ID: 1144765792

View in Genome Browser
Species Human (GRCh38)
Location 17:17731732-17731754
Sequence ATGCTGGTCTAGAGGGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 191}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144765786_1144765792 5 Left 1144765786 17:17731704-17731726 CCTCCTGGAGCTGCTGTGCAGGC 0: 1
1: 0
2: 4
3: 33
4: 395
Right 1144765792 17:17731732-17731754 ATGCTGGTCTAGAGGGAAGCAGG 0: 1
1: 0
2: 0
3: 18
4: 191
1144765784_1144765792 8 Left 1144765784 17:17731701-17731723 CCTCCTCCTGGAGCTGCTGTGCA 0: 1
1: 0
2: 3
3: 49
4: 496
Right 1144765792 17:17731732-17731754 ATGCTGGTCTAGAGGGAAGCAGG 0: 1
1: 0
2: 0
3: 18
4: 191
1144765783_1144765792 9 Left 1144765783 17:17731700-17731722 CCCTCCTCCTGGAGCTGCTGTGC 0: 1
1: 0
2: 2
3: 59
4: 574
Right 1144765792 17:17731732-17731754 ATGCTGGTCTAGAGGGAAGCAGG 0: 1
1: 0
2: 0
3: 18
4: 191
1144765782_1144765792 12 Left 1144765782 17:17731697-17731719 CCTCCCTCCTCCTGGAGCTGCTG 0: 1
1: 2
2: 5
3: 107
4: 792
Right 1144765792 17:17731732-17731754 ATGCTGGTCTAGAGGGAAGCAGG 0: 1
1: 0
2: 0
3: 18
4: 191
1144765787_1144765792 2 Left 1144765787 17:17731707-17731729 CCTGGAGCTGCTGTGCAGGCCTA 0: 1
1: 0
2: 4
3: 25
4: 234
Right 1144765792 17:17731732-17731754 ATGCTGGTCTAGAGGGAAGCAGG 0: 1
1: 0
2: 0
3: 18
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144765792 Original CRISPR ATGCTGGTCTAGAGGGAAGC AGG Intronic
900420444 1:2553804-2553826 GTGCTGCTGCAGAGGGAAGCTGG - Intergenic
900423982 1:2567854-2567876 GTGCTGCTGCAGAGGGAAGCTGG + Intergenic
900794151 1:4697951-4697973 ACGCTGGTGCAGAGTGAAGCTGG - Intronic
903342979 1:22666107-22666129 ACGCTGGTTTAGAAGGAACCTGG - Intergenic
903622298 1:24706723-24706745 ATGCTGGATTAAAGTGAAGCAGG - Intergenic
904775649 1:32904571-32904593 ATTATGGTCTGGAGAGAAGCAGG - Intergenic
906022823 1:42646161-42646183 ATGGTGGCATAGAGGCAAGCTGG + Exonic
906270814 1:44476912-44476934 ATGCTGGTCCAGAAGCAAGCAGG + Intronic
906746425 1:48225127-48225149 CTGCTGAGCCAGAGGGAAGCAGG + Intronic
907083647 1:51648560-51648582 ATGCGGGGCTATAGGGAAGCTGG - Intronic
911407626 1:97462647-97462669 ATGCTGTACTAGAGTGAGGCTGG - Intronic
912038891 1:105359330-105359352 TACCTGATCTAGAGGGAAGCTGG + Intergenic
912956722 1:114159124-114159146 TTACTGGTCTAGAGGAAAGATGG + Intergenic
913264945 1:117034851-117034873 ATGGAGGTGTAGGGGGAAGCAGG - Intronic
913535419 1:119767435-119767457 ATGCAGGTGTATAGGGGAGCAGG + Intronic
914854903 1:151343736-151343758 ATGCTGCTGTAGCAGGAAGCGGG + Exonic
915953646 1:160205975-160205997 AAGCTTGTCCAGAGGGAAGGAGG + Intronic
917607830 1:176653008-176653030 ATGGTGGTGTAGAAGCAAGCTGG - Intronic
920977718 1:210801474-210801496 GTGCTGGTCCAGATGGAAGAGGG - Intronic
921423551 1:214976513-214976535 ATGCTGTTCTAGAAGCAAGGAGG - Intergenic
1067065200 10:43100576-43100598 ATGCTGGCCCAGGCGGAAGCTGG - Exonic
1067450351 10:46378222-46378244 GTGCTGGGGCAGAGGGAAGCCGG + Intronic
1067586894 10:47481541-47481563 GTGCTGGGGCAGAGGGAAGCCGG - Intronic
1067633950 10:47989308-47989330 GTGCTGGGGCAGAGGGAAGCCGG - Intergenic
1071870573 10:89789762-89789784 ATGCAGGTCTCCAGGGAAGTGGG + Intergenic
1071932155 10:90484662-90484684 ATGCAGGTCTCCAGGGAAGTGGG + Intergenic
1072822009 10:98567538-98567560 AAGCTGGCCTGGAGGGAAGCAGG + Intronic
1073935336 10:108624645-108624667 ATGTTGGTATAGAGGGGATCTGG - Intergenic
1076065317 10:127443714-127443736 ATGCTGATCAGGAGGGAAACAGG - Intronic
1077846667 11:6032653-6032675 CTGGTGGACTAGAGGGAAGCGGG + Intergenic
1078712135 11:13803652-13803674 ATGGTTGTCTATAAGGAAGCAGG + Intergenic
1080924057 11:36737676-36737698 ATGGTGGTATAGAGGTGAGCTGG - Intergenic
1080925787 11:36754576-36754598 ACTCTGGTTTAGAGGGCAGCAGG + Intergenic
1081443888 11:43110785-43110807 GTGCAGGTCAAGAGGGAAGTGGG - Intergenic
1082278628 11:50246926-50246948 ATGCTGGCCAAGTGGGAAGTGGG - Intergenic
1085342618 11:75743282-75743304 ATGCTAGGCTGGAAGGAAGCAGG - Intergenic
1085413090 11:76303086-76303108 AGGCTGGAGTAGAGGGAGGCTGG - Intergenic
1085646921 11:78230261-78230283 ATGCCGGGGTAGAGGGAAGTTGG - Intronic
1085926110 11:81023520-81023542 AAGCTGGTCTTGAGGGCATCAGG + Intergenic
1089255705 11:117192805-117192827 ATGCGGTCCTGGAGGGAAGCAGG - Exonic
1089679335 11:120110642-120110664 ATGATGGTAGAGAGGGAAGAGGG - Intergenic
1090791772 11:130096239-130096261 GTGCTGGACTGGAGGGATGCTGG + Intronic
1091408041 12:221122-221144 ATGTTGGTGATGAGGGAAGCTGG - Intronic
1096687765 12:53300073-53300095 ATGCTGGACTTCAGGGAGGCAGG - Intronic
1097327367 12:58292437-58292459 ATGCTGTGCTCCAGGGAAGCTGG + Intergenic
1101833900 12:108281541-108281563 TTGCTGGTCCAGAGGGACCCAGG + Intergenic
1102607251 12:114077455-114077477 ATCCTGGTCAAGTGGGAAGAAGG - Intergenic
1104587333 12:130057784-130057806 ATGCTTTTCCAGAGGGAACCAGG + Intergenic
1104700299 12:130898043-130898065 AAGCTGGGCAAGAGAGAAGCCGG + Intergenic
1105419387 13:20239317-20239339 ATGCTGTTCTGCAGGGAATCAGG + Intergenic
1108711021 13:53032469-53032491 AAGCTGGTTTCAAGGGAAGCTGG + Intronic
1110560127 13:76902288-76902310 CTGATGGTCAAGAGGAAAGCGGG + Intergenic
1110849826 13:80232431-80232453 ATGGTGGTCTAGAGGAAGGCAGG - Intergenic
1113973887 13:114211777-114211799 ATGTTGGTTCAGTGGGAAGCAGG + Intergenic
1116948966 14:50861368-50861390 ATGCTGCTCTAGAGGCAATTTGG + Intronic
1118910660 14:70059644-70059666 ATGCAGGTCCTGAGGAAAGCAGG + Intronic
1120070717 14:80099375-80099397 ATGCTGGTCGAGGGTGAAACAGG - Intergenic
1122427478 14:101620321-101620343 ATGCTGGCTCAGAGGGCAGCAGG - Intergenic
1123030868 14:105450440-105450462 AGGCTGTTCTGGGGGGAAGCGGG + Intronic
1123635316 15:22301866-22301888 ATGGTGGTCTCTTGGGAAGCTGG + Intergenic
1125732077 15:41898292-41898314 AAGCTGCTTTAGAGGGCAGCAGG - Exonic
1126822803 15:52521484-52521506 ATGCTGGGCTAGAGGGAGACTGG - Intronic
1127848184 15:62889928-62889950 ATGTTGGCCAAGTGGGAAGCGGG + Intergenic
1129276335 15:74448138-74448160 ATGCTGGGCTAGTGGCAAGCTGG - Intronic
1129737224 15:77973140-77973162 ATGCTGGCTTTGAGGAAAGCAGG - Intergenic
1129848854 15:78780495-78780517 ATGCTGGCTTTGAGGAAAGCAGG + Intronic
1132403767 15:101530070-101530092 AGGCTTCTGTAGAGGGAAGCAGG - Intergenic
1132881866 16:2165864-2165886 ATTCTGGTCTAGAGGGAGGACGG - Exonic
1132982420 16:2745294-2745316 ACACTGGCCTGGAGGGAAGCTGG + Intergenic
1133561033 16:6950386-6950408 ATGCTGGTGTAGTGGGTAGTGGG - Intronic
1135074676 16:19383129-19383151 AAGCTGGTCGAGAGGCTAGCGGG + Intergenic
1137504041 16:49035647-49035669 ATACTGGGGTAGAGGGAAGAGGG - Intergenic
1140098447 16:71894966-71894988 ATGCTGGTCCAAAGGGCAACCGG + Intronic
1140244871 16:73238972-73238994 ATGCTGTGGGAGAGGGAAGCAGG - Intergenic
1140618511 16:76697098-76697120 ATCCTATTCTAGGGGGAAGCTGG + Intergenic
1140708400 16:77653088-77653110 ATGCTGGTCTACAGGAGAGAAGG - Intergenic
1141486883 16:84346262-84346284 CTGCTGCTCTAGAGAGAAACAGG + Intergenic
1142865664 17:2790073-2790095 ATGCTGGTCTCCAGGGAAACAGG - Intronic
1144765792 17:17731732-17731754 ATGCTGGTCTAGAGGGAAGCAGG + Intronic
1145818115 17:27810234-27810256 ATGCAGGTCCTCAGGGAAGCAGG - Intronic
1147356926 17:39905651-39905673 CTGCAGGCCAAGAGGGAAGCAGG - Intronic
1151228096 17:72661607-72661629 AGGCTGCCCTAGTGGGAAGCCGG - Intronic
1152720931 17:81923536-81923558 AGGCAGGCCTAGAAGGAAGCCGG + Intronic
1153153920 18:2127646-2127668 ATGAGGGTCTAGATGGAGGCAGG - Intergenic
1154393816 18:13968930-13968952 ATGACTGTCTAGAGGGAAGTGGG - Intergenic
1156893375 18:42215591-42215613 ATGCAGGTCTCCAGGGAAGTGGG + Intergenic
1162922894 19:13913694-13913716 ATGCTGCTCTAGGGGGGTGCCGG + Intronic
1163137134 19:15320139-15320161 GTGATGATCTAGAGAGAAGCAGG + Intronic
1164004225 19:21134224-21134246 ATGCAGGTTAAGAGGGAAGAAGG + Intergenic
1164035360 19:21449367-21449389 CTGCTGGTTTAGAGTGAGGCTGG - Intronic
1166108772 19:40610447-40610469 AGGCAGGGGTAGAGGGAAGCGGG - Intronic
926479620 2:13376190-13376212 ATGGTGGTCTCTTGGGAAGCTGG + Intergenic
928250330 2:29671818-29671840 ATGGTGGTGTAGAAGCAAGCTGG - Intronic
929462335 2:42112039-42112061 ATGCAGGTGCAGAGGGGAGCTGG - Intergenic
929759944 2:44798463-44798485 ATGCGGGGCTGGAGGAAAGCAGG - Intergenic
932835385 2:75031142-75031164 ATGCTGGTGTGGAAGGAAGAGGG - Intergenic
933360500 2:81276784-81276806 TTGCTGGGGCAGAGGGAAGCAGG + Intergenic
933583101 2:84149644-84149666 TTGCAGCTCTAGAGGGAGGCTGG + Intergenic
933650581 2:84846996-84847018 AGGCTGCCCTGGAGGGAAGCTGG + Intronic
934676710 2:96254443-96254465 AGGCGGGTCTGTAGGGAAGCAGG + Intronic
936397439 2:112140315-112140337 ATGCTGGCCTGGAGAGAGGCAGG - Intronic
937127189 2:119482247-119482269 ATGCTGGCCTAGAGCGGGGCAGG + Intronic
938218890 2:129548746-129548768 ATGCTGGGCTGGAGGAAACCAGG - Intergenic
945997165 2:216447445-216447467 ACCCTGGGCAAGAGGGAAGCCGG - Intronic
948156708 2:235788952-235788974 ACCCTGGGCTAGAGGGCAGCAGG - Intronic
1169360950 20:4948433-4948455 ATACTGGACTAGTGGGGAGCAGG - Intronic
1170224525 20:13977159-13977181 ATGCTGGTCTAGAGATTAGAAGG + Intronic
1170285846 20:14707471-14707493 ATTTTGTTCTAGAGGGAGGCAGG - Intronic
1171494445 20:25545684-25545706 ATGCTGTGCTAGAGTCAAGCTGG - Intronic
1171949029 20:31404583-31404605 GTGCTGGTCTAGAAGAAAACAGG + Intergenic
1172866664 20:38105082-38105104 ATGCTGGTATAGATGGAACGGGG + Intronic
1173907085 20:46637213-46637235 AAGCTGGTCCTGGGGGAAGCCGG + Intronic
1175321023 20:58088488-58088510 AGGCTGGGAAAGAGGGAAGCAGG - Intergenic
1176135057 20:63518955-63518977 AGGCCAGCCTAGAGGGAAGCGGG + Intergenic
1177351673 21:19951278-19951300 ATGTGGGTGTAGAGGCAAGCAGG + Intergenic
1179610326 21:42545963-42545985 ATGCTGGCCTCGAGGCCAGCAGG + Intronic
1180561660 22:16620147-16620169 AGTCTGGTCTATAGGTAAGCAGG + Intergenic
1181151688 22:20888458-20888480 ATGGGGGGCTGGAGGGAAGCGGG - Exonic
1181467388 22:23117519-23117541 ATGCTGGGACAGAGGGAAGCAGG + Intronic
1182893841 22:33842815-33842837 CTACTGATCTAGAGGGCAGCTGG + Intronic
1183313413 22:37123993-37124015 ATGCTGGCCCAGAGGGACACTGG + Intergenic
1183470914 22:38006260-38006282 ACGCTGGTCTAGATGGAATTTGG + Intronic
1184254018 22:43276860-43276882 ATGCTGCCCTGGAGGGAAGCTGG - Intronic
949298810 3:2559380-2559402 TTACAGGTCTAGAGGGAAGTAGG + Intronic
949521415 3:4858021-4858043 ATGCTGTTCTAGAAGAAAACAGG - Intronic
950065959 3:10111938-10111960 ATGCTGTTCTTGAGTGAAGATGG - Intergenic
950173618 3:10856290-10856312 CTGCGGGTTGAGAGGGAAGCAGG + Intronic
953711638 3:45276277-45276299 ATGGTGGTGTAGAAGCAAGCTGG + Intergenic
954409100 3:50362173-50362195 ATGCTGGTTTAGTGGGGAGGTGG - Intronic
955800280 3:62679363-62679385 ATGCTGGTCCAGAGAGATGCTGG + Intronic
960703254 3:120457828-120457850 ATGATACTCTAGAGGGAAGGTGG - Intergenic
961305599 3:125958020-125958042 ATTCTGGCCTAGCGGGAGGCGGG - Intergenic
963644721 3:147899526-147899548 AGGGTGGTCAAGAAGGAAGCAGG + Intergenic
968569052 4:1329795-1329817 AGGCTGGACAAGAGGGAAGGCGG + Intronic
968730896 4:2268735-2268757 AGGCTGGTCTGGAGGGCTGCCGG + Intergenic
969021200 4:4141656-4141678 ATGCTGGGCAAAAGGGCAGCGGG - Intergenic
969968620 4:11022819-11022841 TTTCTGGTCTTGAGGGAAGGAGG + Intergenic
970536452 4:17035024-17035046 ATGCTGTTATTGGGGGAAGCTGG - Intergenic
974529850 4:63093599-63093621 ATTCTGGTCTAGATGGAATATGG + Intergenic
978888162 4:113790759-113790781 ATGATGGTGTAGAAGCAAGCTGG + Intergenic
981700256 4:147600173-147600195 AGGCCGGTCTAAAGGGAGGCAGG - Intergenic
981900636 4:149857898-149857920 ATGGTGGTATAGAGGCAAGCTGG + Intergenic
983035867 4:162865041-162865063 ATGCAGGTCTCCAGGGAAGTGGG - Intergenic
983325722 4:166253481-166253503 ATGATGGTGTAGAGGGAAGTAGG - Intergenic
983863735 4:172738441-172738463 ATGGTGGTGTAGAGACAAGCTGG - Intronic
986710743 5:10486441-10486463 ATTCTGGTGAAGAGGGACGCAGG + Intergenic
987440623 5:17951784-17951806 ATGCAGGTCGCCAGGGAAGCAGG + Intergenic
988734455 5:34007117-34007139 ATGCTGTTTTAGAAGGAAGAAGG + Intronic
991974511 5:72172952-72172974 AAGCTATTCTAAAGGGAAGCAGG - Intronic
992115142 5:73532364-73532386 ATGCTGATCTGGAAGGAGGCGGG + Intergenic
992521585 5:77556962-77556984 ATGCTGGGCAAGAGGGAAAGGGG + Intronic
993613683 5:90084631-90084653 ATACTGGTCAACAGGGAAGTAGG - Intergenic
996010737 5:118479076-118479098 ATGCAGGTTTTCAGGGAAGCAGG - Intergenic
998116716 5:139543433-139543455 ACGTGGGTATAGAGGGAAGCTGG - Intronic
999424671 5:151476855-151476877 ATGGTGGGCTAGAGTGAAGTGGG - Intronic
1000179702 5:158796340-158796362 ATGCTGGTCTGGAGTGAGGTAGG - Exonic
1001338977 5:170826235-170826257 TTCCTGGTTTTGAGGGAAGCTGG - Intergenic
1002130675 5:177079728-177079750 TTGGTGGTCTCCAGGGAAGCGGG - Intronic
1002582138 5:180215370-180215392 ATGCTGGTGTAGAGGGATCCAGG + Intergenic
1006845993 6:37061873-37061895 ATTCTGGCCTAGAGTGAAGGTGG + Intergenic
1007206535 6:40156876-40156898 ATGCTGGACTAGAGGTTAGAGGG + Intergenic
1011156645 6:84340908-84340930 ATGCAGGTCACCAGGGAAGCTGG + Intergenic
1017255495 6:152328851-152328873 CTGCTGTGCTACAGGGAAGCAGG + Intronic
1023221419 7:37922965-37922987 CTGCTGGTCCAGGGGGATGCAGG + Intronic
1024319030 7:48046867-48046889 ATGCTTATCTAGAGGAAAACTGG + Intronic
1025093526 7:56081430-56081452 ATGCTGGCCAAGTGGGAAGTGGG - Intronic
1025216536 7:57060963-57060985 ATGCTGGCCAAGTGGGAAGTGGG - Intergenic
1025627287 7:63233413-63233435 ATGCTGGCCAAGTGGGAAGTGGG - Intergenic
1025654844 7:63509767-63509789 ATGCTGGCCAAGTGGGAAGTGGG + Intergenic
1026195688 7:68171485-68171507 ATGTTGGTCTAGTGGGAGGGAGG + Intergenic
1027882283 7:83855863-83855885 ATCCTTTTCTAGAGGGAGGCTGG + Intergenic
1032609304 7:133393963-133393985 AGGCTGGTCTAGGAGAAAGCAGG - Intronic
1035130872 7:156651923-156651945 ATGCTGCTCAAGAGGGAGCCCGG - Intronic
1035819079 8:2572068-2572090 AGACTGGGCTGGAGGGAAGCGGG + Intergenic
1036676186 8:10835620-10835642 ATGATGGTCTAATGGGAAACCGG - Intronic
1037399997 8:18486099-18486121 ATGCAGGTTTAGAGGCATGCTGG + Intergenic
1041003676 8:53478798-53478820 GTGCTGGAGTAGAGGGCAGCTGG - Intergenic
1041739790 8:61145980-61146002 ATGCTGGGATAGAAGGAAACTGG - Intronic
1041935128 8:63324895-63324917 AAGCAGGTCTGGGGGGAAGCTGG - Intergenic
1042837345 8:73090672-73090694 TTGCAGGCCTAGAAGGAAGCAGG - Intronic
1044545148 8:93450953-93450975 ATGATGGTAGAGGGGGAAGCAGG - Intergenic
1045181249 8:99785322-99785344 ATGCTGGTCTAGAGACCAGATGG - Intronic
1045342592 8:101267911-101267933 ATGCAGTCCTAGAGGGATGCAGG - Intergenic
1046801761 8:118436383-118436405 AGGTTGGTGTAGAGGGCAGCAGG + Intronic
1047387888 8:124426408-124426430 ATGCAGGTCCAGAGGGACTCTGG - Intergenic
1048502078 8:134987482-134987504 ATCCTGGCCGAAAGGGAAGCAGG - Intergenic
1048955665 8:139533976-139533998 ATCCTGGTTTAGAGTGAAGCGGG + Intergenic
1049047562 8:140164913-140164935 ATGCTAGACTAGAGAGAGGCAGG - Intronic
1051683276 9:19630208-19630230 ATTCTTGTTTAGAGAGAAGCTGG + Intronic
1055723215 9:79198759-79198781 ATTCTGCTCTGGAGGGAAACTGG + Intergenic
1056008415 9:82299556-82299578 AAGCTGTTTTATAGGGAAGCAGG + Intergenic
1056453226 9:86736550-86736572 ATTCTGGTCAACAGGGAAACTGG + Intergenic
1057565343 9:96161662-96161684 ATGCTGGTCTTGGGGGTAGGAGG - Intergenic
1057979897 9:99650275-99650297 ATGCAGGTCAAGAGGCAAGAAGG - Intergenic
1058681900 9:107447361-107447383 ATCCTGATCTAGAGGGAAGTGGG - Intergenic
1058948405 9:109880386-109880408 GTGTTGATCTAGAGGGAAGTAGG + Intronic
1061817191 9:133204561-133204583 ATGCTGGTCTGGCGGGAGGTGGG + Intergenic
1062327732 9:136020221-136020243 ATGCAGGTCTGGAGGGAAACCGG + Intronic
1189222753 X:39386372-39386394 GGGCTGGACTAGAGGCAAGCAGG - Intergenic
1189245166 X:39557705-39557727 CTGGTGGCCTAGAGGGAAACAGG + Intergenic
1189680846 X:43514302-43514324 AAGCTGGTGTAAAGGGAATCTGG + Intergenic
1189756643 X:44278632-44278654 ATGCGAGTCTATAGGGAAGGAGG - Intronic
1191893696 X:65971224-65971246 AGGCTGGTCCTGAGGGAAGGAGG - Intergenic
1194165348 X:90508054-90508076 ATGCAGGTTTTCAGGGAAGCTGG - Intergenic
1194884501 X:99296267-99296289 ATGCAGGTCTAGAAGGAGTCAGG - Intergenic
1196640098 X:118049732-118049754 ATGCTGGTCAAGGGGAAACCAGG - Intronic
1199239113 X:145526142-145526164 AAGCTGGGCTAGAAGGAAACTGG + Intergenic
1199418674 X:147617677-147617699 ATGCTGGCATAAAGGGCAGCTGG - Intergenic
1199988396 X:152969038-152969060 TTCCTGCTCTAGAGGGTAGCAGG + Intronic
1202591946 Y:26494150-26494172 AGTCTGGTCTATAGGTAAGCAGG + Intergenic