ID: 1144769680

View in Genome Browser
Species Human (GRCh38)
Location 17:17752615-17752637
Sequence GGATGAGGATTAGGGGGCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 188}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144769680_1144769697 17 Left 1144769680 17:17752615-17752637 CCAGCGCCCCCTAATCCTCATCC 0: 1
1: 0
2: 0
3: 18
4: 188
Right 1144769697 17:17752655-17752677 CACTGCAGACGTGTCCCCGGGGG 0: 1
1: 0
2: 0
3: 10
4: 107
1144769680_1144769690 -6 Left 1144769680 17:17752615-17752637 CCAGCGCCCCCTAATCCTCATCC 0: 1
1: 0
2: 0
3: 18
4: 188
Right 1144769690 17:17752632-17752654 TCATCCGGCCGTGGGTGGCCAGG 0: 1
1: 0
2: 0
3: 8
4: 72
1144769680_1144769696 16 Left 1144769680 17:17752615-17752637 CCAGCGCCCCCTAATCCTCATCC 0: 1
1: 0
2: 0
3: 18
4: 188
Right 1144769696 17:17752654-17752676 GCACTGCAGACGTGTCCCCGGGG 0: 1
1: 0
2: 0
3: 7
4: 100
1144769680_1144769694 14 Left 1144769680 17:17752615-17752637 CCAGCGCCCCCTAATCCTCATCC 0: 1
1: 0
2: 0
3: 18
4: 188
Right 1144769694 17:17752652-17752674 AGGCACTGCAGACGTGTCCCCGG 0: 1
1: 0
2: 0
3: 15
4: 149
1144769680_1144769695 15 Left 1144769680 17:17752615-17752637 CCAGCGCCCCCTAATCCTCATCC 0: 1
1: 0
2: 0
3: 18
4: 188
Right 1144769695 17:17752653-17752675 GGCACTGCAGACGTGTCCCCGGG 0: 1
1: 0
2: 0
3: 9
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144769680 Original CRISPR GGATGAGGATTAGGGGGCGC TGG (reversed) Intronic
900166036 1:1244747-1244769 GGATGAGGAGTGGGGGGAGGAGG - Intronic
900166067 1:1244836-1244858 GGATGAGGAGTGGGGGGAGGAGG - Intronic
900166143 1:1245032-1245054 GGATGAGGAGTGGGGGGAGGAGG - Intronic
900166164 1:1245074-1245096 GGATGAGGAGTAGGGGGAGGAGG - Intronic
900421879 1:2559296-2559318 GGCTGAGGATGTGGGGGCACAGG + Intronic
901241131 1:7694148-7694170 GGGTGAGGAGTAGGGGAAGCAGG - Intronic
901661298 1:10799461-10799483 GGAAGAGGATTTGGGGGCGGGGG + Intergenic
901678376 1:10899781-10899803 GGAGGAGGAAGAGGAGGCGCTGG + Intergenic
902385339 1:16072875-16072897 GGAGGAGGATTAGGGGGCAGGGG + Intronic
902637168 1:17742084-17742106 ACAGGAGGATTAGGGGGTGCAGG + Intergenic
903177971 1:21591775-21591797 GGATGAAGGTGGGGGGGCGCAGG - Intergenic
903857203 1:26344377-26344399 GGAGGAGGATGAGGTGGCCCTGG - Exonic
904038281 1:27570322-27570344 GGATGAGGGGTGGGGGGCGATGG - Intronic
904598207 1:31659781-31659803 GGCTGAGGTTGAGGGGGTGCAGG - Intronic
905274460 1:36807924-36807946 GGCTGAGGACTAGGAGGGGCTGG - Intronic
914747192 1:150509373-150509395 GGGAGAGGATTAGGGGACACGGG + Intronic
919170618 1:193949158-193949180 GCTTGAGAATCAGGGGGCGCTGG + Intergenic
920793300 1:209113376-209113398 GGATAAGGATCTGGGGGCGGAGG - Intergenic
921077612 1:211712501-211712523 GGATGGGGAATAGGGGAAGCAGG - Intergenic
922009063 1:221563271-221563293 GGATCAGGAATAGGGCGCCCTGG + Intergenic
922766531 1:228159108-228159130 GGAGGAGGGTTGGGGGGCTCCGG + Exonic
922766534 1:228159137-228159159 GGCTGAGGAGAAGGGGTCGCAGG - Exonic
924425607 1:243947245-243947267 GCATGAGCACTAGGGGGCACTGG - Intergenic
1062997689 10:1882161-1882183 GGATGAGGCATAGGGGGCTGTGG + Intergenic
1064850661 10:19705677-19705699 GGAGGAGGAATAGGTGGCGCAGG - Intronic
1065696105 10:28381155-28381177 GGATGAGCATGAGGGGACGTTGG - Intergenic
1069796784 10:71058518-71058540 GCAGGAGCATTAGGGGGAGCTGG + Intergenic
1072562272 10:96587028-96587050 GGAAGAGGCTGAGGAGGCGCGGG - Exonic
1074377827 10:112952852-112952874 GGATGAGGAGGAGGGGGTTCAGG - Intronic
1074891630 10:117741025-117741047 GGATGGGGAGGAGGGGGCTCCGG - Intergenic
1076618665 10:131772963-131772985 GGCTGGGAGTTAGGGGGCGCTGG - Intergenic
1077285709 11:1764295-1764317 GGAGGGGGACGAGGGGGCGCCGG - Intergenic
1077308544 11:1878463-1878485 GCAGGCGGATTCGGGGGCGCGGG + Intronic
1079091552 11:17484209-17484231 GGATTAGGATTCGGGGGTGGGGG - Intergenic
1079572724 11:21964712-21964734 GGAGGAGGATTAGGAGGAGGAGG - Intergenic
1083860502 11:65417720-65417742 GGAGGAGGTCTAGGGGCCGCTGG + Intergenic
1084569504 11:69950918-69950940 GGAGGAGGAGTAGGGGAAGCTGG + Intergenic
1088357670 11:108960548-108960570 GGATGAGGATGAGGAGGAGGAGG + Intergenic
1092432043 12:8417850-8417872 GGAAGAGGATCACGGGGCTCTGG - Intergenic
1093516545 12:19993609-19993631 GGATTAGGATTTGGGGGCCTTGG + Intergenic
1097065110 12:56315295-56315317 GGGTGAGGATTGGGGGGGTCAGG - Intronic
1097245361 12:57604938-57604960 GGAGGTGGAGGAGGGGGCGCCGG - Intronic
1104016549 12:124965713-124965735 GGATGAGGAAGAGGGGGCCCTGG - Exonic
1104841428 12:131827974-131827996 GGGTGGGGCTTGGGGGGCGCGGG - Intergenic
1105015379 12:132783498-132783520 GGCTGGGGAGTGGGGGGCGCCGG + Intronic
1105927071 13:25018254-25018276 GGAAGAGGAGAAGAGGGCGCGGG - Intergenic
1106032045 13:26012679-26012701 TGATGAGGAGTTGGGGGAGCGGG + Intronic
1107540182 13:41382156-41382178 GGATTAGGAGTAGGGGGTGGAGG - Intergenic
1108251318 13:48570760-48570782 GGATGAAGATGACGGGGCACTGG + Intergenic
1110762001 13:79241209-79241231 CCATGAGGATAAGGGGGCACAGG - Intergenic
1113992404 14:16037985-16038007 GGCTGAGGATTAGGGGGTGTGGG + Intergenic
1116701396 14:48247862-48247884 GGATGAGGATGAAGGGGTGAAGG - Intergenic
1117188359 14:53265905-53265927 AGATAAGGATTTGGGGGCGGGGG - Intergenic
1119320443 14:73727046-73727068 GGAAGAAGATGAGGGGGAGCCGG + Intronic
1119883037 14:78116650-78116672 GGATGAGGATAAGGAGGAGGAGG - Intergenic
1121589949 14:95096659-95096681 GGATGAGGATTACGAGGAGGAGG - Exonic
1122325831 14:100880206-100880228 GGATGGGGGTTGGGGGGCGGGGG + Intergenic
1122326085 14:100881407-100881429 GGATGAGTCGTAGGGAGCGCTGG + Exonic
1122895101 14:104752921-104752943 GGTTGAGGATCAGGGTGGGCGGG - Intergenic
1124416317 15:29475565-29475587 GGAGGAGGAGTAGGGGGCGAGGG + Intronic
1134062908 16:11209787-11209809 GGATGAGGTTCAGGGGACTCTGG - Intergenic
1135675215 16:24409251-24409273 GGCTGAGGACTCAGGGGCGCAGG + Intergenic
1137628833 16:49927843-49927865 GGAGGAGGAGTCGGGGGAGCTGG + Intergenic
1138146520 16:54617155-54617177 TGATGAGGATGAGGGGGCAATGG + Intergenic
1138649952 16:58454232-58454254 GGATTAGGATTTGGGGGGGGGGG + Intergenic
1140188576 16:72795601-72795623 GGATGAGGATGAGGAGGGGCAGG - Exonic
1141546996 16:84776789-84776811 GGATGAGGATTCAGGAGGGCAGG - Intronic
1141775690 16:86121523-86121545 GGATGATGATGAGGGGGAGGAGG - Intergenic
1142709489 17:1715628-1715650 GGGAGAGGAGTAGGGGGCGGCGG - Intergenic
1143585112 17:7847058-7847080 GGATGAGGAATAGAGAGCGTGGG - Intronic
1144057967 17:11558609-11558631 GGATGGGGAGAAGGAGGCGCGGG - Exonic
1144769680 17:17752615-17752637 GGATGAGGATTAGGGGGCGCTGG - Intronic
1146655863 17:34634817-34634839 GGATGAGGATGAGGAGGAGGAGG + Exonic
1147425359 17:40343583-40343605 GGATTAGGATTAGGGGGAGAGGG - Intronic
1147891537 17:43720830-43720852 GGCTGAGGATTTGGCGGCGGCGG - Intergenic
1148439884 17:47706436-47706458 AGCTGAGGATGAGGGGGCACAGG + Intronic
1148907230 17:50919268-50919290 GGATGAGGATTCAGAGGCCCAGG - Intergenic
1149304660 17:55335945-55335967 GGATGAAGATTTGAGGGCCCAGG + Intergenic
1149863882 17:60139731-60139753 GGATGAGGAGGAGGGGGCCGCGG - Intergenic
1151215426 17:72573824-72573846 GGAGGAGGATGAGAGGGCACTGG - Intergenic
1151478303 17:74355886-74355908 AGATGGGGACTAGGGGGAGCGGG - Intergenic
1151674394 17:75590106-75590128 GGATGAGGACGAGGCGGTGCTGG + Intergenic
1152291118 17:79440789-79440811 GGATGCTGATGAGGGGGTGCAGG - Intronic
1152392375 17:80010440-80010462 GGATGAGGAGAAGCTGGCGCAGG - Exonic
1152504259 17:80737265-80737287 CGATGGGAAGTAGGGGGCGCTGG + Intronic
1152593882 17:81228994-81229016 GGACGATGTTTGGGGGGCGCGGG + Exonic
1154294050 18:13134675-13134697 GGCTGAGGAGTGCGGGGCGCAGG - Intergenic
1157311480 18:46556625-46556647 GTATGAGGATGAGGGTGGGCTGG - Intronic
1157452037 18:47796076-47796098 GGATGAGGTTTGGTGGGCCCTGG - Intergenic
1159884619 18:73892082-73892104 GGAAGAGGGGTAGGGGGCGCTGG + Intergenic
1160696255 19:486038-486060 GGATGAGGATGGAGGGGAGCTGG - Intergenic
1160720704 19:595855-595877 GGGAGAGGATTAGGGGCCGGAGG - Intronic
1160918273 19:1507874-1507896 GGATGAGGAGAAAGGGGGGCTGG + Intronic
1161424895 19:4198179-4198201 GGATGAGGAGGACGCGGCGCCGG - Intronic
1161570244 19:5026615-5026637 GGAGGAGGATTCTGGGGCCCTGG + Intronic
1161804077 19:6432218-6432240 GGCTGAGGATGAGGGAGGGCCGG - Intronic
1161882693 19:6967843-6967865 GGAAGAGGAAGAGGGGGCGTTGG - Intergenic
1162141274 19:8586773-8586795 GGATGAGGATTAGGGGTCAGTGG - Intronic
1163085997 19:14979936-14979958 GGAGGCGGTTTAGGGGGCGGGGG - Intronic
1163184736 19:15629467-15629489 GGATGGCCAGTAGGGGGCGCTGG + Exonic
1163442433 19:17328704-17328726 GGAGGAGGAGGAGGCGGCGCTGG - Exonic
1163560618 19:18017249-18017271 GGATGAGGACTGGGGGACCCAGG + Intergenic
1164156755 19:22601912-22601934 GGATGAGGATGAGGAGGAGAAGG + Intergenic
1165064062 19:33218996-33219018 GGAACAGGATGAGGGGGCACGGG + Intronic
1166039276 19:40192034-40192056 GGAGGAGGAGGAGGGGGCGGTGG + Exonic
1166359896 19:42248709-42248731 GGCTCAGGCTTAGGGGGTGCAGG + Exonic
1167609594 19:50500808-50500830 GGAGGAGGAGCTGGGGGCGCTGG - Intergenic
1167744259 19:51341405-51341427 GGATTGGGACTAGGGGGAGCCGG + Exonic
927177960 2:20423515-20423537 GGTTGAGGAGTAGGTGGAGCAGG + Intergenic
927812475 2:26187677-26187699 AGAGGAGGAGGAGGGGGCGCAGG - Exonic
927981947 2:27380053-27380075 GGTTAAGGATTAGCGGCCGCTGG - Intronic
928304363 2:30154428-30154450 TGGTGAGGGTTAGGGGGTGCAGG + Intronic
928481891 2:31691887-31691909 GTATAAGGATTAGGGGCCACTGG + Intergenic
931265118 2:60653737-60653759 GGAGGAGGGTTGGGGGGCGGTGG - Intergenic
935743831 2:106174079-106174101 GGAAGAGGATTGGGGGGGGCGGG + Intronic
935960074 2:108417066-108417088 GGATGGGGATAAGGAGGAGCAGG + Intergenic
937918824 2:127115609-127115631 CGATGAGGATTAGGGGTACCAGG + Intergenic
938261120 2:129895770-129895792 GGATGAGGATATGGAGGCTCAGG - Intergenic
940885290 2:158984669-158984691 GGAGGAGGAGTAGGGGGAGGAGG + Intronic
948869903 2:240792533-240792555 GGGTGAGGAGTGGGGGGAGCTGG + Intronic
1168934118 20:1648143-1648165 GGATGAGGATTCTGGGCCTCTGG + Intronic
1169197918 20:3693291-3693313 GCATTAAGAGTAGGGGGCGCTGG - Intronic
1170732138 20:18984837-18984859 GGCTGAGGATCAGGAGGGGCAGG + Intergenic
1173488560 20:43458868-43458890 GGAGGTGGGGTAGGGGGCGCGGG + Intronic
1174565973 20:51464672-51464694 GGATGAGGAGTGGGGTGGGCAGG + Intronic
1175429280 20:58890998-58891020 GGAGGAGGCCTCGGGGGCGCCGG + Intronic
1175700024 20:61130313-61130335 GGGTGAGGATTCTGGGGCTCAGG - Intergenic
1176546150 21:8201101-8201123 GGCTGAGGATTAGGGAGTGTGGG + Intergenic
1176565101 21:8384147-8384169 GGCTGAGGATTAGGGAGTGTGGG + Intergenic
1178334569 21:31731912-31731934 GGATGAGGAAAAGGAGGCGGCGG + Exonic
1178706438 21:34877435-34877457 AGATGAGGGTTAGGGAGCTCTGG - Intronic
1180075483 21:45459494-45459516 GGACGAGGTGGAGGGGGCGCTGG - Intronic
1180314867 22:11269532-11269554 GGCTGAGGATTAGGGGGTGTGGG - Intergenic
1181368297 22:22397036-22397058 GGGTGAGGAGGAGGGGGTGCAGG - Intergenic
1183667549 22:39254296-39254318 GGGTGAGGATGCAGGGGCGCTGG - Intergenic
1183948269 22:41338917-41338939 GGATGAGCATCACGGGGCCCGGG + Intronic
1203251022 22_KI270733v1_random:117338-117360 GGCTGAGGATTAGGGAGTGTGGG + Intergenic
949999776 3:9647975-9647997 GGAGGAGGGTTCCGGGGCGCTGG + Intergenic
951439325 3:22705079-22705101 GAATCAGGCTTAGGGGGCGGCGG + Intergenic
952901891 3:38116377-38116399 GTATGAGGAGGAGGGGGCCCCGG + Intronic
954133101 3:48569967-48569989 GGAGGAGGATCAGGGGGAGGAGG + Intronic
961094725 3:124144556-124144578 GGATGAGGAATAGGAGGAGGAGG - Intronic
961666993 3:128498743-128498765 GAATGAGGACTAGAGGGGGCTGG + Intergenic
964630236 3:158802158-158802180 GGAGGAGGATGAGGAAGCGCGGG + Exonic
965322857 3:167269102-167269124 TGAGGAGGAGTAGGGGGCTCAGG + Intronic
967872870 3:194246530-194246552 GGAATAGGCTTAGGGGGCTCTGG + Intergenic
968840542 4:3001992-3002014 GGATGAGGGTTAAGGAGAGCAGG + Intronic
968956958 4:3724307-3724329 GGATGAGGAAGAGGGAGGGCCGG + Intergenic
974019227 4:56678203-56678225 GGATGAGGCTTGGGAGGCTCAGG - Intronic
975701978 4:77075629-77075651 GGAAGCGGATCGGGGGGCGCGGG + Exonic
976390131 4:84498073-84498095 GGACGAGGAGGAGGGGGGGCCGG + Exonic
981605499 4:146536108-146536130 GGATGAGGGTTGGGGGAGGCAGG + Intergenic
985768704 5:1795804-1795826 GGATGAGGACTGGGGGGGGGGGG - Intergenic
985905664 5:2833889-2833911 GGACGAGGATGAGGGGGATCGGG - Intergenic
987570163 5:19646891-19646913 GGATGAGGATAAGGTGGAGAAGG + Intronic
988927482 5:36004246-36004268 GGTGGGGGATTGGGGGGCGCCGG - Intergenic
995692096 5:114838677-114838699 GTAGGAGGATTAGGGGGAGGTGG + Intergenic
1003702707 6:8487348-8487370 GGATGAGGAAAAGGGGGAGTAGG + Intergenic
1004455139 6:15785153-15785175 AGATGAGGAAAAGGGGGCTCAGG + Intergenic
1006752521 6:36387616-36387638 GGAGGAGGACTGCGGGGCGCGGG - Exonic
1007292928 6:40800748-40800770 GGATGAGCATTTGGGGACGGTGG + Intergenic
1011843166 6:91527515-91527537 GGATGGGGGTTAGGGGGCTAGGG - Intergenic
1013482425 6:110563956-110563978 GGATAAGGATTATGGGGCTCTGG - Intergenic
1014755964 6:125302082-125302104 GGAGGAGGAAGAGGGGGAGCAGG - Intergenic
1016880302 6:148904996-148905018 GGATGAGGACTAGGAGGAGTAGG - Intronic
1025212757 7:57030161-57030183 GGATGAGGGCTAGTGGGAGCTGG - Intergenic
1025659196 7:63546663-63546685 GGATGAGGGCTAGTGGGAGCTGG + Intergenic
1026600568 7:71774176-71774198 ATGTGAGGATTAGGGGGCACTGG - Intergenic
1027226728 7:76248310-76248332 GGATGAGGGAGAGGGGGTGCAGG + Intronic
1029221843 7:98996070-98996092 ACATGAGGATGAGGGGACGCAGG - Intronic
1029493058 7:100882716-100882738 GGATGAGGAGGAGGAGGAGCAGG - Intronic
1030265463 7:107616297-107616319 GGATGAGGGTTATGGAGCCCAGG - Intronic
1030668532 7:112308595-112308617 GGATGAGGATTAGTGGACTCTGG + Intronic
1033894737 7:146056115-146056137 TGATGAGGATTAGAGGGATCAGG - Intergenic
1034918555 7:155060429-155060451 TGTTGAGGATTAGTGGGCCCAGG - Intergenic
1035563381 8:625439-625461 GGAAGAAGATTAGGGGTTGCTGG + Intronic
1036620457 8:10421776-10421798 GGATGAGGCCTAGGGGGCTGGGG + Intronic
1037306603 8:17511095-17511117 GGTTGAGGAGTTGGGGGCGAGGG + Intronic
1038963707 8:32548865-32548887 GGAGGAGGAGTAGGAGGAGCAGG - Intronic
1039542321 8:38382293-38382315 GGCTGAGGATTTGGCGGCGGCGG - Intergenic
1040807480 8:51409514-51409536 CGATGAGGCTGAGGGAGCGCGGG + Exonic
1041779202 8:61558898-61558920 GGAGGAGGATGAGGGGGAGTTGG - Intronic
1042787312 8:72563200-72563222 GGATGATGATTAGAGGGCATAGG + Intronic
1044996146 8:97839909-97839931 GGATGTGGAGTAGGGGAGGCAGG + Intronic
1049726314 8:144148092-144148114 GGATGAGCCTTCGGCGGCGCTGG + Intronic
1050259620 9:3827844-3827866 GGGTGAGGATTAGGTGAGGCAGG + Exonic
1051513824 9:17907306-17907328 GGCTGAGGCTTGGGCGGCGCCGG + Intergenic
1053281081 9:36820136-36820158 AGATCAGGAGTAGGGGGCGGGGG - Intergenic
1053593436 9:39534828-39534850 GGGTGAGGATTTCGGGGCCCTGG - Intergenic
1053851170 9:42289536-42289558 GGGTGAGGATTTCGGGGCCCTGG - Intergenic
1054572870 9:66830449-66830471 GGGTGAGGATTTCGGGGCCCTGG + Intergenic
1056378324 9:86035502-86035524 GGAAGAGGCTTCGGGGGAGCCGG - Exonic
1056909383 9:90684407-90684429 GGATGAGGCTTATGGGGCAGGGG - Intergenic
1057083269 9:92188439-92188461 GGACGAGGGTTAGGGGGCTGGGG - Intergenic
1057141613 9:92729835-92729857 GGGTGAGGAACAAGGGGCGCGGG + Intronic
1062006662 9:134241847-134241869 GGATGAGGATGAGGGGTGGCAGG + Intergenic
1062408298 9:136408627-136408649 GGAAGAGGGTCAGGGGGCACTGG - Intronic
1203467423 Un_GL000220v1:100603-100625 GGCTGAGGATTAGGGAGTGTGGG + Intergenic
1203363175 Un_KI270442v1:235545-235567 GGCTGAGGATTAGGGGGTGTGGG - Intergenic
1186380845 X:9057196-9057218 GGAAGAGGATTGGGTGGAGCTGG - Intronic
1186405220 X:9295923-9295945 GGAGGAGGAAGAGGAGGCGCTGG - Intergenic
1190246943 X:48696931-48696953 GGATGAGGCTCGGGGAGCGCGGG + Intronic
1190329393 X:49226428-49226450 GGATGAGGAGGAGGGGGCTCTGG - Exonic
1190713051 X:53083017-53083039 GGATGAGGATGAGGATGAGCGGG + Exonic
1198761907 X:140040999-140041021 GGATGGGGAAGAGGTGGCGCTGG + Intergenic
1199502811 X:148527744-148527766 GAATGAGGATGAGGTGGCGGGGG - Intronic
1199992152 X:152993364-152993386 GGGTGGGGATTGGGGGGAGCAGG - Intronic