985978 10:63108086-63108108 CTTGGAGGTCAGAAGCAAGATGG - Intergenic
1069417703 10:68215628-68215650 ATTGGGGATCAGAGGGAAAATGG + Intergenic
1069797199 10:71061061-71061083 CTTGGCGACAAGAGTGAAGCTGG + Intergenic
1069856201 10:71442589-71442611 CATTGAGGCCAGAGGGGAGAAGG - Intronic
1069935071 10:71909797-71909819 CTTGGAGGTTAGAGGGAAGATGG + Intergenic
1070526747 10:77302165-77302187 CTTGGAAATCAGAGGGACCAGGG - Intronic
1070750035 10:78958581-78958603 CTTGGAGAGCAGAGAGAGCAGGG + Intergenic
1071152954 10:82656953-82656975 CTTGGAGGCCAGCGTGATGAGGG - Intronic
1071730169 10:88240084-88240106 CTTTGAAAACAGAGCGAAGAAGG - Intergenic
1072584787 10:96772060-96772082 CTTGGAGGTCAGAAGCAAGATGG - Intergenic
1072634876 10:97171405-97171427 CTTGGAGAGCAGATTGGAGAGGG - Intronic
1073379165 10:103065024-103065046 GATGGAGTCCAGAGGGAAGATGG + Intronic
1073510548 10:104039991-104040013 CTGGGGGACCTGAGGGAAAAAGG + Exonic
1073538835 10:104301551-104301573 CCTGGAGAAAAGAGGGAAGGAGG + Intronic
1073664137 10:105510533-105510555 CTTGGAGTTCAGAAGCAAGATGG + Intergenic
1074983992 10:118641477-118641499 CTGGGAGACCAGAGGAAGGGAGG + Intergenic
1075068482 10:119305296-119305318 CTCAGAGACCTGGGGGAAGATGG + Intronic
1075713205 10:124541790-124541812 GTTGGAGACCAGAGTGGAGTGGG + Intronic
1075809645 10:125215633-125215655 CTGGAGGAGCAGAGGGAAGAAGG + Intergenic
1076722669 10:132399496-132399518 CTTGCAAAGCAGAGGGGAGAGGG + Intronic
1076922432 10:133461295-133461317 CTGGGAGACCACAGGTCAGATGG - Intergenic
1077083800 11:737411-737433 CAGTGAGACCAGAGGGAACACGG - Intergenic
1077219963 11:1411462-1411484 CTTGGGGAGCAGAGGGAGGAAGG - Exonic
1077235166 11:1478489-1478511 CCAGGAGGCCAGAAGGAAGAAGG - Intronic
1077915824 11:6611003-6611025 CTTGCGGTCCTGAGGGAAGAGGG + Exonic
1078453407 11:11456936-11456958 CATGGAGACAAGTGGGAAGTGGG + Intronic
1078860336 11:15240753-15240775 GTGGTAGAACAGAGGGAAGAGGG - Intronic
1079090057 11:17474666-17474688 CCAGGAGAGCAGAGGGAACACGG - Intronic
1079322561 11:19463762-19463784 TTTGGAGGCAAGAGGGAACAGGG + Intronic
1079585730 11:22124927-22124949 CTTGCAGGCCAGAAGGAAAAGGG + Intergenic
1079699906 11:23532365-23532387 CCTGGAGACCAGTGGGATGAGGG - Intergenic
1080235355 11:30062320-30062342 CATGGAGGCCAGAAGGAAGTGGG + Intergenic
1080428651 11:32178738-32178760 CTTTGGGAGCAGAGGGCAGAAGG - Intergenic
1081118759 11:39237699-39237721 ATCGGAGACCAGAAGGCAGAAGG - Intergenic
1081174220 11:39906893-39906915 CATAGATACCAGAGGGAAGTTGG + Intergenic
1081395867 11:42585528-42585550 CTTGGAGATTAGAAGCAAGATGG + Intergenic
1081406413 11:42703861-42703883 TTTGGAGAAGAAAGGGAAGATGG + Intergenic
1081525568 11:43925323-43925345 CCTGGTGACAAGAGGGAACATGG + Exonic
1081630843 11:44688558-44688580 GCGGGAAACCAGAGGGAAGAAGG + Intergenic
1081874945 11:46402066-46402088 CTGGGGGACCAGAGAGAAGTGGG - Intronic
1082274628 11:50208121-50208143 CTTGGAGGTCAGAAGCAAGATGG - Intergenic
1083025314 11:59545833-59545855 CTTGGAGGTTAGAGGCAAGATGG + Intergenic
1083028378 11:59570092-59570114 AATGGAGGGCAGAGGGAAGAAGG - Intergenic
1083381030 11:62268690-62268712 ATCAGAGACCAGAGGGCAGATGG - Intergenic
1083504418 11:63142408-63142430 CTTGGAGGTCAGAAGCAAGATGG - Intronic
1084101870 11:66955205-66955227 CTGAGAGGACAGAGGGAAGAGGG + Intronic
1084461433 11:69298705-69298727 CGTGGAGACCAGGAGGAAGCTGG + Intronic
1084609289 11:70191907-70191929 CATGGAGACAGGAGGGCAGAGGG - Intergenic
1085153021 11:74267319-74267341 CTGGGAGAGAACAGGGAAGAAGG + Intronic
1085181435 11:74540178-74540200 GTAGGAGACCGGAGGGAGGAAGG + Intronic
1085260502 11:75201941-75201963 CTTGGTCACCAGAGGGACCAAGG - Intronic
1085261285 11:75206167-75206189 CTGGGAAACAAGAGGGATGAAGG - Exonic
1085681085 11:78575450-78575472 GTTGGAGGGCAGAGGGAAGAGGG - Intergenic
1086845860 11:91748943-91748965 CTTGGAGGTCAGAAGCAAGATGG - Intergenic
1088801762 11:113313411-113313433 CTTGGAGATGAGAAGCAAGATGG - Intergenic
1088823198 11:113474221-113474243 CTTGAAGAGCAGAGGTAAGAGGG - Intronic
1089258169 11:117204984-117205006 CTTGGGGACCGAAGGGAAAAAGG + Exonic
1089873491 11:121697346-121697368 CTGGCAGAGCAGAGGGGAGAGGG - Intergenic
1090088253 11:123670403-123670425 CTTCTGGACCAGAGGGAAAAGGG + Intergenic
1090402571 11:126458493-126458515 CTTGGGCACCAGCAGGAAGAGGG - Intronic
1090582759 11:128178079-128178101 CTTGGAAAACAGGGGCAAGATGG - Intergenic
1090729105 11:129554421-129554443 ATTGGAAACTGGAGGGAAGATGG + Intergenic
1091198293 11:133750378-133750400 ATTGAAGACCAGAGGCAGGAAGG + Intergenic
1091249653 11:134132245-134132267 CTTGGAGGCCAGAAGGAAGTGGG + Intronic
1091388628 12:111446-111468 CCTAGAGAACAGAGGAAAGAGGG - Intronic
1091846491 12:3660021-3660043 CGTGGAGATCAGCGGGAACAGGG - Intronic
1092115959 12:6005689-6005711 CTTGCAGGCCAGAAGGGAGATGG + Intronic
1092193636 12:6536471-6536493 CTAAGAGACAAGAGGCAAGAAGG - Intronic
1092709710 12:11322797-11322819 CTTGGGGACAAGAGAGAATATGG + Intergenic
1094763041 12:33557227-33557249 CTTGGAGGCTAGAAGTAAGATGG - Intergenic
1095193992 12:39290932-39290954 CTTGGAGTCAACAGGGGAGAGGG - Intergenic
1095595183 12:43950825-43950847 CTTGTGGAACAAAGGGAAGATGG + Intronic
1096340214 12:50791588-50791610 CTTGGAGCCCAATGTGAAGAAGG + Intronic
1096353474 12:50919077-50919099 CTTGGAGGCCAGAGGCAACATGG + Intergenic
1096666520 12:53169969-53169991 CATGGAGACGAGAGGGATGAAGG + Intronic
1096710709 12:53452887-53452909 CTTGGATAACCGAGGGGAGAGGG + Intronic
1097861715 12:64524406-64524428 CTTGGAGGACAGAGGGAAGAGGG - Intergenic
1098765682 12:74485966-74485988 CTTGGAGATTAGAAGCAAGATGG - Intergenic
1098995736 12:77117401-77117423 CTTAGAGAGCAGGGGGAAGATGG - Intergenic
1099222929 12:79935299-79935321 CTGGGCCACCAGAGGGAAGCGGG + Intronic
1100102853 12:91130515-91130537 CTTGGATACTAGAGGGCAGTGGG - Intergenic
1100376628 12:94022432-94022454 CGGGGAGACCAGTGAGAAGATGG + Intergenic
1101830851 12:108255311-108255333 GTGGGAGACAAGAGGGAGGAAGG + Intergenic
1102453474 12:113057423-113057445 CCAGGAGACAAGAGGGGAGAGGG - Intronic
1102574861 12:113849926-113849948 CTGGGAGACTGGAGGAAAGAGGG + Intronic
1102667459 12:114587608-114587630 CTTTGAGAACAGAGGAAATAGGG + Intergenic
1102925420 12:116822271-116822293 CTTGGTTCCCAGAGGGAAGCAGG + Intronic
1103680941 12:122693076-122693098 CTTGGAGTTCAGAAGCAAGATGG + Intergenic
1104265670 12:127230626-127230648 CTTGGAGGCTAGAAGTAAGATGG - Intergenic
1104852790 12:131885615-131885637 CTTGGAGGTTAGAAGGAAGATGG + Intergenic
1105617770 13:22035567-22035589 CTGGGAAATCAGAGTGAAGAAGG - Intergenic
1105690750 13:22837148-22837170 CTTGGCAACCAGTGGGAAGATGG + Intergenic
1106353512 13:28956944-28956966 GTTGGGGGACAGAGGGAAGAAGG + Intronic
1107592862 13:41926629-41926651 CTTGGAAATCACAGAGAAGATGG + Intronic
1107600091 13:42004364-42004386 CATGGAGACAGGAGGGAAGAAGG - Intergenic
1107868510 13:44726667-44726689 CTTGGAGGTCAGAAGCAAGATGG - Intergenic
1110371304 13:74743559-74743581 CCTGGGGACCAGGGGGAAGTGGG - Intergenic
1111096022 13:83516901-83516923 CTCGGAGAGCAGAGGGGAGCCGG - Intergenic
1111319281 13:86603973-86603995 CTTACAGATCAGAGGGAAGAGGG - Intergenic
1112571757 13:100599582-100599604 CTTGGGGACCAGAAGAAAAAAGG + Intergenic
1112660557 13:101502868-101502890 CTTGGAGACAAGAGAGAATGAGG + Intronic
1112966499 13:105202949-105202971 CCTAGAGACCAAAGGAAAGAAGG - Intergenic
1113159520 13:107364484-107364506 CTTGAACACCAAAGTGAAGACGG - Intronic
1113601919 13:111575620-111575642 TCTGGGGACCAGAGAGAAGATGG - Intergenic
1113918420 13:113888880-113888902 CTTGGAGGTCAGAAGCAAGATGG - Intergenic
1114556042 14:23562900-23562922 CTTGGCCACCAGAGGGCAGTGGG - Intronic
1114558678 14:23576633-23576655 GTGGGAGAGCAGAGTGAAGACGG + Intronic
1114935426 14:27531181-27531203 CTTGGAGATCAGAAGCAAAATGG - Intergenic
1115856392 14:37633735-37633757 CATTGACACCAGAGGGAAGAGGG - Intronic
1115862628 14:37705696-37705718 CCTGGAGACCAGTGAAAAGAAGG + Intronic
1116565982 14:46444736-46444758 CCAGGAGACCAGAGGACAGAGGG - Intergenic
1117305890 14:54472776-54472798 CTTGGAGGTCAGAAGCAAGATGG - Intergenic
1117320088 14:54613306-54613328 GGTGGAGACCAGAGGGAGGTGGG + Intronic
1117561584 14:56945632-56945654 CTTGGAGGCCACAGAGAAGTAGG + Intergenic
1118378876 14:65201505-65201527 CCTGGAGCCCAGAGAGAAGGGGG + Intergenic
1120213542 14:81658171-81658193 CTTGGAAAGTAGAGGGTAGAGGG + Intergenic
1120760580 14:88281114-88281136 ACTGGAGTCCAGAGGGAAAAGGG - Intronic
1121658304 14:95614892-95614914 CTTGGAGGTCAGAAGCAAGATGG + Intergenic
1122294821 14:100699455-100699477 CCTGGTGGCCAGTGGGAAGAGGG + Intergenic
1122787788 14:104171910-104171932 CTCGGAGTCCTGGGGGAAGACGG - Exonic
1122921934 14:104883907-104883929 CTTGGAGGCCAGCGGGGAGCAGG + Exonic
1123402527 15:20002802-20002824 CATGGTGAGCAGGGGGAAGAAGG + Intergenic
1123511865 15:21009456-21009478 CATGGTGAGCAGGGGGAAGAAGG + Intergenic
1123846668 15:24310381-24310403 CTTGGAGATTAAAGGCAAGATGG + Intergenic
1124039898 15:26091724-26091746 CTTGGAGATTAGAAGCAAGATGG + Intergenic
1124230748 15:27944267-27944289 CTTGAAGGCTAGAGGCAAGAAGG - Intronic
1124449016 15:29767810-29767832 CTTTGAGACCAGAAGGAAAGAGG - Intronic
1124832330 15:33161330-33161352 ATTGGAGGGCAGATGGAAGAGGG + Intronic
1124849364 15:33321429-33321451 CATGGAAAGCAGAGGGAAAAAGG - Intronic
1125766737 15:42141403-42141425 CGAGGAGACCAGAAGGCAGAAGG + Exonic
1126046629 15:44647745-44647767 CTTGGAGACAACAGGAAATAGGG + Intronic
1127145266 15:56016711-56016733 CTTGGAGGTCAGAAGCAAGATGG + Intergenic
1128034073 15:64507775-64507797 AATAGAGAGCAGAGGGAAGATGG + Intronic
1128341839 15:66827712-66827734 CAAGGAGAACAGAGGAAAGAAGG - Intergenic
1128904177 15:71452455-71452477 CTTTGAGAGCTGAGGGAGGAGGG - Intronic
1129174826 15:73832463-73832485 CTTTGGGAGCAGAGGGAATATGG - Intergenic
1129294505 15:74592498-74592520 CTTGGGGACCAGAAGGAAACTGG + Intronic
1129464377 15:75715773-75715795 GTTGGAGGGCAGAAGGAAGAAGG - Intergenic
1129720868 15:77877239-77877261 GTTGGAGGGCAGAAGGAAGAAGG + Intergenic
1129929319 15:79396554-79396576 ACTGGAGCCCAGAGGGAAGATGG - Intronic
1129956195 15:79638772-79638794 CTTGGATACTAGAGGATAGAGGG + Intergenic
1130093809 15:80841393-80841415 CCTGGAGTCCACAGGCAAGAAGG + Intronic
1130191540 15:81741016-81741038 CTTGGAGACTAAAGGGGAGTAGG + Intergenic
1130980866 15:88811067-88811089 CTTGGAGAACCAAGGGAGGAAGG - Intronic
1131283474 15:91039498-91039520 TTTGGAGACAAGAGAAAAGAGGG - Intergenic
1131414085 15:92236967-92236989 CTTGGAGTTCAGGAGGAAGATGG - Intergenic
1131585613 15:93689761-93689783 CTTGGAGCCTAGAGGGAACAGGG + Intergenic
1131688109 15:94793204-94793226 CCTGGAGAGCAGAGGCAAGAGGG - Intergenic
1132879037 16:2153163-2153185 CATGGAGACCAGCGCCAAGACGG + Exonic
1133342933 16:5049039-5049061 AATGGAAACCAGAAGGAAGAAGG + Intronic
1133435417 16:5775306-5775328 CTTGAAGGGAAGAGGGAAGAGGG - Intergenic
1134432568 16:14224653-14224675 CTTGAAGACCAGAAGGCAGTGGG + Intronic
1135012039 16:18890202-18890224 CTTGGAGAATAGAGGTAAAAAGG - Intronic
1135889585 16:26345176-26345198 CCTGGAGACTGGAGGGAACATGG + Intergenic
1136704159 16:32172341-32172363 CTTGGAGACGGGAGGGCCGATGG + Intergenic
1136749866 16:32624995-32625017 CTTGGAGGCCAGAAGGCAGTAGG - Intergenic
1136763750 16:32757065-32757087 CTTGGAGACGGGAGGGCCGATGG - Intergenic
1136804349 16:33113321-33113343 CTTGGAGACGGGAGGGCCGATGG + Intergenic
1137521930 16:49202007-49202029 CTTGGGGAACATGGGGAAGAGGG - Intergenic
1138270699 16:55693896-55693918 CTCTGAGACCAGAGGAAACATGG - Intronic
1138483298 16:57318394-57318416 CTTCCAGAGCAGAGGCAAGAGGG - Intergenic
1138499587 16:57431351-57431373 CTTGGAGTCCAGGGTAAAGAAGG + Intronic
1138558107 16:57784694-57784716 CTTGGAGACCTTGGGGAAGTGGG + Intronic
1138605213 16:58084235-58084257 CTTGGAGATTAGAAGCAAGATGG - Intergenic
1138695551 16:58809607-58809629 CCTGGAGAACAGATGGAAGGAGG - Intergenic
1138756565 16:59493597-59493619 AATTGAAACCAGAGGGAAGAGGG - Intergenic
1139346861 16:66309418-66309440 CTTGGAGCCACGAGGGAAGCTGG - Intergenic
1139589252 16:67924324-67924346 CTTGGGGAGCAGCGGGGAGAGGG + Intronic
1139701357 16:68710015-68710037 GTTGCAGAGCAGCGGGAAGAAGG - Intronic
1140254351 16:73322125-73322147 CTCGGAGAGCAGAGGGAGGAAGG + Intergenic
1140899386 16:79353945-79353967 CATGGAGACCAGAGATAAGTGGG + Intergenic
1141012309 16:80414244-80414266 CTTGGAGACCAGTGAGAACATGG - Intergenic
1141529457 16:84636154-84636176 TTTGGGGAGCAGGGGGAAGATGG + Intergenic
1142104376 16:88294481-88294503 CTGGGAGCCCAGAGGGCAGGAGG - Intergenic
1142353141 16:89588880-89588902 CCTGGAGACCAGGGGGGTGAGGG - Intronic
1203052000 16_KI270728v1_random:884193-884215 CTTGGAGGCCAGAAGGCAGTAGG - Intergenic
1203065900 16_KI270728v1_random:1017386-1017408 CTTGGAGACGGGAGGGCCGATGG - Intergenic
1142951111 17:3480826-3480848 CTTGGAGATTAGAAGCAAGATGG + Intronic
1143026131 17:3942968-3942990 CTTGGAGAAAAGAGGGGAGAAGG - Intronic
1143178904 17:4972372-4972394 CTGGGACACCAGAGGAAAGCTGG + Exonic
1143222199 17:5272019-5272041 CTTGGAGGTTAGAGGCAAGATGG - Intergenic
1143795703 17:9334478-9334500 CTTGGAGGTTAGAGGCAAGATGG + Intronic
1143916196 17:10295180-10295202 CTAGAAGAGCAGAGGGAAGGAGG - Intergenic
1144238698 17:13288109-13288131 CTTGGAGGTCAGAAGCAAGATGG + Intergenic
1144408357 17:14974598-14974620 CCTCGAGCCCAAAGGGAAGAGGG - Intergenic
1144764727 17:17726148-17726170 CTTGTGGCCCGGAGGGAAGAGGG + Intronic
1144765111 17:17728341-17728363 CTTGGAGACCAGAGGGAAGACGG - Intronic
1144879752 17:18425240-18425262 CTAGAAGACCAGAGGGGAGGAGG + Intergenic
1145103671 17:20097238-20097260 CTTAGAGACCAAAGGGATGGGGG - Intronic
1145813857 17:27781542-27781564 CTGGGAGAGCAGGGGGAAGATGG - Intronic
1146872658 17:36386055-36386077 CTAGGAGAACGGGGGGAAGATGG - Intronic
1146887489 17:36482475-36482497 CTTAGATACCAGAGGGGAAACGG + Intergenic
1146952541 17:36916775-36916797 TTTGGAGGCCAGGGGGAGGACGG + Intergenic
1147343618 17:39771669-39771691 CCTGGAGTGCAGAGGGAGGATGG + Intronic
1147664897 17:42140421-42140443 GTGGGAGACCTGAGGGACGATGG + Intronic
1147879304 17:43643634-43643656 CCAGGAGAACAGAGGGAAGCCGG - Exonic
1147920417 17:43913401-43913423 ATTGGAGCCCAGACAGAAGAGGG + Intergenic
1147948059 17:44091657-44091679 CCTCAACACCAGAGGGAAGATGG + Intronic
1147960018 17:44161679-44161701 CAAGGGGAGCAGAGGGAAGATGG + Intronic
1148221788 17:45868009-45868031 CTTGGAGGCTAGAAGCAAGATGG - Intergenic
1148466142 17:47866390-47866412 CCTGGAGACAAGGAGGAAGATGG + Intergenic
1148543110 17:48495655-48495677 CTTAGAAACCAGGGAGAAGATGG - Intergenic
1148558954 17:48595084-48595106 CTTGGAGACCCCAGGGCAGGAGG - Intronic
1148627204 17:49078776-49078798 CTGGGAGGCTAGAGGTAAGATGG - Intergenic
1148856927 17:50583996-50584018 CTTAGTGTCCAGAGGGAGGAAGG + Intronic
1149453683 17:56770222-56770244 CTTGGAGGCCAGAAGGAGCAAGG - Intergenic
1149847586 17:60016655-60016677 CTAGGAGAACGGGGGGAAGATGG - Intergenic
1150085944 17:62273272-62273294 CTAGGAGAACGGGGGGAAGATGG - Intronic
1150321382 17:64217256-64217278 CTGGGAGGACAGAGAGAAGAGGG - Intronic
1151207046 17:72515489-72515511 CTTGGAAACCAGATGGAAATAGG - Intergenic
1151334977 17:73434416-73434438 CTTGGAAGCCAGAAGCAAGACGG + Intronic
1151705095 17:75763267-75763289 CCTGGAGACCTCAGGGAAGGAGG + Intronic
1151741313 17:75984153-75984175 CTTAGAGGCCAAAGGCAAGAGGG + Intronic
1153089138 18:1323975-1323997 CTTGGAGAGGTGAGGGAGGAAGG + Intergenic
1153666038 18:7368370-7368392 ATTGGAGCCCAGAGGGATTAAGG + Intergenic
1153787918 18:8551290-8551312 CTTGGAGGCTAGAAGCAAGATGG + Intergenic
1154265561 18:12875759-12875781 TTTGGAGACCAAAGGGAAGAAGG + Intronic
1155389737 18:25322151-25322173 CTTGAAGACAAGACTGAAGATGG - Exonic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1155963038 18:32010867-32010889 CTTGGAGATTAGAAGCAAGATGG + Intergenic
1157301676 18:46484016-46484038 CTTGGAGAGCAGAGGGAGGAGGG + Intronic
1158201411 18:54945897-54945919 CTTGGAAGCCAGAGAGAGGATGG + Intronic
1159580547 18:70230374-70230396 CTTGGAGGTTAGAGGCAAGATGG + Intergenic
1160579390 18:79875032-79875054 CTGGGAGATCACAGGGCAGAAGG - Intronic
1160913197 19:1484119-1484141 CGTGGTGACCTGAGGGCAGAGGG + Exonic
1161050741 19:2162974-2162996 CTTGGAGGTTAGAAGGAAGAGGG - Intronic
1161064103 19:2229123-2229145 CTTTGAGACCAGAAGGAAGTTGG + Intronic
1161070455 19:2257306-2257328 CTGGGAGTCCTGAGGGAAGAGGG + Intronic
1161434488 19:4254561-4254583 CTTGGGGACCTGAGGCAGGAAGG - Intronic
1161592185 19:5133860-5133882 CTAGAAGAACAGAGGGGAGAGGG - Intronic
1162455444 19:10781354-10781376 CTTGGATCCAAGAGGGAGGAGGG - Intronic
1162774922 19:12973671-12973693 CTTGGAGAAATGAGGGGAGATGG + Exonic
1163066056 19:14796228-14796250 CTTGGAGGTTAGAGGCAAGATGG + Intronic
1163219835 19:15910702-15910724 CTTGGCAACCAGTGGGAAGATGG + Intergenic
1163720831 19:18897419-18897441 CCAGGATACCAGACGGAAGAGGG - Intergenic
1163765265 19:19160295-19160317 CTGGGAAACCAAAAGGAAGAAGG + Intronic
1165853643 19:38866702-38866724 CTTGGAGATTAGAAGCAAGATGG + Intergenic
1166122667 19:40694770-40694792 CATTGAGACCTGAGGGATGAGGG - Intronic
1166205422 19:41265717-41265739 TTTGGAGAACAGAGGGTAGCTGG + Intronic
1166862064 19:45816523-45816545 CTTGGAGGCCAGCGGCAAGCAGG - Exonic
1167166522 19:47803131-47803153 CCTGGAGAATGGAGGGAAGAGGG + Intronic
1167175320 19:47860633-47860655 CCTGGAGAAGGGAGGGAAGAGGG - Intergenic
1167743321 19:51337562-51337584 CTTGGGTGCCAGAGGGGAGAGGG + Intronic
925036993 2:695255-695277 CATGGAGCCCAGTGGGAAGGTGG - Intergenic
925285602 2:2713723-2713745 GGTGGAGACCAGAGGAAAGCTGG + Intergenic
925286543 2:2719966-2719988 CTTGGAGGTGAGAGGGAAGGTGG + Intergenic
925799760 2:7586630-7586652 CCAGAAGACCAGAGGGGAGAAGG - Intergenic
926037622 2:9647577-9647599 CTTGGTGACAAGGGGGAATAAGG - Intergenic
926389042 2:12368597-12368619 GTTGGAGAACAGAGGCCAGATGG + Intergenic
926905468 2:17801345-17801367 CTTGGAGATTAGAAGCAAGATGG - Intergenic
927061871 2:19430943-19430965 CTTGAAGACCATTGTGAAGAAGG + Intergenic
927394869 2:22638197-22638219 CCTGGAGACCAGAGGCCAAAGGG - Intergenic
927653462 2:24926691-24926713 CGCGGAAACCAAAGGGAAGAAGG - Intergenic
927857245 2:26535406-26535428 CTGGGAGCCCCGTGGGAAGATGG - Intronic
929565107 2:42979086-42979108 ATTCTAGGCCAGAGGGAAGAGGG + Intergenic
930751984 2:54943242-54943264 CTCTGAGAAGAGAGGGAAGAAGG - Intronic
930839378 2:55827978-55828000 CTTGGAGGTTAGAGGCAAGATGG + Intergenic
930911845 2:56638316-56638338 CATTGAGACCAGGAGGAAGAAGG + Intergenic
931412484 2:62046102-62046124 CTTGGAGGTCAGAAGCAAGATGG + Intronic
932313856 2:70767211-70767233 CAGGGAGAGGAGAGGGAAGATGG + Intronic
932582982 2:73004628-73004650 CTGGGAGACCAGAGGGAGTGTGG + Intronic
932623926 2:73283840-73283862 CTTGGAGAACAGGGGCCAGAGGG - Intronic
932863395 2:75317279-75317301 CTTGGAGATTAGAAGCAAGATGG - Intergenic
933051244 2:77605324-77605346 CTTGGAGATCAGAAGCAAGATGG - Intergenic
933119037 2:78513055-78513077 ATAGGAGACCAAAGGGAATAAGG - Intergenic
933167035 2:79087661-79087683 GTAGGAGAACACAGGGAAGAGGG + Intronic
934871534 2:97871268-97871290 CTTGGAGGTCAGAAGCAAGATGG - Intronic
935061805 2:99615214-99615236 CTGGGAGTCCAGATGGTAGAGGG + Intronic
935673382 2:105574125-105574147 CCTGCAGAGCAGAGGGAAGGTGG - Intergenic
935946166 2:108288641-108288663 CTTCGAGGCCAGTGGGAGGAGGG + Exonic
936018240 2:108975506-108975528 CTTGGTGACCAGATGGATGCCGG + Intronic
936411719 2:112264472-112264494 CTAGGAGACCATAATGAAGAAGG + Intergenic
936626350 2:114153486-114153508 CTTGGAGGTTAGAGGCAAGATGG - Intergenic
936918218 2:117661585-117661607 CCTGGGGACCCGAGGGAAGAGGG + Intergenic
937211330 2:120273690-120273712 CTGTAAGACCAGAGGCAAGATGG + Intronic
937481001 2:122259202-122259224 CATGGAGACCACACAGAAGATGG + Intergenic
937712538 2:124995005-124995027 CTTGGAGATAAGAAGCAAGATGG - Intergenic
938343841 2:130552780-130552802 CTTGGAGGTCAGAAGCAAGATGG - Intergenic
938345992 2:130567942-130567964 CTTGGAGGTCAGAAGCAAGATGG + Intergenic
938779825 2:134575091-134575113 ATGGGAGGCCAGAGGGAGGAAGG + Intronic
938844021 2:135189749-135189771 CTTGGAGGCCAGAAGGCAGTAGG + Intronic
939936063 2:148294874-148294896 AATGGAGACCAGAAGGCAGAGGG - Intronic
940849161 2:158672003-158672025 CTTGAGGAACAGAGGGAAGCCGG + Intronic
941403088 2:165056097-165056119 CTTGGAGGTCAGAAGCAAGATGG - Intergenic
941877425 2:170448269-170448291 CTTGGAGGTTAGAAGGAAGATGG + Intronic
941960338 2:171246928-171246950 CTTGGAGGTTAGAAGGAAGATGG + Intergenic
941966734 2:171307955-171307977 CTTGGATGCCAAAGGGTAGATGG + Intergenic
942320687 2:174733063-174733085 CATGGAACCCAGAGGGAAGACGG - Intergenic
942552544 2:177134532-177134554 CTTGGCAACCAGAGGGAAAAGGG + Intergenic
944301410 2:198128826-198128848 CTTGGAGGTTAGAGGCAAGATGG + Intronic
944325602 2:198400267-198400289 CTAGGAGACTAGAAGGAATAAGG + Intronic
945781899 2:214185776-214185798 TGTGGAGACCAGAGAGCAGAGGG + Intronic
946527273 2:220534510-220534532 CTTGGAGATCAGAAGCAAGATGG - Intergenic
946734314 2:222739285-222739307 CTTGGAGGTTAGAGGCAAGATGG + Intergenic
946830159 2:223720480-223720502 CTTGGAGGTTAGAGGCAAGATGG + Intergenic
947104598 2:226655409-226655431 CCTGGGGTCCATAGGGAAGATGG - Intergenic
947551768 2:231051451-231051473 ATGGGAGGTCAGAGGGAAGAAGG + Intergenic
947554458 2:231078341-231078363 CTTGGAGACCTTGGGCAAGATGG + Intronic
947686414 2:232089712-232089734 CTTGGAGCCCAGAGGAAAAGAGG - Intronic
947688595 2:232113683-232113705 CTTGGAGGTTAGAGGCAAGATGG - Intronic
947747924 2:232518896-232518918 CCTGAAGACCAGAGGCAGGAGGG + Intergenic
947802752 2:232941498-232941520 CTTGGAGGTTAGAAGGAAGATGG + Intronic
948004507 2:234596173-234596195 CTTGGAGATTAGAAGCAAGATGG + Intergenic
948006632 2:234614918-234614940 CTTGGAGGTTAGAAGGAAGATGG - Intergenic
948588771 2:239036659-239036681 CTTGGAGTGCAAAGGCAAGAGGG - Intergenic
1168955023 20:1828685-1828707 CCAGGAGCCCAGAGGGAAGCTGG + Intergenic
1169941492 20:10942600-10942622 ATTGAAGAGCAGAGGGAGGAAGG - Intergenic
1170368141 20:15619350-15619372 CTTGGAGGTTAGAGGCAAGATGG + Intronic
1170822667 20:19767521-19767543 CTGAGAGACCAGAGGGCAGGAGG + Intergenic
1170901134 20:20464532-20464554 CTTGCAGACAAGAAGGAAGTGGG - Intronic
1170926352 20:20727944-20727966 CTGGAAGGACAGAGGGAAGAGGG + Intergenic
1171289010 20:23969493-23969515 CATTGAGGCCAGAGGGAAGATGG + Intergenic
1171500937 20:25592833-25592855 CTTAGAGGCCAGAGAGAAGTGGG + Intergenic
1172900928 20:38334408-38334430 CCTGGAAATCAGAGGGAGGATGG - Exonic
1173275146 20:41573938-41573960 TTTAGAGACCACAGGGAAAAGGG + Intronic
1173802420 20:45902649-45902671 TTTGGAGCCCCCAGGGAAGAAGG + Intronic
1174704870 20:52644916-52644938 TTTGCAGACCAGAGTAAAGAAGG - Intergenic
1176910597 21:14560359-14560381 CTTGGAGGTCAGAAGCAAGATGG - Intronic
1176930972 21:14809792-14809814 CTTGGAGATTAGAAGCAAGATGG - Intergenic
1177323368 21:19551510-19551532 CTTGGAGGTTAGAGGCAAGATGG - Intergenic
1178582407 21:33847848-33847870 CCAGGAGATCAGAGGAAAGATGG - Intronic
1178944363 21:36933929-36933951 CCTGGAGACAAGGGGGAAGATGG + Intronic
1179229543 21:39489037-39489059 CAAGAAGACCAGAGGGAAGAAGG + Intronic
1179410943 21:41162774-41162796 CTTTGGGACCAGAGGGAAGTAGG - Intergenic
1179901956 21:44399013-44399035 CTTGGAGGTTAGAGGCAAGATGG + Intronic
1180675069 22:17581214-17581236 CCTGGAGACTGGAGGGAAGGGGG - Intronic
1181687186 22:24537563-24537585 TTTGGACATCAGAGGGCAGAGGG + Intergenic
1181884467 22:26009215-26009237 TTCTGAGACCAGAGGGAATATGG - Intronic
1182488249 22:30652556-30652578 CTTGGAGATTAGAAGCAAGATGG + Intronic
1183230697 22:36580224-36580246 CTTGGACACCAGTGGGAGGCAGG - Intronic
1183295264 22:37025442-37025464 CTTGGAGAACTGAGGGTGGAAGG + Intronic
1183717727 22:39543666-39543688 CTTTGAGCCCAGCAGGAAGATGG - Intergenic
1184044707 22:41965647-41965669 CCTGGGTCCCAGAGGGAAGAGGG + Intergenic
1184542050 22:45132610-45132632 AAAGGAGGCCAGAGGGAAGAAGG + Intergenic
1184892102 22:47386349-47386371 CGTGGGGACCAGAAGGAAGGGGG + Intergenic
1184892332 22:47387607-47387629 CGTGGGGACCAGAAGGAAGGGGG + Intergenic
949886868 3:8702290-8702312 CTTGGAGACTTAAGGGAAGGGGG + Intronic
950426557 3:12927630-12927652 CTCAGAGCACAGAGGGAAGAGGG + Intronic
950566058 3:13770400-13770422 TATGCAGACCAGAGGGGAGAAGG + Intergenic
950964335 3:17135984-17136006 CTTTGAGCCCACAGGGCAGATGG - Intergenic
951700030 3:25487010-25487032 CTTGGAGAGGAGAGAGAGGAGGG + Intronic
952719639 3:36519025-36519047 CTGGGATTCCAGAAGGAAGAGGG + Intronic
952928923 3:38344776-38344798 CTTGGAGGCTAGAAGCAAGATGG + Intergenic
952942555 3:38455041-38455063 CCTGGAGGCCCGAAGGAAGAGGG - Intronic
953024898 3:39139155-39139177 CCTGGAGACCAGACAGGAGAGGG - Intergenic
953184001 3:40621317-40621339 CTTGGGCAGCAGTGGGAAGAGGG + Intergenic
953519200 3:43625038-43625060 CTTGGAAGCCAGAGAGAACATGG - Intronic
953612604 3:44460238-44460260 CTTGGAGGCTAGAAGCAAGATGG - Intronic
953658298 3:44871497-44871519 CTTGGAGAGCAGAGAGCAGAGGG + Intronic
953821205 3:46208887-46208909 CTTGGGGAGCAGAGAGCAGAGGG - Intronic
954092142 3:48293634-48293656 GTGGGAGAACAGAGGAAAGAAGG - Exonic
954277352 3:49551294-49551316 GTAGAAGACCAGAGGGAAAATGG - Intergenic
954457533 3:50607955-50607977 GTTGGAGTCCAGACGGAAGCTGG + Exonic
954460176 3:50622026-50622048 CCTGGGAACCAGAAGGAAGATGG - Intronic
955117788 3:56023192-56023214 CATGGAGACCAAATGGAAGGAGG - Intronic
955260775 3:57388181-57388203 CATGGAGGTCTGAGGGAAGAGGG - Intronic
955344271 3:58149535-58149557 CTTGGAGGCGTGAGGGCAGAAGG + Intronic
957461671 3:80529796-80529818 CTTGGAGGTTAGAGGCAAGATGG - Intergenic
957867208 3:86040240-86040262 TTTGAAGACCTGAGAGAAGAAGG + Intronic
958573212 3:95913094-95913116 CTTGGAGGCTAGAAGCAAGATGG + Intergenic
959161920 3:102734422-102734444 CTTGGAGGTCAGAAGCAAGAGGG - Intergenic
959346584 3:105202646-105202668 ATTGGAGGCCAGAAGGAAGTGGG - Intergenic
959676937 3:109046244-109046266 CGTGGAGACTAGAAGGGAGAGGG + Intronic
960713151 3:120551193-120551215 CTTTGAGATCAGAGTGAAGGTGG + Intergenic
960842598 3:121975406-121975428 CTTGGAGATCAGAAGCAAGATGG + Intergenic
962123978 3:132595097-132595119 CTGGGAGTCCAGATGGATGAGGG + Intronic
963690724 3:148498660-148498682 CTTGGAGATCACAGGGAGAAGGG + Intergenic
963993059 3:151676023-151676045 CTTGGAGGCTAGAAGCAAGATGG - Intergenic
964521081 3:157568095-157568117 CTTGCAGGCCAGAAGGAAGTGGG - Intronic
964636203 3:158860425-158860447 CTTGGGCACCAGTGGGAGGAAGG + Intergenic
965657720 3:171006666-171006688 CTTTGACACCATAGGGTAGAAGG + Intronic
965682601 3:171266838-171266860 TTTGGAGAACAGAAGGAAGCCGG - Intronic
966535233 3:181025373-181025395 CTTGGAGGCCAGAAGGGAGTGGG - Intergenic
966885140 3:184373338-184373360 CTAGAAGACCTGAGGGAAGAAGG - Intronic
967054469 3:185817427-185817449 CTTGGCTGCCAAAGGGAAGAAGG - Intronic
967596656 3:191332783-191332805 CTTGGAGAGCAAAAGGAAGTAGG - Intronic
967795038 3:193590703-193590725 CTTGGAGGTCAGAAGCAAGATGG + Intronic
968592015 4:1464053-1464075 CTGGGAGACCCGAGGGAATGTGG + Intergenic
968817245 4:2828443-2828465 CTGGGACCCCAGAGGGAAGGAGG - Intronic
969060281 4:4428610-4428632 CTTTGAGACTAGAGGGTAGAAGG - Intronic
969613866 4:8241269-8241291 GTTGGCGGCCAGAGGGGAGACGG + Intronic
969655105 4:8492442-8492464 CTTGGAGATTAGAAGCAAGATGG - Intronic
969868221 4:10089039-10089061 TTCAGAGCCCAGAGGGAAGAGGG - Intronic
970889869 4:21031072-21031094 CTTGGAGACCAGATGGAAGATGG - Intronic
972682142 4:41316312-41316334 CTTGGAGATCAGAAGCAAGATGG + Intergenic
972683068 4:41325483-41325505 CTTGGAGGTCAGAAGCAAGATGG + Intergenic
972706916 4:41553768-41553790 CCTGGATCCAAGAGGGAAGATGG - Intronic
973545861 4:51981467-51981489 AGTGGAGACCCCAGGGAAGAAGG + Intergenic
975393193 4:73844213-73844235 CTTGGAAATCAAAGGGAATAAGG + Intronic
976217395 4:82728229-82728251 CTTGGAGGTCAGAAGCAAGATGG - Intronic
977077951 4:92482321-92482343 CTTAGAGGGCAGAGGGAGGAAGG + Intronic
977348817 4:95853441-95853463 CTGAGAGACAAGAGGGAAGGAGG + Intergenic
977527612 4:98164025-98164047 CTTGGAGATTAGAAGCAAGATGG - Intergenic
978437938 4:108705960-108705982 ATTGCAGACCAGTGGGAAAAAGG + Intergenic
978651884 4:111015313-111015335 TTTGGAGACCAAAGGGATTAAGG - Intergenic
978713677 4:111816347-111816369 CTTGGAGGTCAGAAGCAAGATGG - Intergenic
978873107 4:113604639-113604661 CTTTGAAACCAAAGTGAAGAAGG - Intronic
979084981 4:116396800-116396822 CTTGGAGAAAAGAAGCAAGATGG + Intergenic
979490412 4:121320323-121320345 CTAGCAGATCAGAGGGAGGAAGG + Intergenic
979773905 4:124563409-124563431 CTTGGAGATTAGAAGCAAGAGGG - Intergenic
980467224 4:133201934-133201956 CTTTGGGAGCAGAGTGAAGAAGG + Intronic
980740015 4:136938323-136938345 CTGGGAATCAAGAGGGAAGAAGG + Intergenic
981643856 4:146975676-146975698 CTCTGAGACCAGATGGCAGATGG + Intergenic
981679804 4:147383891-147383913 ATTGGGGACCACTGGGAAGAAGG + Intergenic
982086594 4:151842165-151842187 CTTGGGTACCTGAGGGAGGAGGG + Intergenic
982220884 4:153124242-153124264 ATTGGAGATAAGAGGGAAGTTGG - Intergenic
982720838 4:158858074-158858096 GTTGAAGACCAGGGGGCAGAAGG + Intronic
984170679 4:176355642-176355664 CTTGGAGATTAGAAGCAAGATGG - Intergenic
984902747 4:184599664-184599686 CCTGGAGGTCAGAGGCAAGATGG - Intergenic
985426938 4:189840492-189840514 CTTGGAGGCTAGAGGCAAGATGG - Intergenic
985426948 4:189840565-189840587 CTTGGAGGCTAGAGGCAAGATGG - Intergenic
986164641 5:5263395-5263417 AATGAAGACCAGAGGGATGAAGG - Intronic
986670571 5:10139530-10139552 GGTGGAGAGCAGAGGGAGGAAGG + Intergenic
991207624 5:64067541-64067563 CTTGGAGATTAGAAGCAAGATGG - Intergenic
991601084 5:68351775-68351797 CTGGAAGACCAGAGGTAGGAAGG - Intergenic
992688976 5:79224775-79224797 CTTGGAGGTCAGAAGCAAGATGG + Intronic
993329421 5:86579457-86579479 CTAGGAGACCAGTAGGAAGGGGG - Intergenic
993628687 5:90257593-90257615 CTTGGAGAACAAAGGGAAAGGGG + Intergenic
993814326 5:92522510-92522532 CCTGGGGACCAGAGAGTAGAAGG + Intergenic
993823779 5:92655404-92655426 CATGGAGAATAAAGGGAAGAGGG - Intergenic
994239009 5:97398797-97398819 CTTGGAGGTCAGAAGCAAGATGG - Intergenic
995105466 5:108372591-108372613 CATGGAGACCAGAAGGCAGTGGG + Intronic
995165751 5:109039623-109039645 CATGGACATCTGAGGGAAGAGGG + Intronic
996452709 5:123644600-123644622 CTTGGAGACACAAGGGAAGAAGG - Intergenic
996616703 5:125450626-125450648 ATTGAAGAGCAGAGGGAGGAAGG + Intergenic
997605480 5:135172978-135173000 CTTGGAGACCATGGAGAAGGGGG + Intronic
997764706 5:136489448-136489470 CATGGAGACCAGAAGGCAGTGGG - Intergenic
998093223 5:139382884-139382906 CTTGGAGACCACAGGAGAGGGGG + Intronic
998315304 5:141177882-141177904 CTTGGATGCCAAAGGGAGGACGG + Exonic
998319230 5:141213970-141213992 CTTGGATGCCAAAGGGAGGACGG + Exonic
998501919 5:142640591-142640613 CTTGGATAACAGCTGGAAGAAGG - Intronic
998779351 5:145639340-145639362 CTTGAAAACCAGAGGGAGAAGGG + Intronic
999023743 5:148201224-148201246 CTTGAAGATCAGAGGAAAGCAGG + Intergenic
999520746 5:152348453-152348475 CTAGGACACCAGAGGAAAAAAGG - Intergenic
999579191 5:153015635-153015657 TTTGCAGACCAGAAGGAAGTGGG + Intergenic
999978743 5:156938577-156938599 CGTGGAGATAAGAGAGAAGAGGG - Intronic
1000089563 5:157918439-157918461 CTTGGAGATTAGAGGCAAGATGG + Intergenic
1000642090 5:163715161-163715183 AATGGAGACGAGATGGAAGAGGG - Intergenic
1000822955 5:166007993-166008015 GCTGGAGGGCAGAGGGAAGAGGG - Intergenic
1000886153 5:166750152-166750174 CTTGGAGAAAAGAAGGAAAAAGG + Intergenic
1001079997 5:168660696-168660718 CAGGGAGACCTGGGGGAAGAAGG + Intergenic
1001557610 5:172647233-172647255 CTTAGAGCAGAGAGGGAAGAGGG + Intronic
1002882312 6:1263706-1263728 TTTGGATTCCAGAGGAAAGAAGG + Intergenic
1003263539 6:4546749-4546771 CTTGAAGACCACAGGGGAGAGGG - Intergenic
1003269273 6:4592996-4593018 CTTGCAGATCAGAAGCAAGATGG + Intergenic
1003642208 6:7885439-7885461 CTTGGAGACCAGAGCAGAAATGG - Intronic
1005292997 6:24397381-24397403 CTTGGAGGTCAGAAGCAAGATGG + Intergenic
1006054063 6:31367524-31367546 CTGGGTGCTCAGAGGGAAGATGG + Intergenic
1006426040 6:33963542-33963564 CGTGGAGACCACAGGGACCATGG - Intergenic
1006454447 6:34123859-34123881 GCTGGAGACCAGAGAGAGGAAGG - Intronic
1006516945 6:34550467-34550489 CTTGGAGACCCTGGGGAAGCAGG - Intronic
1006939110 6:37739891-37739913 CTTGAAGAACTGAGGGATGAGGG - Intergenic
1006945040 6:37779295-37779317 CTGAGAGGCCAGAGGGAAAAGGG + Intergenic
1007150731 6:39688231-39688253 CTGGGAGGCCAGAGGGCAGGAGG + Intronic
1007730751 6:43944122-43944144 CATGGAGAGCAGAGAGAGGAAGG - Intergenic
1007945846 6:45826283-45826305 CTTGGATAACAGATGGGAGATGG + Intergenic
1007950492 6:45868115-45868137 CTTGGAGATGAGATGCAAGATGG + Intergenic
1008487451 6:52051529-52051551 GGCGGAGACAAGAGGGAAGATGG - Intronic
1008991930 6:57613513-57613535 CTTGGAGCTCAGAGGGATAAGGG - Intronic
1009910995 6:69926938-69926960 CATGGAGACCAGAAGGCAGTGGG + Intronic
1010706328 6:79115846-79115868 CTTGGAGTTCAGAGAGAAGAAGG + Intergenic
1010804392 6:80217841-80217863 CTTGGTAACTAGAGCGAAGAAGG + Intronic
1011071607 6:83391737-83391759 CCTGGAGACCAGAAGCAGGATGG - Intronic
1011477699 6:87764024-87764046 CATGGAAACCAGAGGGAAATGGG + Intergenic
1011492178 6:87903476-87903498 CATGGAAACCAAAGGGAAGGTGG - Intergenic
1011676645 6:89741370-89741392 CTTGGAGGCTAGAAGAAAGATGG - Intronic
1011823217 6:91276516-91276538 CTTTGCCACTAGAGGGAAGAAGG + Intergenic
1013044398 6:106470058-106470080 CTCGGGGACCAAAGGGAGGAGGG - Intergenic
1013117325 6:107113555-107113577 CTTGGATTCTAGAGGAAAGATGG - Intronic
1013168469 6:107615410-107615432 CTTGGAAATCAGAGGGACAAAGG + Intronic
1013941574 6:115669475-115669497 TTAGGAGACCAGAGTGAAGTGGG + Intergenic
1015394320 6:132717889-132717911 CTATGAGACCAGAGGAAAAATGG - Intergenic
1015631319 6:135234838-135234860 CTTTGAGGCGAGAGGGGAGAAGG - Intergenic
1017103482 6:150867062-150867084 ATGGGAGAGCAGAGGGAGGAAGG - Intronic
1017308473 6:152949070-152949092 TTTCGAGACCAAAGGGAAGAGGG - Intergenic
1017351399 6:153446639-153446661 CTTGGAGGCTAGAAGCAAGATGG - Intergenic
1017407763 6:154138618-154138640 CTTGGAGGTTAGAGGCAAGATGG - Intronic
1017975677 6:159355200-159355222 CTTGGAGATCAGAAGCAAGATGG - Intergenic
1018145700 6:160885746-160885768 CTTGGAGGCTAGAAGCAAGATGG + Intergenic
1018227345 6:161641040-161641062 CTTGGAGATGAGAAGGAAGATGG - Intronic
1019357812 7:590101-590123 CCTGGAGACCAGAAGACAGAGGG + Intronic
1020359855 7:7316292-7316314 CTTGGTTTCCATAGGGAAGATGG - Intergenic
1021124633 7:16836971-16836993 CTTGGAGATTAGAAGCAAGATGG + Intergenic
1021315670 7:19144873-19144895 CTTGGAGAGCTGTGAGAAGAAGG - Exonic
1021526685 7:21595868-21595890 TTAGGAGACCAGGGAGAAGAAGG + Intronic
1022209252 7:28192836-28192858 CTTGGAAACAGAAGGGAAGATGG - Intergenic
1022599931 7:31748145-31748167 CTTGGAGATCAGAAGCAAGAGGG + Intergenic
1023305108 7:38817816-38817838 GTTTGTGACCGGAGGGAAGAAGG - Exonic
1024449728 7:49525458-49525480 CTTGGAGAAAAGAGGGTAGGAGG - Intergenic
1025078305 7:55962497-55962519 CTTGGAGGCCAGTGGGATGGAGG - Intronic
1026287960 7:68980260-68980282 CTTGGAGGCTAGAGGCAAGATGG - Intergenic
1026591582 7:71700615-71700637 CCTGGAGACCAGAGGAAATGTGG - Intronic
1026660544 7:72298324-72298346 CTTTGAGATGAGATGGAAGATGG - Intronic
1027526008 7:79269691-79269713 CTTGGAGATCACAAGCAAGATGG - Intronic
1027579834 7:79978402-79978424 CTTGGAGGTTAGAAGGAAGATGG + Intergenic
1027858135 7:83539199-83539221 CTGGGAGCCCAGGGGGAAGCTGG + Intronic
1028248474 7:88511538-88511560 CTTGGAGGCTAGAAGCAAGATGG + Intergenic
1028686329 7:93592320-93592342 CTTGGTGAGCAGGAGGAAGATGG - Intronic
1029526463 7:101097607-101097629 CTTAGGGACCAGATGGAAGAGGG + Intergenic
1029979115 7:104861759-104861781 CTTGGAGAACCTGGGGAAGAGGG + Intronic
1031131063 7:117833690-117833712 CTTGGAGGACAGAGAGGAGATGG - Intronic
1032116144 7:129118876-129118898 CTTGAAGGGCAGAGGGAAGTGGG - Intergenic
1032429482 7:131849316-131849338 CTAGGAGTCCAAATGGAAGACGG + Intergenic
1032503388 7:132417120-132417142 CTTTGAGGCCAGGGGGAAGCGGG - Intronic
1032547518 7:132756128-132756150 CTTTGGGAGCAGAGGGCAGAAGG - Intergenic
1032667200 7:134048445-134048467 CTTGGAGGTTAGAGGCAAGATGG + Intronic
1033626158 7:143111649-143111671 CTTGAAGACCAAAGGCAAGAAGG - Intergenic
1034255042 7:149720262-149720284 CTTCCAGCCCAGAGGGATGAGGG - Intronic
1034630414 7:152526160-152526182 CTTGTAAACAAGAGGGAAGGAGG - Intergenic
1034686769 7:152978706-152978728 CTTGGAGGTCAGAAGCAAGATGG + Intergenic
1034737616 7:153443713-153443735 CTTGGAGAGAAGAGGCAAAAGGG - Intergenic
1035976300 8:4315240-4315262 CTTGAAGACCAGAGTGAGGTAGG + Intronic
1036159857 8:6377268-6377290 CTTGGAGGCCAGAAGGCAGTGGG + Intergenic
1036763347 8:11528419-11528441 CTTGGAGGTCAGAAGCAAGATGG + Intronic
1037161783 8:15781546-15781568 CTTGCAGGCCAGAAGGAAGTGGG + Intergenic
1037904897 8:22710526-22710548 CCTGGAAACCACAGGGAAGGAGG - Intergenic
1038339151 8:26669641-26669663 CTTGAAGGCCAAAGGCAAGAGGG + Intergenic
1038398704 8:27266739-27266761 CTTGAAGGCCAAAGGCAAGATGG - Intergenic
1038428432 8:27480631-27480653 CTTGGAGAGCAGGGAGAAGAGGG + Intergenic
1039081045 8:33734221-33734243 GTTGGAGATCAGAGGCCAGATGG + Intergenic
1040435523 8:47387274-47387296 CTTAGAGACCACAGGGCAGGTGG + Intronic
1040688904 8:49910726-49910748 GTGGGAGACCAGAGGGAAAATGG + Intronic
1040768647 8:50946577-50946599 CTTGCAGACAAGAAGGAAAATGG - Intergenic
1042004668 8:64168130-64168152 CTTGGAGGCTAGAAGCAAGATGG + Intergenic
1042351321 8:67780569-67780591 CTGGTAGGCCTGAGGGAAGAAGG - Intergenic
1043570721 8:81599664-81599686 CTTGGAGGTTAGAGGCAAGATGG + Intergenic
1043660961 8:82739932-82739954 ATCAGAGAGCAGAGGGAAGATGG + Intergenic
1045362107 8:101442321-101442343 CTTGGAGCTCAGAGGAGAGAAGG + Intergenic
1045582620 8:103498531-103498553 CCTGGGGAACAGAGGGAGGAGGG + Intergenic
1045624106 8:104022336-104022358 CTTGGAGATTAGAAGCAAGATGG + Intronic
1045860575 8:106811446-106811468 CATGGTTACCAAAGGGAAGAAGG + Intergenic
1045917389 8:107488396-107488418 CTTGGAGGGCCAAGGGAAGAGGG + Intronic
1046287573 8:112114888-112114910 CTTGGAGATCAGAAGCAAGATGG - Intergenic
1047047327 8:121069581-121069603 CTTGGAGGTCAGAAGCAAGATGG - Intergenic
1048491855 8:134901616-134901638 CCTGGGGACCACAGGAAAGATGG - Intergenic
1049294816 8:141826850-141826872 CTCGGAGATGAGAGGGAAGGGGG + Intergenic
1049341431 8:142114646-142114668 CTTTGAGAGAAGAAGGAAGAAGG + Intergenic
1049431584 8:142567673-142567695 CTCGAGGACCAGAGGGATGAGGG + Intergenic
1049582207 8:143417966-143417988 TCTGGAGAGAAGAGGGAAGAGGG + Intergenic
1049648691 8:143752293-143752315 CTTGGAGGCCAGAAGGCAGAGGG - Intergenic
1049956337 9:696402-696424 TTAGGAAACAAGAGGGAAGAAGG + Intronic
1049959199 9:722065-722087 CTTGGAGGTCAGAAGTAAGACGG - Intronic
1050160953 9:2718206-2718228 ATTGTAGACCAGCTGGAAGACGG - Exonic
1050980933 9:12014693-12014715 CTTGGAGGCCAAAAGGAAGTGGG + Intergenic
1051047751 9:12895506-12895528 CATGGAGACAAGAGAGTAGAAGG + Intergenic
1051061781 9:13053458-13053480 GGTGGAGACCAGAAGTAAGAAGG + Intergenic
1052074058 9:24118725-24118747 CTTGGAGGTTAGAGGCAAGATGG + Intergenic
1052635189 9:31093932-31093954 CTTTGATACCAGAGGGAGAAAGG - Intergenic
1053249025 9:36559085-36559107 CATGGAGCCCAGAGGGAAAAAGG - Intergenic
1053306363 9:36986947-36986969 CTGGGTGTCCAGAGGGAGGAAGG + Intronic
1053532819 9:38898830-38898852 CCTGGATACTAGAGGGAAGTTGG - Intergenic
1054205045 9:62123259-62123281 CCTGGATACTAGAGGGAAGTTGG - Intergenic
1054633314 9:67465111-67465133 CCTGGATACTAGAGGGAAGTTGG + Intergenic
1055686558 9:78781480-78781502 CTTGGAGGTCAGAAGCAAGATGG - Intergenic
1056215137 9:84399472-84399494 CTTGGAGGTCAGAAGTAAGATGG - Intergenic
1056391520 9:86145641-86145663 CTTGGAGATTAGAAGCAAGATGG + Intergenic
1056408800 9:86303970-86303992 CTGGGAGTACAGAGGGAATAGGG + Intronic
1056641262 9:88372884-88372906 CTTGGAGATTAGAAGCAAGATGG + Intergenic
1056712504 9:89002123-89002145 GTTGCAGACCAGACGGAAGAAGG - Exonic
1057151397 9:92799070-92799092 CCTGGATACTAGAGGGAAGTTGG + Intergenic
1057176079 9:93000607-93000629 TTTGCAGACCAGAAGGCAGAGGG - Intronic
1057239385 9:93394912-93394934 TTTGGAGGCCAGAAGGAAGTGGG - Intergenic
1058689790 9:107510065-107510087 CTAGGAGCCCAGAGGGCACAGGG + Intergenic
1059429885 9:114243580-114243602 CCTGGGGACAAGAGGAAAGAGGG + Intronic
1059584838 9:115594989-115595011 GTTGGGGGTCAGAGGGAAGAGGG - Intergenic
1059812652 9:117873055-117873077 CATGGAGCCCAAAGGGTAGATGG + Intergenic
1061675388 9:132212702-132212724 CTTGGGCACTAGAGGGAAGGAGG - Intronic
1061761935 9:132857425-132857447 CCTGGAGACCTGAGGGAAACGGG - Intronic
1061919941 9:133777226-133777248 GCTGGAGCCCAGAGAGAAGATGG - Intronic
1062139107 9:134945666-134945688 CCTGGAGAGCGGAGGGCAGAGGG + Intergenic
1062291631 9:135797858-135797880 CTTGGGAAGCAGAGGAAAGAGGG - Intergenic
1062464649 9:136675670-136675692 CTGGGAGAGCAGAGGGGAGACGG - Intronic
1062731573 9:138113076-138113098 CTTGGAGACGTGAGGGAGCACGG + Intronic
1185734857 X:2488911-2488933 CTTGGGCAGCAGGGGGAAGAGGG + Exonic
1186039020 X:5456141-5456163 CTTGGAGTTTAGAGGCAAGATGG - Intergenic
1186166452 X:6831479-6831501 CTTGGAGGTCAGAAGCAAGATGG + Intergenic
1186169216 X:6859350-6859372 CTTGGAGGTCAGAAGCAAGATGG - Intergenic
1188050172 X:25474843-25474865 CTAGGAGACCAGAGGGTGCAGGG + Intergenic
1188872252 X:35387544-35387566 CTTGGAAACTAAAGGCAAGAGGG - Intergenic
1189189300 X:39084118-39084140 CTTGGAGGCCAGAAGGAAGTGGG + Intergenic
1189422297 X:40866907-40866929 CTTGTAGATCAGAGGGGTGATGG + Intergenic
1189632772 X:42973104-42973126 CTTGGAGGCTAGAAGCAAGATGG - Intergenic
1189792796 X:44619616-44619638 CTTGGAGGTTAGAGGCAAGATGG - Intergenic
1190411399 X:50140434-50140456 CTTCAAGTCCAGAGGGAACAAGG - Intergenic
1191136479 X:57070154-57070176 GTTGGAGCCCAGAAGGAAAATGG - Intergenic
1191914600 X:66188048-66188070 CTTGAAGACCAGAGGGTGGCAGG + Intronic
1192081097 X:68048710-68048732 CTTGGAGAACCCAGGGAAGCTGG + Intronic
1192315805 X:70050381-70050403 ATTGGAGGGCAGAGGGAAGGAGG + Intergenic
1193359924 X:80569976-80569998 CTGGGAGCACAGAGGGGAGAGGG - Intergenic
1194051241 X:89071574-89071596 CTTGGAGATAAGAAGCAAGATGG + Intergenic
1194621347 X:96176233-96176255 CTTGAAGGCCAAAGGCAAGAAGG + Intergenic
1194758531 X:97766215-97766237 CTTGGAGGCTAGAAGCAAGATGG + Intergenic
1195469842 X:105219470-105219492 CATGGAGACCACAGAGAAGCTGG - Exonic
1196016233 X:110943673-110943695 CTTGGGGATCAGAGGGTTGAAGG - Intergenic
1196260932 X:113580511-113580533 CTTGTAGTCCAGAAGGAAGAGGG - Intergenic
1196287504 X:113899471-113899493 CTTGGAGGTCAGAAGCAAGATGG - Intergenic
1196649050 X:118150202-118150224 CTTGGAGGCCAGAAGCAAGATGG - Intergenic
1196862854 X:120043873-120043895 CTTGAAGGCCAAAGGCAAGATGG - Intergenic
1196880248 X:120192471-120192493 CTTGAAGGCCAAAGGCAAGATGG + Intergenic
1197494124 X:127155850-127155872 TTTGAAGACCAGAAGGAAGTGGG - Intergenic
1197753206 X:129979770-129979792 CCTGGAGACGAGAGGCAAGGCGG + Intergenic
1198110861 X:133501653-133501675 CTGGGAAATCAGAGGCAAGATGG - Intergenic
1198223383 X:134623310-134623332 CTTGGACACAAGAGGGAGGATGG + Intronic
1198444518 X:136698576-136698598 CTTGGAGGCCAGAAGGCAGTGGG + Intronic
1199869182 X:151881458-151881480 CTTGGAGGCTAGAAGCAAGAAGG + Intergenic
1200650118 Y:5831031-5831053 CTTAGAGACAAGAAGCAAGATGG + Intergenic
1201632530 Y:16084844-16084866 CTTGGAGTTTAGAGGCAAGATGG + Intergenic
1201733780 Y:17235306-17235328 TTTGGAGACTAAAGGAAAGATGG - Intergenic