ID: 1144768574

View in Genome Browser
Species Human (GRCh38)
Location 17:17746362-17746384
Sequence TGCCTGCCTCGCTCTGAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 125}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144768574_1144768583 10 Left 1144768574 17:17746362-17746384 CCTCTTTCAGAGCGAGGCAGGCA 0: 1
1: 0
2: 1
3: 15
4: 125
Right 1144768583 17:17746395-17746417 TCGGTCTGGCTCTGGGCAGGAGG 0: 1
1: 0
2: 2
3: 20
4: 238
1144768574_1144768581 3 Left 1144768574 17:17746362-17746384 CCTCTTTCAGAGCGAGGCAGGCA 0: 1
1: 0
2: 1
3: 15
4: 125
Right 1144768581 17:17746388-17746410 GACTGGGTCGGTCTGGCTCTGGG 0: 1
1: 0
2: 0
3: 12
4: 139
1144768574_1144768578 -9 Left 1144768574 17:17746362-17746384 CCTCTTTCAGAGCGAGGCAGGCA 0: 1
1: 0
2: 1
3: 15
4: 125
Right 1144768578 17:17746376-17746398 AGGCAGGCAGCGGACTGGGTCGG 0: 1
1: 0
2: 3
3: 38
4: 350
1144768574_1144768580 2 Left 1144768574 17:17746362-17746384 CCTCTTTCAGAGCGAGGCAGGCA 0: 1
1: 0
2: 1
3: 15
4: 125
Right 1144768580 17:17746387-17746409 GGACTGGGTCGGTCTGGCTCTGG 0: 1
1: 0
2: 0
3: 13
4: 165
1144768574_1144768582 7 Left 1144768574 17:17746362-17746384 CCTCTTTCAGAGCGAGGCAGGCA 0: 1
1: 0
2: 1
3: 15
4: 125
Right 1144768582 17:17746392-17746414 GGGTCGGTCTGGCTCTGGGCAGG 0: 1
1: 0
2: 2
3: 23
4: 244
1144768574_1144768584 22 Left 1144768574 17:17746362-17746384 CCTCTTTCAGAGCGAGGCAGGCA 0: 1
1: 0
2: 1
3: 15
4: 125
Right 1144768584 17:17746407-17746429 TGGGCAGGAGGTAGAGAACCTGG 0: 1
1: 0
2: 1
3: 55
4: 640
1144768574_1144768579 -4 Left 1144768574 17:17746362-17746384 CCTCTTTCAGAGCGAGGCAGGCA 0: 1
1: 0
2: 1
3: 15
4: 125
Right 1144768579 17:17746381-17746403 GGCAGCGGACTGGGTCGGTCTGG 0: 1
1: 0
2: 0
3: 3
4: 73
1144768574_1144768585 23 Left 1144768574 17:17746362-17746384 CCTCTTTCAGAGCGAGGCAGGCA 0: 1
1: 0
2: 1
3: 15
4: 125
Right 1144768585 17:17746408-17746430 GGGCAGGAGGTAGAGAACCTGGG 0: 1
1: 0
2: 2
3: 38
4: 560

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144768574 Original CRISPR TGCCTGCCTCGCTCTGAAAG AGG (reversed) Intronic
900136237 1:1118244-1118266 TGCCTTCTTCCCTCTGACAGGGG - Intergenic
900404516 1:2486549-2486571 TGCCTGCCTGGCTCTGCCAAGGG + Intronic
900427997 1:2589188-2589210 AGCCTGCCCCACTCTGCAAGTGG - Intronic
900539532 1:3195984-3196006 AGCCACCCTCGCTCTGACAGGGG + Intronic
903651696 1:24926588-24926610 TGCCAGCCCCGCTCTGAAACAGG - Intronic
904454019 1:30636174-30636196 TGACTGCATCATTCTGAAAGGGG + Intergenic
910032938 1:82753397-82753419 TGCCTGTATGGCTTTGAAAGTGG + Intergenic
910386822 1:86692957-86692979 TGCCGGCCTGGCTCTAAGAGCGG + Intergenic
919834790 1:201566172-201566194 GGCCTGCCTCTCTCTGAAAGAGG - Intergenic
920375130 1:205504314-205504336 TGCCTGCCTGTCTCTAAAAGCGG - Intergenic
922613728 1:226948336-226948358 TGCCTGCCTCCCTCTTATATGGG + Intronic
923744237 1:236686220-236686242 TGCCACCCACGCTCTGAGAGCGG - Intergenic
923783224 1:237043250-237043272 TGCCTTCCACGCTTTGCAAGCGG - Intronic
924387506 1:243512944-243512966 TGCCTGCCCTGCTCTGGAAAAGG + Intronic
1065088382 10:22203681-22203703 TAGCTGCCCAGCTCTGAAAGGGG + Intergenic
1069562329 10:69439530-69439552 TGCCTGACTCACACTGGAAGAGG - Intergenic
1075955919 10:126522914-126522936 TGCCAGCCTCTCTCTTACAGAGG - Intronic
1076262803 10:129081774-129081796 TGCCTACCTTCCACTGAAAGGGG - Intergenic
1078679227 11:13460079-13460101 TCTCTGCCTCTCTCTGAAATAGG - Intronic
1079353403 11:19712384-19712406 TGGCTGGCGCGCTCTTAAAGCGG + Intronic
1080937873 11:36882502-36882524 TGCCTGCCTCCCTTTGCAGGAGG - Intergenic
1081527240 11:43935414-43935436 GGCCTGCCTGCCTCTGAAATTGG - Intronic
1082178431 11:49088814-49088836 TGGCTGTCTTGCTCTGAGAGGGG + Intergenic
1083147656 11:60771159-60771181 TGCCTGCCTGGCAGAGAAAGTGG + Intronic
1085035132 11:73295387-73295409 GGCCTGCCTAGCTCTGAAGTTGG + Intronic
1086686640 11:89741022-89741044 TGGCTGTCTTGCTCTGAGAGGGG - Intergenic
1088000853 11:104878302-104878324 CTCCTGCATCTCTCTGAAAGAGG - Intergenic
1089123481 11:116159772-116159794 TGTCTGCATCTCTCTGTAAGAGG - Intergenic
1089740593 11:120579323-120579345 TGGCTGGCTCCTTCTGAAAGGGG - Intronic
1089916343 11:122160762-122160784 TCCCTGCCTCGCTATGATAGTGG + Intergenic
1091994494 12:4982578-4982600 TGCCTGGCTCCCTCTGAAGCAGG + Intergenic
1101189726 12:102319639-102319661 TGTCTGCATCACTCTTAAAGTGG - Intergenic
1101572979 12:105972118-105972140 TGCCTACCACACCCTGAAAGTGG - Intergenic
1102549113 12:113678343-113678365 TGCCTGGCTTGCTCTGAACCTGG - Intergenic
1104061114 12:125269360-125269382 TGCCTGCCTCGCTCCACAAAGGG - Intronic
1104241048 12:126989985-126990007 TGCCTCCAGCTCTCTGAAAGAGG - Intergenic
1105969105 13:25412119-25412141 TGCCTGCCTGTCTCTGAGAGGGG - Intronic
1110515635 13:76408943-76408965 TGCCTTCCTTGCTGTGAAAAAGG + Intergenic
1111995207 13:95158739-95158761 TGCCTGCCTCACTATCATAGAGG + Intronic
1113908635 13:113831649-113831671 AGCCTGGCTCCCTCAGAAAGGGG - Intronic
1114880257 14:26776008-26776030 TGCCAGCTTGGTTCTGAAAGGGG - Intergenic
1115747659 14:36453998-36454020 GGCATGCCTAGCTCTGGAAGTGG - Intergenic
1117625356 14:57631552-57631574 TGCCTGCCTCGTTATGAGGGAGG + Intronic
1118834481 14:69467196-69467218 TGACTGCCTTGCTCTCAAAGAGG - Intergenic
1120276067 14:82374215-82374237 TGCCTTTCTAGCTCTGTAAGAGG - Intergenic
1121678908 14:95776526-95776548 TGCCTACCCAGCTCTAAAAGAGG - Intergenic
1122004824 14:98693806-98693828 TGCCTGCCTCTCTCTTAGAAAGG + Intergenic
1122241103 14:100368075-100368097 TGCCTGCTTCCCTCTGAAGTGGG - Intronic
1123061282 14:105595702-105595724 AGCCTGCCTCAGTCTGACAGCGG - Intergenic
1123085736 14:105716613-105716635 AGCCTGCCTCAGTCTGACAGCGG - Intergenic
1128946632 15:71827409-71827431 TGCCTGCCACCCTCAGAAAATGG + Intronic
1136016119 16:27402268-27402290 TGCCTGCCTCTCCCTGAGTGTGG + Exonic
1137610129 16:49812345-49812367 TGCCTGGCTGGCTATGAGAGGGG + Intronic
1137988632 16:53131018-53131040 TCCCTGCCCCGCGCTGACAGGGG + Intronic
1139579027 16:67861023-67861045 AGCCTGGCTCTCTCAGAAAGGGG - Intronic
1142808423 17:2383907-2383929 TGCCTCCGCCGCTCTGAAAATGG - Intergenic
1143770031 17:9162690-9162712 TGCCTGCCTGGCTCTGCTAGTGG + Intronic
1144768574 17:17746362-17746384 TGCCTGCCTCGCTCTGAAAGAGG - Intronic
1146744469 17:35315102-35315124 TGCCTGCCTCTCTCTCAGAGAGG - Intergenic
1147041822 17:37725401-37725423 TGTCAGCCTCCCTCTGATAGGGG - Intronic
1152047362 17:77946185-77946207 TGCCTGCCGTGCTCCGACAGTGG - Intergenic
1152471736 17:80493299-80493321 TGCCTGCCTGGCTCTGCCTGGGG + Intergenic
1152517461 17:80834161-80834183 TCCCTGCCTTGCTCTGAGTGGGG + Intronic
1153667955 18:7383189-7383211 GCCCTGACTCCCTCTGAAAGAGG - Intergenic
1160571894 18:79823056-79823078 TGCCTGCCTGGCTGTGCAGGAGG - Intergenic
1160951040 19:1667561-1667583 GGCTTGCCTGGCTCTGTAAGGGG + Intergenic
1161234387 19:3190625-3190647 AGCCAGCCTCGCTCTGAAGGTGG - Intronic
1163322129 19:16581046-16581068 TGGCTGCCTCCCACTGGAAGTGG - Intronic
1163691124 19:18739049-18739071 TGGCTGCCTGGCTGTGAGAGTGG - Intronic
1165136427 19:33672799-33672821 AGCCTGCATCTCTCTGACAGAGG + Intronic
929287415 2:40150837-40150859 GGCCTGCCTTGTTCTGGAAGTGG + Intronic
931011262 2:57916781-57916803 TGACTGTCTGGCTCTGAAATTGG + Intronic
932642119 2:73459718-73459740 TGTCTTCCTAGCTCAGAAAGTGG - Intronic
936078713 2:109418081-109418103 AGGCTGCCTGGCTCTGAATGGGG - Intronic
936252302 2:110876270-110876292 TGCCTGCCTCTCTCTGGGTGTGG - Intronic
936508946 2:113130297-113130319 CCTGTGCCTCGCTCTGAAAGTGG + Intronic
936685401 2:114821393-114821415 TGCCTGCCAGGCTCTAAAAGTGG + Intronic
937081811 2:119145603-119145625 TGCCTGCCTCTCTTAGAAAGTGG + Intergenic
937335480 2:121059776-121059798 TGCCTGCCCAGCCCTGACAGTGG + Intergenic
941905189 2:170713066-170713088 TGCCCGCCTCCCTGGGAAAGGGG + Exonic
942073957 2:172339725-172339747 TGCCTGCCTGGCTGCGAAAGAGG - Intergenic
945891716 2:215436735-215436757 TGCCTGTCTGGCTCTGAGAAAGG + Intergenic
948497636 2:238362762-238362784 TGCCTGCCATGCTCAGAAAATGG + Intronic
949031450 2:241799250-241799272 GGCCTGTCTCCCTCTGGAAGAGG + Intronic
1172597905 20:36162929-36162951 TTCTTGCCTGGCTGTGAAAGTGG + Intronic
1173813294 20:45969439-45969461 TGCCTGACTCACTCTGGATGAGG + Exonic
1175133370 20:56806041-56806063 TGCCTGGCTTGCTCTGGGAGAGG + Intergenic
1175819705 20:61902202-61902224 TGCCTGCCCTGCTCTGAAAACGG - Intronic
1177946874 21:27481323-27481345 AGCCAGCCTGGTTCTGAAAGAGG - Intergenic
1180721293 22:17910729-17910751 GGCCTGTCTCACTCTGCAAGGGG + Intronic
1180971938 22:19820416-19820438 TGCCTGCCTCCCTGTGACAAGGG + Intronic
1183320297 22:37161257-37161279 TGCACTCCTCCCTCTGAAAGTGG - Intronic
1184091121 22:42293554-42293576 TCCCTGCCTGACTCTGTAAGGGG + Intronic
954422759 3:50427257-50427279 TGGCTGCCTCCCTCTGTAGGCGG + Intronic
954957790 3:54537394-54537416 TGCTTGCCTCTCTGTGAAATGGG + Intronic
959918738 3:111847749-111847771 TTCCTGGCTCTCTCTAAAAGTGG + Intronic
962355415 3:134689911-134689933 TCCCTTCCTCGCTATGGAAGGGG - Intronic
963868717 3:150390458-150390480 TGCCATCCTCTCTCTGCAAGGGG + Intergenic
966933513 3:184690956-184690978 TGCCTGTGTTTCTCTGAAAGAGG - Intergenic
967841330 3:194007250-194007272 TGACTGCCCCTCCCTGAAAGAGG + Intergenic
968894962 4:3394096-3394118 TGCCGGCATCTCTCTGAACGTGG + Intronic
969565944 4:7978196-7978218 TGTCTGCCTCGGGCTGAGAGTGG - Intronic
976986036 4:91299187-91299209 TGTCTGCCTCACTCTTAAAAGGG - Intronic
980457598 4:133065776-133065798 TGCCTTCCTGGCTCTGACAAAGG + Intergenic
986002640 5:3642363-3642385 TCCCTGCCTCACTCTGGGAGTGG - Intergenic
987146861 5:14999943-14999965 TGCCTCCCTCCCCCTGGAAGAGG - Intergenic
988461002 5:31437824-31437846 TGCCTGGCACTCTCTGAAAGAGG + Intronic
989098202 5:37800551-37800573 TGTCTTCCTTGCTCAGAAAGGGG + Intergenic
989751555 5:44900713-44900735 TGGCTTCCTAGATCTGAAAGTGG + Intergenic
995557405 5:113344000-113344022 TGACTTCCTCTCACTGAAAGAGG + Intronic
995667892 5:114565360-114565382 TGCTTCCCTTGCTCTGACAGTGG - Intergenic
998176632 5:139905360-139905382 TGCCTGCCTAGCTCTGCCTGAGG + Intronic
1000246667 5:159453938-159453960 TGGCTGCCTCCCTCTGCATGAGG - Intergenic
1000971136 5:167715984-167716006 TGCTGCCATCGCTCTGAAAGTGG + Intronic
1001698258 5:173688675-173688697 TGTCTGCCTCTCTTTCAAAGGGG + Intergenic
1002895780 6:1379392-1379414 TCGCAGCCTGGCTCTGAAAGTGG - Intergenic
1003229472 6:4238592-4238614 TCCTTGCCTGGCTCTGATAGGGG + Intergenic
1005277921 6:24239501-24239523 TGCCTGCCTCGGTGTTACAGGGG - Intronic
1017324806 6:153131810-153131832 TGACTTCCTCGCCCAGAAAGAGG + Intergenic
1020363809 7:7358075-7358097 TGCCTCACTTGCCCTGAAAGTGG - Exonic
1024329287 7:48140252-48140274 TGCCTGACATTCTCTGAAAGGGG + Intergenic
1034020893 7:147641113-147641135 TGCCGGCCTGGCTCTAAGAGCGG + Intronic
1034230807 7:149527010-149527032 TCCTTGCCTCCCTCTGAGAGAGG + Intergenic
1035259318 7:157651597-157651619 TGCCTGGCTGGCTCTGAGTGAGG - Intronic
1036991738 8:13605698-13605720 TGCATGCCTCCCTCAGAAAGTGG + Intergenic
1037988618 8:23305154-23305176 TGTCTGCATCGCTCAGAGAGGGG + Intronic
1039930705 8:41985643-41985665 TGTCTGCCTCTATCTGGAAGAGG - Intronic
1042568274 8:70134607-70134629 TGCCTGCCTCCTCCTGACAGTGG - Intronic
1046867430 8:119166209-119166231 TGTGTGGCTGGCTCTGAAAGAGG + Intronic
1051140909 9:13978196-13978218 TGGCTGCCTCTCTCTAAATGTGG + Intergenic
1051351685 9:16203630-16203652 TGACAGCCTCTCTCTGCAAGAGG - Intergenic
1058150541 9:101459118-101459140 TGCCTCCCCTTCTCTGAAAGAGG - Intergenic
1060932557 9:127498010-127498032 TGCCTGCCTCCCTGGGGAAGAGG + Intronic
1062021522 9:134321720-134321742 AGCCTCCCTGGCTCTGAAGGTGG - Intronic
1185675122 X:1842905-1842927 TCTCTGCCTCCCTCTGCAAGTGG - Intergenic
1186500553 X:10047241-10047263 TTCCTGCCTTGCTCAGACAGCGG + Intronic
1191110163 X:56798274-56798296 TCTCTGCCTCTATCTGAAAGGGG - Intergenic
1194091414 X:89584385-89584407 TGTCTGGCTCCCTCTGAATGCGG + Intergenic
1197268758 X:124403600-124403622 TGACTGCCTCTCTCTGGAATTGG + Intronic
1197704267 X:129622722-129622744 TGCCTGCCTTCCTCAGAGAGAGG + Intergenic
1200289813 X:154861068-154861090 TGCCTGACTCTGTCTGAAAGAGG - Intronic
1200444054 Y:3240450-3240472 TGTCTGGCTCCCTCTGAATGCGG + Intergenic