ID: 1144771054

View in Genome Browser
Species Human (GRCh38)
Location 17:17759862-17759884
Sequence TCAAGATTACAGCATCCTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 96}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144771054_1144771063 30 Left 1144771054 17:17759862-17759884 CCACTAGGATGCTGTAATCTTGA 0: 1
1: 0
2: 1
3: 2
4: 96
Right 1144771063 17:17759915-17759937 TTTGTGCTTATTAAGGGCTCTGG 0: 1
1: 0
2: 1
3: 16
4: 155
1144771054_1144771061 23 Left 1144771054 17:17759862-17759884 CCACTAGGATGCTGTAATCTTGA 0: 1
1: 0
2: 1
3: 2
4: 96
Right 1144771061 17:17759908-17759930 GGTAAGATTTGTGCTTATTAAGG 0: 1
1: 0
2: 1
3: 20
4: 240
1144771054_1144771062 24 Left 1144771054 17:17759862-17759884 CCACTAGGATGCTGTAATCTTGA 0: 1
1: 0
2: 1
3: 2
4: 96
Right 1144771062 17:17759909-17759931 GTAAGATTTGTGCTTATTAAGGG 0: 1
1: 0
2: 3
3: 16
4: 236
1144771054_1144771060 2 Left 1144771054 17:17759862-17759884 CCACTAGGATGCTGTAATCTTGA 0: 1
1: 0
2: 1
3: 2
4: 96
Right 1144771060 17:17759887-17759909 TGGGGCTAAATTGAGTCTTGGGG 0: 1
1: 0
2: 1
3: 6
4: 147
1144771054_1144771058 0 Left 1144771054 17:17759862-17759884 CCACTAGGATGCTGTAATCTTGA 0: 1
1: 0
2: 1
3: 2
4: 96
Right 1144771058 17:17759885-17759907 TCTGGGGCTAAATTGAGTCTTGG 0: 1
1: 0
2: 1
3: 6
4: 114
1144771054_1144771059 1 Left 1144771054 17:17759862-17759884 CCACTAGGATGCTGTAATCTTGA 0: 1
1: 0
2: 1
3: 2
4: 96
Right 1144771059 17:17759886-17759908 CTGGGGCTAAATTGAGTCTTGGG 0: 1
1: 0
2: 0
3: 4
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144771054 Original CRISPR TCAAGATTACAGCATCCTAG TGG (reversed) Intronic
902649517 1:17827406-17827428 TCAAGCTTACAGCCTCCTGTGGG + Intergenic
908187663 1:61668182-61668204 TCAAGATCACAGCTACCAAGTGG + Intergenic
909458627 1:75881040-75881062 TCAAGATCACAGCTACTTAGTGG - Intronic
911563055 1:99430099-99430121 TCATGATTACAGCATAGCAGAGG + Intergenic
916322705 1:163522557-163522579 CCTACATTACAGCATCCTGGAGG - Intergenic
919137662 1:193531066-193531088 TCAAGCTAACAGCATCCTGGTGG - Intergenic
920215985 1:204361850-204361872 AAGAGATTACAGCATCCCAGAGG + Intronic
924444127 1:244112776-244112798 TAATGGTTACAGAATCCTAGAGG - Intergenic
1063036100 10:2288421-2288443 TCAAGAAGAGATCATCCTAGAGG + Intergenic
1064825466 10:19394010-19394032 TCAAGATTACTGCATGCTTTAGG + Intronic
1066412019 10:35180997-35181019 TTACGATGACAGCATCTTAGTGG - Intronic
1070299364 10:75191900-75191922 GCAGGAATACTGCATCCTAGTGG + Intergenic
1071121871 10:82287765-82287787 TCAAGAAAACAGAATCCCAGTGG - Intronic
1071625603 10:87165347-87165369 CCAAGATACCAGCATACTAGAGG + Intronic
1075208295 10:120466129-120466151 TGGAGATTACAGCATCATACAGG - Intronic
1088277354 11:108101839-108101861 TGAAGATTACAGGAACCCAGAGG - Intronic
1088971314 11:114776674-114776696 TCAAGATGACATCACCTTAGGGG + Intergenic
1093642796 12:21546954-21546976 TCTAGATTAAATCATGCTAGAGG + Intronic
1094279297 12:28717614-28717636 TCAACATTCCACCATCCTAATGG + Intergenic
1096796428 12:54080797-54080819 TCAGGATCACAGCATCTGAGGGG - Intergenic
1098904263 12:76145664-76145686 TCAAGTTTTCAGCATTCTTGGGG + Intergenic
1099766541 12:86994712-86994734 TCAAGATTAATGCATCCAAAGGG + Intergenic
1100034615 12:90235692-90235714 TCTATATTACAGCATGCTTGGGG - Intergenic
1100851809 12:98719672-98719694 TCAAGAAAACAGAATCCTAAAGG - Intronic
1104650140 12:130525435-130525457 TCATGCTTAGAGCCTCCTAGGGG + Intronic
1108548380 13:51519177-51519199 TTAAGATTAGAGCATCTTAGAGG + Intergenic
1118434933 14:65762170-65762192 TGAATATGACAGCTTCCTAGAGG - Intergenic
1127861185 15:62995441-62995463 TCATGTTCACAGCATCCCAGGGG - Intergenic
1129914640 15:79258192-79258214 TCCAGATTACAGCATCTTGAAGG + Intergenic
1131455892 15:92582297-92582319 ACAAGATTAGAGCCTCGTAGAGG + Intergenic
1131738623 15:95361950-95361972 ACAAGATTATAACATTCTAGGGG - Intergenic
1135700878 16:24631469-24631491 TAAATATTAGAACATCCTAGGGG + Intergenic
1135936862 16:26787946-26787968 AAGGGATTACAGCATCCTAGAGG - Intergenic
1143877331 17:10002001-10002023 ACCTGTTTACAGCATCCTAGCGG + Intronic
1144771054 17:17759862-17759884 TCAAGATTACAGCATCCTAGTGG - Intronic
1148370417 17:47095515-47095537 TTTTGATTATAGCATCCTAGTGG - Intergenic
1149080051 17:52644738-52644760 TAAAGATTTCAACATCCTAATGG - Intergenic
1149156028 17:53630823-53630845 GCAAGATTACTGCCTTCTAGGGG + Intergenic
1151049786 17:70964457-70964479 TCAACACTACAGCATCCTAGGGG - Intergenic
1153979314 18:10295757-10295779 GTAAGACTACTGCATCCTAGAGG - Intergenic
1160169524 18:76541374-76541396 CCAAGATAACAGCGTCCCAGAGG - Intergenic
1166198564 19:41221796-41221818 CAAAGCCTACAGCATCCTAGTGG + Intronic
930161718 2:48165309-48165331 TCATGATCACAGAATTCTAGTGG + Intergenic
932068931 2:68596339-68596361 TCAAGAATACAGCTGCCTATGGG + Intronic
933526236 2:83443551-83443573 CAAAGATTACAGAATACTAGAGG + Intergenic
933892325 2:86783293-86783315 CCAAGTTTACAGCATAATAGAGG + Intergenic
1171847896 20:30288829-30288851 TCAGGATCACAGCATCTGAGGGG - Intergenic
1175056873 20:56206614-56206636 TGAAGATGACAGCATCCCTGTGG + Intergenic
1175534775 20:59701813-59701835 TCACCATTACAGTATCATAGAGG + Intronic
1176954715 21:15087957-15087979 ACAAAATCACAGCATCTTAGAGG - Intergenic
1178825224 21:36009746-36009768 TGAATATTTCAGCATCCTTGAGG - Intergenic
1182434787 22:30323577-30323599 TTAAGATCACAGCATATTAGTGG - Intronic
949296320 3:2528215-2528237 TCAAGACTACAACATCCATGGGG - Intronic
951659771 3:25049615-25049637 TAAAAATTAAAGCATCCTATTGG + Intergenic
953586211 3:44203292-44203314 TCAGGCTTTCAGCATCTTAGGGG + Intergenic
955191816 3:56768766-56768788 TCACCATTACAGCCTCCTGGGGG - Intronic
958628840 3:96662080-96662102 TTTAGATTACAGAATTCTAGTGG - Intergenic
961262656 3:125615123-125615145 TAACCATCACAGCATCCTAGAGG - Intergenic
965014500 3:163139912-163139934 GCAAGATTCCACCAGCCTAGTGG + Intergenic
966586433 3:181631308-181631330 TCAACATTACAGCTTTCAAGAGG - Intergenic
973662837 4:53125747-53125769 TCTAAGTTACAGCATCCTATTGG - Intronic
973804517 4:54512921-54512943 TGAAGATTATAGTTTCCTAGGGG + Intergenic
976534760 4:86198355-86198377 TGAACATTACATCATCCTATGGG + Intronic
980026983 4:127779601-127779623 TCAAGATTATCGCCTCATAGAGG - Intergenic
980307435 4:131080906-131080928 TCAATATTAAAGCATCTTCGGGG - Intergenic
982559671 4:156914599-156914621 TAAAGATTAGAGTAACCTAGTGG - Intronic
983076969 4:163338141-163338163 TCTACATAACAGGATCCTAGGGG - Intronic
993265709 5:85723542-85723564 TCTTGATTACAGCATACCAGTGG - Intergenic
995652610 5:114386939-114386961 ACAAAAGTACAGCATCCTAAAGG - Intronic
1001232421 5:170000204-170000226 TCAAGATTCCAAGATCCTTGAGG - Intronic
1001527801 5:172441097-172441119 TCAACCTAACAGCATCCCAGGGG + Intronic
1001595122 5:172893470-172893492 TCATCATTACAGCATCCAATGGG + Intronic
1006744172 6:36330028-36330050 GCAAGTTTAGAGCACCCTAGGGG + Intronic
1009960984 6:70521066-70521088 TGAAGATAATATCATCCTAGAGG + Intronic
1010483873 6:76385927-76385949 TCAAGATTAGAGGATGGTAGAGG + Intergenic
1015976279 6:138794656-138794678 TAAAAATTACAGCATCATGGAGG + Intergenic
1021674472 7:23066150-23066172 TCAAGATGACTGCATTCTGGAGG + Intergenic
1024879153 7:54066283-54066305 TCAATCTTTCAGCATCCAAGTGG - Intergenic
1029318011 7:99732138-99732160 TCAAGAGGACAGCACCCAAGGGG - Intronic
1031961231 7:127991766-127991788 ACAAGATTATAGGGTCCTAGAGG + Intronic
1034725686 7:153333179-153333201 TCTAGCTTACAGAATTCTAGTGG + Intergenic
1035110732 7:156479330-156479352 TTTTGATTATAGCATCCTAGTGG - Intergenic
1043298509 8:78697464-78697486 TCACGATTACCGCAGCCAAGTGG + Exonic
1045243526 8:100422922-100422944 TCAAGGTAACAGTGTCCTAGGGG + Intergenic
1045384752 8:101661262-101661284 TCAAGTTTACAGCATGCCACTGG + Intronic
1046385890 8:113509002-113509024 ACAAAATTACAGCTGCCTAGGGG - Intergenic
1046746239 8:117879103-117879125 TCAAGAATATATCATCCTACAGG + Intronic
1046752545 8:117940848-117940870 GCAAGATCCCAGCAGCCTAGGGG - Intronic
1053786031 9:41653479-41653501 TCAGGATCACAGCATCTGAGGGG - Intergenic
1054159019 9:61660717-61660739 TCAGGATCACAGCATCTGAGGGG + Intronic
1054174747 9:61867412-61867434 TCAGGATCACAGCATCTGAGGGG - Intergenic
1054449602 9:65396472-65396494 TCAGGATCACAGCATCTGAGGGG - Intergenic
1054478793 9:65591722-65591744 TCAGGATCACAGCATCTGAGGGG + Intergenic
1054662791 9:67713381-67713403 TCAGGATCACAGCATCTGAGGGG + Intergenic
1060499900 9:124145210-124145232 TCAAGCTTCCATCATCCTCGGGG - Intergenic
1185918454 X:4062726-4062748 TCAAGATGAGATCATCCTGGAGG + Intergenic
1186452655 X:9686338-9686360 TCCAGATTCCAGCACTCTAGGGG + Intronic
1188162914 X:26824019-26824041 TAAAGCCTACAGCATCCTATTGG - Intergenic
1193074882 X:77345287-77345309 TCACCTTCACAGCATCCTAGGGG + Intergenic
1196076521 X:111583715-111583737 GCAAGATTATAGAATCCTTGGGG - Intergenic