ID: 1144769357

View in Genome Browser
Species Human (GRCh38)
Location 17:17750985-17751007
Sequence CCTCCTCTGTGGAAGGCGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 318
Summary {0: 1, 1: 0, 2: 0, 3: 35, 4: 282}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144769357_1144769364 -4 Left 1144769357 17:17750985-17751007 CCTTCCGCCTTCCACAGAGGAGG 0: 1
1: 0
2: 0
3: 35
4: 282
Right 1144769364 17:17751004-17751026 GAGGAAGATGGGTACACATGTGG 0: 1
1: 2
2: 0
3: 15
4: 256
1144769357_1144769365 24 Left 1144769357 17:17750985-17751007 CCTTCCGCCTTCCACAGAGGAGG 0: 1
1: 0
2: 0
3: 35
4: 282
Right 1144769365 17:17751032-17751054 AACCATTAGCCGTCGACTTCCGG 0: 1
1: 0
2: 0
3: 1
4: 23

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144769357 Original CRISPR CCTCCTCTGTGGAAGGCGGA AGG (reversed) Intronic
900271227 1:1790035-1790057 CCTCCTCTTTAGCACGCGGATGG - Intronic
900322816 1:2093481-2093503 CCACTTCTCTGGAAGGCGAAAGG + Intronic
900341032 1:2189419-2189441 CCCCCACTGTGGACAGCGGACGG - Intronic
900457157 1:2782759-2782781 CCTCCTCTGTAAAAGGAGGAGGG - Intronic
900620855 1:3586985-3587007 CCACCTGTGTGCAAGGAGGAAGG + Intronic
900954034 1:5875829-5875851 CCTCCTCTGTGTTAGACAGAAGG - Intronic
901677513 1:10894867-10894889 CCAGCACTTTGGAAGGCGGAGGG - Intergenic
902812193 1:18894630-18894652 TCTGCCCTGTGGAAGGAGGAGGG - Intronic
902814785 1:18910061-18910083 CCTGCTCTGTGCAAGACGGTGGG - Intronic
903029718 1:20454993-20455015 CCTCCCCTGTGGAATGGGAATGG + Intergenic
903176822 1:21586412-21586434 CCGTCTCTGGGGAAGGCGGGTGG + Intergenic
903293681 1:22330311-22330333 TCTCCTGTGTTGCAGGCGGAAGG + Intergenic
904646263 1:31969136-31969158 CCTGCACTGTGGGAGGCCGAGGG + Intergenic
905272961 1:36798802-36798824 ACTCCTGTGTGGAAGCAGGAGGG - Exonic
905777714 1:40680043-40680065 CCTGCACTTTGGAAGGCTGAGGG + Intergenic
906412309 1:45588496-45588518 CCTGCACTTTGGAAGGCAGAAGG - Intronic
906570558 1:46834705-46834727 CCACCACTTTGGAAGGCAGAAGG - Intergenic
907393557 1:54174400-54174422 CCTACTATGTAGAAGGAGGATGG - Exonic
907479835 1:54737854-54737876 CCTCTTACGTGGATGGCGGAAGG + Intronic
908350062 1:63277912-63277934 GCTCCTGTGTGGTAGGCAGAGGG - Intergenic
909327611 1:74371055-74371077 CCACCTCTGTGGAAGCCCAAAGG + Intronic
910566547 1:88650005-88650027 TCTCCTCTGTGCAAAGCAGAGGG + Intergenic
911155277 1:94630204-94630226 AGTCCTCTGTGGAAGGAAGAAGG + Intergenic
912398572 1:109368734-109368756 CCTCCTTTGTGGCAGGGGCAGGG + Intronic
917839579 1:178966744-178966766 CCTCATCTGTGAAATGAGGATGG + Intergenic
918640705 1:186837907-186837929 CCTCCTTTGTGGCAGGGAGAAGG + Intronic
919747222 1:201016495-201016517 CCAGCTCTGGGGAAGGCGGCTGG + Intronic
921263017 1:213400532-213400554 CCTCATCTCTGGAAGGGGCAGGG - Intergenic
921297985 1:213722620-213722642 CCTCCACTGGGGAAGGGAGATGG - Intergenic
921686544 1:218095449-218095471 CAACCTCTGTGGAAGGAAGAGGG + Intergenic
922824807 1:228510418-228510440 CCTCCTCCCTGAAAGGAGGAAGG - Intergenic
923544126 1:234911988-234912010 GCTTGTGTGTGGAAGGCGGAGGG + Intergenic
1062897457 10:1115106-1115128 CCTCCTCTGTGGGTGGCAGGTGG + Intronic
1063686490 10:8241753-8241775 CCAGCTATGTGGAAGGCTGAAGG + Intergenic
1066180798 10:32958572-32958594 CCTCCTCTGCGAAGGGCGGGAGG + Intronic
1066537725 10:36409926-36409948 TCTCCTGTGTGGAAGGCTAAAGG + Intergenic
1066644732 10:37594888-37594910 TCTCCTGTGTGGAAGGCTAAAGG + Intergenic
1067470756 10:46536175-46536197 CCTCCTGTGTGGCAGGGGCAGGG - Intergenic
1069718045 10:70533146-70533168 CTTCCTCTGAGGAAGGCGAGAGG - Intronic
1069791420 10:71024676-71024698 CATCCCATGTGGAAGGTGGAAGG - Intergenic
1069855198 10:71436336-71436358 CCTGCACTGTGGAAAGCGAAAGG + Intronic
1070550630 10:77488291-77488313 GCTGCTCTGGGGAAGGGGGATGG + Intronic
1070742217 10:78910656-78910678 CCTCCTCTGTGAGATGGGGATGG + Intergenic
1071584051 10:86801961-86801983 CCAGCACTTTGGAAGGCGGAGGG - Intronic
1072626033 10:97112575-97112597 CCTCATCTGTGAAATGGGGATGG - Intronic
1072686443 10:97540040-97540062 CCTTCTCTGAGGAAGGGGGAGGG + Intronic
1073053997 10:100687428-100687450 GCTCCTCTCTGGGAGGAGGAAGG - Intergenic
1073543317 10:104329295-104329317 CCTCCTCTCTGGAGAGCAGAGGG + Intronic
1074059086 10:109948693-109948715 CCTCCTCTGTGAAATGAGGATGG - Intronic
1075696187 10:124437272-124437294 CCAGCACTGTGGAAGGCCGAGGG - Intergenic
1076826566 10:132972486-132972508 GCTGCCCTGTGGGAGGCGGAGGG - Intergenic
1080438823 11:32271458-32271480 ATTCCAATGTGGAAGGCGGAAGG - Intergenic
1081195141 11:40152131-40152153 CCCCATCTGTGGAAGTAGGAAGG + Intronic
1082091204 11:48091082-48091104 CCTCCTTGATGAAAGGCGGAGGG + Intronic
1083844142 11:65321309-65321331 CCTCCTGTGGGGAAGGCTGAGGG - Exonic
1085709909 11:78819908-78819930 CCTCCTCTGGGGAAGCCAGGAGG - Intronic
1086462175 11:87016946-87016968 CCTCCTCTCTTGGAGGTGGAAGG - Intergenic
1086883841 11:92180727-92180749 CTTCCTCTGGGGTAGGGGGAAGG - Intergenic
1088373254 11:109114183-109114205 CCTCCTATGTGTAAGGTGGTTGG - Intergenic
1088991864 11:114960868-114960890 GCTCCTCAGTGGAAGCCAGAAGG + Intergenic
1090043778 11:123313413-123313435 CCTCCTCTGTAGAAGGCCCCGGG + Intergenic
1090273295 11:125402792-125402814 CCCCCTCTGAGGAAGGATGAAGG - Intronic
1092477036 12:8828340-8828362 ACTCCTCTGTGAAAAGGGGAAGG - Intronic
1093662630 12:21774800-21774822 CCACTTCAGTGGAAGGAGGAGGG + Exonic
1093723649 12:22477695-22477717 CCTCCTCTGTGGATGACTGATGG - Intronic
1094728579 12:33148149-33148171 CCTCCTCTGTGGTAGTAAGATGG + Intergenic
1096290262 12:50336282-50336304 CCTCTTCTGTAGAATGAGGATGG - Intronic
1096536547 12:52278773-52278795 CCTCCTCTTGAGAAGGCAGAAGG + Intronic
1096572765 12:52533240-52533262 CCTCCTCTCTGGAAGCCCTAAGG + Intergenic
1099955152 12:89346066-89346088 TTTCTTCTGTGGAAGGTGGAAGG - Intergenic
1101587883 12:106101033-106101055 CCTTCTCTCTGGAAGCCGGTTGG - Intronic
1101885477 12:108657557-108657579 CCTCATCTGGGGAAGGGGGATGG - Intronic
1101901240 12:108792606-108792628 CATCCTCAGGGGAAGGCAGAAGG + Exonic
1102111229 12:110366880-110366902 CCTCCCCTGTTGAGGGCTGAGGG - Intergenic
1102854170 12:116278180-116278202 TCTCCTCTGCAAAAGGCGGACGG - Intergenic
1103269653 12:119662545-119662567 GCTCCTCTGTGGTTGGCTGAGGG + Intergenic
1104096100 12:125559573-125559595 CCCCCTCTGTGTGATGCGGATGG + Intronic
1104586760 12:130053908-130053930 CCTCTTCTGTGGCAGGAGAAAGG - Intergenic
1105004275 12:132711183-132711205 CCTCCGCTGGGGAAAGCAGACGG - Intronic
1105432306 13:20348030-20348052 CATCCTCTGTGGAAGGCACATGG + Intergenic
1105890908 13:24681422-24681444 CCTCCTCTGGGGAGGCCGGAGGG - Intronic
1106750200 13:32756349-32756371 CTTCCTCTGTAGAAGGAGAATGG + Intronic
1106804014 13:33287545-33287567 CATCGTCTGTGGAAGGTGAAAGG + Intronic
1107269482 13:38598404-38598426 CGACGTCTGTGGAAGGAGGAAGG + Intergenic
1111649893 13:91076247-91076269 CCTTCTCTGTGAAATGTGGAAGG + Intergenic
1112356709 13:98679529-98679551 TCTCCTCTGTGGAATGGGAATGG + Intergenic
1112854154 13:103745810-103745832 ATTCCACAGTGGAAGGCGGAAGG + Intergenic
1113933656 13:113981853-113981875 AGGCCTCTGTGGAGGGCGGAGGG + Exonic
1114267215 14:21079942-21079964 CCTCATCTATAGAATGCGGATGG + Intronic
1114407453 14:22470149-22470171 ACTCCTCTGTGTAAAGAGGAAGG + Intergenic
1114408581 14:22479255-22479277 CCTCCTCTGTAGAATGGGGGAGG + Intergenic
1114634163 14:24178074-24178096 CCTCCTCTGTTGAGTGGGGAGGG - Exonic
1116246693 14:42424243-42424265 TGTCTTCTGTGGAAGGCAGAAGG + Intergenic
1120624447 14:86807309-86807331 CCTCACATGTGGAAGGCAGAGGG + Intergenic
1120837823 14:89057007-89057029 CCAGCTATGTGGAAGGCTGAGGG - Intergenic
1121523499 14:94602384-94602406 CCTTCTCTGTGGAAGGCCAGAGG - Intronic
1121694124 14:95899179-95899201 CCTCCTCTGTGGTATGCTGGAGG + Intergenic
1122075906 14:99234369-99234391 CCTCCTCTGAGGAAGGATGGGGG - Intronic
1122138518 14:99648328-99648350 CCTCATCTGTGGAAGGGGAAAGG - Intronic
1122242094 14:100375881-100375903 CCTCATCTGTGGAATGGGCATGG + Intronic
1122352425 14:101103788-101103810 CTGCCTCTGGGGGAGGCGGAGGG - Intergenic
1122636837 14:103133976-103133998 CCTCCTCTGTGAAACGGGAATGG - Intronic
1122699996 14:103581916-103581938 CCTGCTCTGTGGAGGGAGGGTGG + Intronic
1128346281 15:66854509-66854531 CCTCCTCTGTTGCAGGCACAGGG - Intergenic
1129249656 15:74301930-74301952 TCTCCTCTGAGCAAGGCAGAAGG - Intronic
1129252257 15:74315473-74315495 CCTCCTCTGTGGAATGGACATGG + Intronic
1130660747 15:85829905-85829927 CCACCACTGAGGAAGGAGGAAGG + Intergenic
1131300406 15:91194786-91194808 CCCCCTCTGTGGAAGGATCATGG + Intronic
1131386798 15:92014759-92014781 CCTTCTCTGTGGAGGGAGAAGGG + Intronic
1131447242 15:92510682-92510704 CCACCACTATGGAAGGCGGGAGG - Intergenic
1133233043 16:4375257-4375279 CCTCCTGGGTGGAGGGAGGAGGG + Intronic
1133411093 16:5569571-5569593 CCTCATCTGTGAAATGGGGATGG - Intergenic
1133463981 16:6012202-6012224 CCTCATCTGTAGAATGAGGATGG + Intergenic
1133872795 16:9705227-9705249 CCTCATCTGTAAAAGGCGGATGG - Intergenic
1134572825 16:15306254-15306276 CCTCATATGTGGAAGGTGGAAGG - Intergenic
1134729561 16:16449782-16449804 CCTCATATGTGGAAGTTGGAAGG + Intergenic
1134937875 16:18262124-18262146 CCTCATATGTGGAAGGTGGAAGG - Intergenic
1135017385 16:18935198-18935220 GCTCCTCTGTGGGAGGTGGGGGG - Intergenic
1136490205 16:30602942-30602964 CCACCTCTGTGGAGGGAGGCTGG + Exonic
1137399219 16:48139707-48139729 CCTCCTTTGTGGAAGGAGTGTGG + Intronic
1137563354 16:49517016-49517038 GCTCCTCTGTACAAGGAGGAAGG - Intronic
1138592973 16:58012675-58012697 CACTCTCTGTGGAAGGGGGAAGG - Intronic
1139122888 16:64042340-64042362 CATCCTATGTGGATGGCGGCAGG + Intergenic
1139440866 16:66966164-66966186 CCCTCTCTGTGGGAGGCAGAAGG + Intronic
1140807740 16:78548653-78548675 TCACTTCTGTGGCAGGCGGATGG - Intronic
1141405162 16:83786053-83786075 CCTCCTCTCTGGAGGAGGGATGG - Intronic
1142236096 16:88923278-88923300 CCTCCTCTGTGCGATGAGGAGGG - Intronic
1142483863 17:234437-234459 CTTCCTTTGTGGAAGTCAGAAGG - Intronic
1143780795 17:9228273-9228295 GCTCCTCGGTGGAGGGAGGAAGG + Intronic
1143858412 17:9869892-9869914 CCTCCACTTTTGAAGGCAGAAGG + Intronic
1144684774 17:17218874-17218896 CCTCCTCGGTGGGTGGCTGAGGG - Intronic
1144695456 17:17301237-17301259 GCTCCTCGGTGGAAGGGGGCGGG + Intergenic
1144769357 17:17750985-17751007 CCTCCTCTGTGGAAGGCGGAAGG - Intronic
1144775883 17:17784322-17784344 CCTAGGCTGGGGAAGGCGGAAGG + Intronic
1146626990 17:34442480-34442502 CCTCCTCAGTGAAATGGGGATGG - Intergenic
1146820847 17:35982738-35982760 CCTTATCTGTGGAAGGCTGGAGG + Intergenic
1147145668 17:38483067-38483089 CTTTCTCTGTAGAAGGCAGAGGG + Intronic
1147630977 17:41931410-41931432 GCTGCTCTGTGGAAGGAGGCCGG - Intronic
1148182310 17:45615037-45615059 CCACCTCTGTGGAAACTGGAAGG + Intergenic
1149610592 17:57955531-57955553 CCTCCTCTCTGGAAAGGGGTCGG - Intergenic
1150473110 17:65454178-65454200 CCTCATGTGGGGAAGGTGGAGGG - Intergenic
1150652730 17:67020312-67020334 GCTCCTCTGGGGAGGGCGCAAGG + Intronic
1151536784 17:74743412-74743434 CCTGCCCTGTGGAAAGCGGGTGG + Intronic
1151996242 17:77611098-77611120 CCTTCTCGGTGGAGGGAGGATGG - Intergenic
1152127221 17:78454469-78454491 CCTCTTCTGTCCCAGGCGGATGG + Exonic
1152256677 17:79244022-79244044 CTTCATGTGTGGAAGGCCGAGGG - Intronic
1152531360 17:80921323-80921345 CCTCATCTGTGTCAGGAGGATGG - Intronic
1152651966 17:81499046-81499068 CCTCCGCCCTGGAAGGCGCACGG - Intergenic
1152708028 17:81855401-81855423 CCTCCTCAATGGATGACGGAAGG + Intronic
1153729193 18:7990662-7990684 CCTCCTCTGTTTAAGCCTGAAGG - Intronic
1154999832 18:21675240-21675262 CCTCATCTGTGGAATGAGGTGGG + Intronic
1155454483 18:25996789-25996811 CCCCCTCTTTGGAAGTGGGAAGG - Intergenic
1156490587 18:37493622-37493644 CCTCCTCTGAGGAAGACGTATGG - Intronic
1156939864 18:42754239-42754261 CCTTCTTTGTGGTAGGCAGAAGG + Intronic
1157307082 18:46525199-46525221 CCTCCTCTGTGTAAGGGGGCTGG + Intronic
1157396143 18:47343264-47343286 CATCCTCTGGGGAAGGGAGAGGG - Intergenic
1157480909 18:48053150-48053172 TTTCCTCTGGGGCAGGCGGAAGG - Intronic
1157770250 18:50339366-50339388 CATCCTCTGTGGAAGGTGATTGG - Intergenic
1159327583 18:66943211-66943233 CCTCCTCTGTGCCACGAGGAAGG - Intergenic
1160837935 19:1133258-1133280 CCTCCTCTGTGAGGGGAGGAAGG + Intronic
1161107060 19:2449244-2449266 GCTCCTCTGTGGAATGCTGTGGG - Intronic
1161407265 19:4097649-4097671 CCTCCTCTCTGGAGGGCAGGGGG + Intronic
1161505287 19:4640348-4640370 CCTTCTCTATGGAGGGGGGAAGG + Intronic
1161579737 19:5074260-5074282 CCTCCCCTCTGGAAGGCAGCTGG + Intronic
1161812794 19:6480046-6480068 CCCCCTCTGTGGGATGCAGAAGG + Exonic
1162604652 19:11697341-11697363 CCAGCACTGTGGAAGGCTGAGGG - Intergenic
1163846397 19:19640566-19640588 CCTCCCCTGGGGAAGATGGATGG + Exonic
1163848604 19:19651147-19651169 CCTCCTCTGTGGTGTGGGGAAGG + Intronic
1164217093 19:23160379-23160401 CAAACACTGTGGAAGGCGGAAGG - Intergenic
1165739528 19:38197168-38197190 CCTCCTCTGTGCAGGGCCAAGGG - Intronic
1165952727 19:39483247-39483269 CCTCCCCAGTGGAAGGAGGAGGG - Intronic
1166810148 19:45509414-45509436 CAGGCTCGGTGGAAGGCGGATGG + Intronic
1167134483 19:47608812-47608834 CCTCCTCCGGCGAGGGCGGAGGG + Intronic
1167145181 19:47677080-47677102 CCTCGTCTGTGAAATGAGGAAGG + Intronic
1167737872 19:51308104-51308126 CAGCCTCTGTGGAAGGGAGAGGG - Intergenic
1168306810 19:55440449-55440471 CCTGCCCTGCGAAAGGCGGACGG - Intronic
925640972 2:5985597-5985619 CCTCATCTCTGGAAGCCGGGAGG + Intergenic
926049943 2:9738238-9738260 CCTCATCTGTGAAATGGGGATGG - Intergenic
926928406 2:18011770-18011792 CCTCTTCTGTGAAATGGGGATGG + Intronic
927203062 2:20590421-20590443 CCTTCTCTGTAGAAGGATGATGG + Intronic
928408235 2:31031828-31031850 GCCCCTCTGTGGAGGGTGGAGGG - Intronic
929878248 2:45814789-45814811 CATCCTCTCTGGAGGGAGGAGGG + Intronic
930517995 2:52432202-52432224 CCTCCTTGGTGAAAGGTGGAGGG - Intergenic
930884907 2:56314391-56314413 CCTCATCTGTGGAATGAGAAGGG + Intronic
933902924 2:86862097-86862119 CCTCCTTTCTGGAAAGCGGAGGG - Intergenic
934605123 2:95689258-95689280 CATGCTCTGTGAAAGACGGAAGG - Intergenic
935488138 2:103683671-103683693 CCAGCACTGTGGAAGGCTGAGGG - Intergenic
935777621 2:106487172-106487194 CCTCCTTTCTGGAAAGCGGAGGG + Intergenic
935883264 2:107588133-107588155 CCTCCTCTGTGGTAGATGGTAGG - Intergenic
936538583 2:113331798-113331820 CATGCTCTGTGAAAGACGGAAGG - Intergenic
936697479 2:114967328-114967350 TCTGCTCTGTGGAAGCAGGAAGG + Intronic
936887446 2:117329839-117329861 TCTCCTCTGTGAAAGGCAAAAGG + Intergenic
937339286 2:121080742-121080764 CCTCCTCAGTGAAAGGGTGATGG - Intergenic
937410494 2:121670581-121670603 CCTCCTCTGGGGGAGGTGGCAGG - Intergenic
937969229 2:127536562-127536584 CGTCCTCTGTGAAATGGGGATGG - Intronic
938377947 2:130820724-130820746 CCTCCTCTGCGGCACGGGGAAGG + Intergenic
938951247 2:136256672-136256694 CCTCCTCTGTTAAAGGTTGAAGG + Intergenic
940712007 2:157173812-157173834 CTTCCTCTGTGGCAGGCATATGG - Intergenic
946059899 2:216932976-216932998 CCTCCTACGTGGATGGCAGATGG + Intergenic
947324681 2:228961475-228961497 CCTCCCCTGGGGAAGGAGCAAGG - Intronic
1169336893 20:4764037-4764059 CTTCCTCTGTGGAAGCCTGAGGG - Intergenic
1172378320 20:34464957-34464979 CCTACTCTTTGGGAGGCTGAGGG - Intronic
1172477338 20:35248803-35248825 CCTCCGCTTTGAAAGGCGGCTGG - Intronic
1172626632 20:36351124-36351146 CCTCCTCTGTGCCAGGCAGGGGG - Intronic
1172628684 20:36363832-36363854 CCTCCTGTGTGCCAGGCTGATGG + Intronic
1172767201 20:37357132-37357154 GCCCCTTTGTGGAGGGCGGATGG + Intronic
1172933366 20:38601475-38601497 CCTCCTCTGTGAAATGGGGATGG - Intergenic
1173169832 20:40715055-40715077 CCTCCTCTGCTGAAGGCTGGAGG + Intergenic
1173295365 20:41750535-41750557 CCTCATCCGTGGAAGTCAGAGGG - Intergenic
1173514825 20:43657784-43657806 CCTCCTCCGTGAAAACCGGAGGG - Intergenic
1175900794 20:62359192-62359214 CCTCATCTGAGGGAGGCGGGAGG + Intronic
1175988173 20:62774642-62774664 CCTCCACTGGGGCAGGCGGAGGG + Intergenic
1176201792 20:63864265-63864287 CCTCATCTGTGGAGTGGGGAGGG + Intergenic
1178628973 21:34243050-34243072 CATCCTCTGGGGCAGGTGGAAGG + Intergenic
1179897517 21:44370932-44370954 CCCTCTCTGTGGACGGCGGAGGG + Intronic
1180175620 21:46085760-46085782 CCTCCTCTGTCACAGGGGGAGGG - Intergenic
1181728303 22:24826894-24826916 CCTCATCTGTGTAACGGGGATGG - Intronic
1184043208 22:41956711-41956733 CCTCCCCTATGGAAGGGGAAAGG - Intergenic
1184093087 22:42302492-42302514 CTTCCTCTGTGAAAGGGGCATGG - Intronic
1185104696 22:48860752-48860774 GCTCCTCTGGGGAAGGCGCTCGG + Intergenic
949510041 3:4759540-4759562 CCTCATCTGTGAAATGTGGAAGG + Intronic
949935495 3:9112617-9112639 CCTCTCCTGGGGAAGGCGGAGGG + Intronic
950189606 3:10967416-10967438 CCTCATCTGTGAAATGCAGACGG - Intergenic
950374560 3:12560060-12560082 CCTCATCTGTGAAATGAGGATGG + Intronic
952455339 3:33467029-33467051 CATCCTGTGTGGGAGGGGGAGGG + Intergenic
953241818 3:41156128-41156150 CCTGCTTTGTGGAATGTGGATGG - Intergenic
953534841 3:43769741-43769763 CCTCCTCCAAGGAAGGCGGAAGG - Intergenic
953780904 3:45869628-45869650 CCTCCTTTGTGGAAGGTGCCTGG + Intronic
954260759 3:49436999-49437021 CCAGCACTGTGGAAGGCCGATGG + Intergenic
955682749 3:61519253-61519275 CATCCTATGTGGATGGCGGCAGG + Intergenic
958680217 3:97320547-97320569 ATTTCTCTGTGGAAGGAGGAAGG - Intronic
960786850 3:121383030-121383052 CCTGCACTTTGGAAGGCTGAGGG + Intronic
961485144 3:127210910-127210932 CCCCCTCTGTGGAATGGGGAGGG - Intergenic
961638505 3:128349969-128349991 CCACCACTGTGGAAGGGGGATGG - Intronic
965835209 3:172843383-172843405 CCTCCTCAGTGGATGAAGGAGGG + Intergenic
966394061 3:179483175-179483197 ACTCCTTTGTGGAAGGAGGCAGG - Intergenic
966908428 3:184544264-184544286 CCCACTCTCTGCAAGGCGGAGGG - Intronic
967986628 3:195100212-195100234 CATCCTCTGTGGATGTCTGACGG + Intronic
968010049 3:195268697-195268719 CCTCCTCTGTTGAGGGGTGAGGG - Intronic
969414750 4:7051014-7051036 CCTCCTCCGTGGGAAGCGCACGG + Intronic
969600541 4:8173645-8173667 CCTCATCTGTGCAAGGGCGATGG - Intergenic
972245766 4:37244491-37244513 ACTCCTCTGTGGACAGCCGAGGG - Exonic
974586644 4:63888573-63888595 CCTCCACTTTGGAAGGCCAAGGG + Intergenic
975199610 4:71570977-71570999 CCTCCTCTCTTGGAGGTGGAAGG - Exonic
981698324 4:147581309-147581331 GCCCCTCTGGGGAAGGCTGAGGG - Intergenic
983115476 4:163810849-163810871 TCTGCTTTGTGGAAGGTGGATGG - Intronic
984490764 4:180431759-180431781 CCTCCTCTGTGGCGGGGGAACGG + Intergenic
984758558 4:183344980-183345002 CCTCCTCCTTGGAAGCAGGATGG - Intergenic
985782959 5:1880621-1880643 CCCCCTTTCTGGAAGGCGGGAGG - Intronic
985952820 5:3236465-3236487 CCTCCTCTGTTCAAAGAGGAGGG + Intergenic
987183018 5:15386252-15386274 CCAGCTCTGGGGAAGGAGGAGGG - Intergenic
990685833 5:58300084-58300106 CCTTCTATGTGGAAGGGGGTTGG - Intergenic
991408969 5:66328330-66328352 CCTCCCATGTGGAAGGCAGAAGG - Intergenic
992765219 5:79991929-79991951 CCTCTTCTGTGAAAGGCAAAAGG - Intronic
993465417 5:88240127-88240149 GCTCCTTTGTGGAAGGAGTAGGG + Intronic
999769815 5:154766879-154766901 CCTCTTCTCTGAAAGGAGGAAGG - Intronic
1001396343 5:171421456-171421478 CCCCCTCGGTGGAAGGCAGGTGG + Intronic
1001401761 5:171450460-171450482 CCTCATCTGTGGAATGGGGATGG - Intronic
1002494942 5:179605453-179605475 CCTGCTGTCTGGAAGGGGGAAGG - Intronic
1002934363 6:1659146-1659168 CCTGCTCTGTGGAGGGAGGCTGG + Intronic
1007795374 6:44342800-44342822 CCTCCCCTGGGGAAGGGGGTGGG + Exonic
1008857763 6:56112505-56112527 CCTCTGCTGGGGAAGGGGGAGGG - Intronic
1013375297 6:109508902-109508924 CCTCCTTTGTTGAAGTCTGAAGG + Intronic
1017537673 6:155365699-155365721 CCTCCTCTGTGTAGGGTGGCAGG + Intergenic
1018358840 6:163045205-163045227 CCTCCTCTGTGGCCAGCAGAGGG + Intronic
1018837185 6:167494005-167494027 TCTGCTCTGTGAGAGGCGGACGG - Intergenic
1019384811 7:748629-748651 CCTCCACTGTGGTAGGGGGCAGG - Intronic
1021840187 7:24716097-24716119 CCCCATTTGTGGAAGGCGGGTGG - Intronic
1022509449 7:30925888-30925910 CCTGCTCTGTGGAGGGTAGAGGG - Intergenic
1024626598 7:51213221-51213243 CCTCGTCTGTGGCAGGCGGTTGG - Intronic
1026228001 7:68459567-68459589 CCTCCTCTGAGGATGGAGGATGG + Intergenic
1027234062 7:76287361-76287383 CTTCCTCTGAGGGAGGCGAAAGG + Intergenic
1027557309 7:79681771-79681793 CATCCTCCGTGGATGGCGGCAGG - Intergenic
1032322539 7:130898016-130898038 CCTCATCTGTGAAATGGGGATGG - Intergenic
1032476633 7:132215638-132215660 TCTCCTCTGGGGAAGGGAGAGGG + Intronic
1032597153 7:133253236-133253258 CCTCCGCTTTGGAAGGGAGAAGG + Intronic
1034343052 7:150370112-150370134 CCTCCTCCGCGGAAGGAGGAAGG - Intronic
1034481184 7:151321281-151321303 GCTCCTGGGTGGAAGGCGGCAGG + Intergenic
1034830074 7:154301308-154301330 CCTCTTCTGTGCAAGGCGCTTGG + Intronic
1034896348 7:154878704-154878726 CCACCCCTGTGGAAGGCAGCGGG + Intronic
1034900680 7:154906296-154906318 CCTCCTGGGTGGGAGGAGGAAGG + Intergenic
1036784561 8:11677335-11677357 CCACCTCAGTGGAAGAAGGAGGG - Intronic
1037889701 8:22617408-22617430 CTGCCTCTGTAGAAGGAGGATGG + Exonic
1039518771 8:38153810-38153832 CCTCCTCTCTGAAAGGTAGAGGG - Intergenic
1040470810 8:47734522-47734544 CCTCCTCTGTGCAAGGCATTTGG - Intronic
1041275804 8:56156683-56156705 CCTGCTCTATAAAAGGCGGATGG - Intergenic
1042383794 8:68150248-68150270 CCTCCTTTCTGGATGGGGGAGGG + Intronic
1042648432 8:71013014-71013036 CCTCCTCTTTGGGAGAAGGATGG + Intergenic
1045057635 8:98382929-98382951 CCTCTTCTGTGGGAGGCAGGCGG - Intergenic
1047125558 8:121955791-121955813 CCTCCTCTGTGGAAAGGCAAAGG - Intergenic
1047863400 8:128993925-128993947 CCTGATCTTTGGAAGGCGGAAGG + Intergenic
1047980359 8:130174605-130174627 CCACCTCTGGGGAGGGCAGAGGG + Intronic
1048354582 8:133642788-133642810 CCCCACCTGTGGAAGGCGGAAGG + Intergenic
1049005376 8:139852145-139852167 CATCATCTGTGGAAGGCAGCAGG - Intronic
1049410469 8:142471755-142471777 CCGCCTCTGTGGCGGGAGGAAGG + Intronic
1049414178 8:142487894-142487916 CTCCCTCTGTAGAAGGGGGATGG - Intronic
1049815083 8:144595442-144595464 GCTTCTCTGTGGGAGGTGGATGG + Intronic
1050353700 9:4763467-4763489 CCTCCTAGGAGGAAGGCGGGGGG + Intergenic
1053299119 9:36936267-36936289 ACTCCTGTGGGGAAGGGGGATGG + Intronic
1053428330 9:38025637-38025659 CCTCATCTGTGAAATGAGGATGG + Intronic
1054804758 9:69387086-69387108 CCTCCATTGTGGAAGGCGCCAGG + Intronic
1056395364 9:86176536-86176558 CTTCCACTGGGGAAGGCGGTGGG - Intergenic
1057258713 9:93571608-93571630 CCAGCACTCTGGAAGGCGGAGGG + Intergenic
1058045545 9:100353061-100353083 CCTGCTCTGTGGGAACCGGAGGG + Intergenic
1060054276 9:120400496-120400518 CCTCATGTGTAGAATGCGGACGG + Intronic
1060375989 9:123115426-123115448 CCTCCTCTGTGCAGGGAGAAAGG - Intronic
1060882589 9:127128676-127128698 CCTCCTCTCTTGAAGGCGCGTGG + Intronic
1061390215 9:130313485-130313507 CCTCGTCTGTGAAACGAGGAGGG + Intronic
1061690383 9:132323093-132323115 CCTCTTCTCTGGAAGCCTGAAGG + Intronic
1061937513 9:133866362-133866384 CCTGCTCTGCAGAAGGCGTAGGG - Intronic
1062213979 9:135379102-135379124 CCTCCTCGGGGGAAGGCAGAGGG + Intergenic
1062434607 9:136541394-136541416 CCTCCGCTGTAGAAGGGGCATGG - Intronic
1189428037 X:40920050-40920072 CCAGCTCTGTGGAAAGCAGAAGG + Intergenic
1189718997 X:43895708-43895730 CTCACTTTGTGGAAGGCGGAAGG - Intergenic
1190884614 X:54520606-54520628 CACCTTCTGTGTAAGGCGGAAGG + Intergenic
1190952873 X:55163051-55163073 CATTCTCTGAGGAAGGTGGAGGG + Intronic
1195332877 X:103820044-103820066 CCAGCTCTGTGGAAGGGGGAAGG - Intergenic
1196898913 X:120364185-120364207 CCTCCTCTGTGGAAGGTTAAAGG + Intronic