ID: 1144769166

View in Genome Browser
Species Human (GRCh38)
Location 17:17749760-17749782
Sequence CTTTCATGGAGCTTACAGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 483
Summary {0: 1, 1: 1, 2: 14, 3: 83, 4: 384}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144769166 Original CRISPR CTTTCATGGAGCTTACAGTA TGG (reversed) Intronic