ID: 1144771165

View in Genome Browser
Species Human (GRCh38)
Location 17:17760442-17760464
Sequence CAGCCCAGTGTCCCTGGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 452
Summary {0: 1, 1: 0, 2: 4, 3: 57, 4: 390}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144771162_1144771165 -9 Left 1144771162 17:17760428-17760450 CCAGAAGTTTGGCTCAGCCCAGT 0: 1
1: 0
2: 0
3: 10
4: 159
Right 1144771165 17:17760442-17760464 CAGCCCAGTGTCCCTGGCCTGGG 0: 1
1: 0
2: 4
3: 57
4: 390
1144771159_1144771165 2 Left 1144771159 17:17760417-17760439 CCAGACTGTACCCAGAAGTTTGG 0: 1
1: 0
2: 0
3: 11
4: 90
Right 1144771165 17:17760442-17760464 CAGCCCAGTGTCCCTGGCCTGGG 0: 1
1: 0
2: 4
3: 57
4: 390
1144771158_1144771165 3 Left 1144771158 17:17760416-17760438 CCCAGACTGTACCCAGAAGTTTG 0: 1
1: 0
2: 1
3: 9
4: 163
Right 1144771165 17:17760442-17760464 CAGCCCAGTGTCCCTGGCCTGGG 0: 1
1: 0
2: 4
3: 57
4: 390
1144771161_1144771165 -8 Left 1144771161 17:17760427-17760449 CCCAGAAGTTTGGCTCAGCCCAG 0: 1
1: 0
2: 0
3: 12
4: 234
Right 1144771165 17:17760442-17760464 CAGCCCAGTGTCCCTGGCCTGGG 0: 1
1: 0
2: 4
3: 57
4: 390

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144771165 Original CRISPR CAGCCCAGTGTCCCTGGCCT GGG Intronic
900108984 1:997815-997837 CAGGCCAGTGACCCTGGGCGGGG - Intergenic
900179511 1:1305073-1305095 CTGACCGGTGTCCCAGGCCTCGG + Intronic
900299533 1:1969873-1969895 CATCCCAGTCTCCCTGTCCACGG - Intronic
900503603 1:3018410-3018432 CAGCACAGTGGCCCTGGGCCAGG - Intergenic
900505027 1:3025615-3025637 CAGCCCAGAGTCCCAGACCATGG + Intergenic
900654229 1:3747154-3747176 CCGCCGAGAGTCCCCGGCCTTGG - Intergenic
900699042 1:4032654-4032676 CAGCCCATGGCCCCTGGCCCAGG - Intergenic
901277456 1:8003341-8003363 CAGCACAGTGTACCTTGTCTTGG + Intergenic
901494675 1:9614125-9614147 CAGGCCCGTGTCCCAGGCCCAGG - Exonic
902243565 1:15104093-15104115 CAGGGCAGTGGCCATGGCCTCGG - Exonic
902634122 1:17724067-17724089 CAGCCCACTGGCCTTGACCTTGG + Intergenic
902801529 1:18833003-18833025 CTTCCCAGTCTCCCTGCCCTGGG + Intergenic
902822607 1:18952343-18952365 CAAACCAGAGCCCCTGGCCTGGG - Intronic
903350359 1:22713048-22713070 CAGCCCTGTGTCCAGGGCCAGGG - Intronic
903548439 1:24141525-24141547 TAGCCCAGGGTCCTTTGCCTTGG - Intronic
904293742 1:29504520-29504542 CACCCCAGTGTCCCGGGATTTGG + Intergenic
904678780 1:32214775-32214797 AAGCCCAGTGTCCCTTCTCTAGG + Exonic
904813556 1:33179742-33179764 CAGCCCCATGTACCTGGCTTTGG - Intronic
905173769 1:36124364-36124386 CCTCCCAGTGTCTCTGCCCTGGG - Intronic
905796211 1:40818072-40818094 CAGCCAAGAGTCCCTGGGTTAGG - Intronic
905825582 1:41023791-41023813 CAGCCTAGTGTCTGTGCCCTGGG + Intergenic
905972543 1:42153017-42153039 CAGCCAGGTGTCCTTGGCCCAGG - Intergenic
906129461 1:43447486-43447508 CAGACCAGTGTGTCTGTCCTAGG + Intronic
906154031 1:43603641-43603663 CAGCGCAGTGTTCATGGCCGTGG - Exonic
909057917 1:70844936-70844958 CAGCACAGGGACCCTGGGCTTGG - Intergenic
912421077 1:109542948-109542970 CATCCCAGGGTCGCTGGACTAGG + Exonic
912541606 1:110420434-110420456 CCGCCAAGTGTCCCTGGCTGAGG - Intergenic
913591909 1:120337461-120337483 GAGCCCAGTGGGCCTGGCCATGG - Intergenic
913651447 1:120917685-120917707 GAGCCCAGTGGGCCTGGCCATGG + Intergenic
914169662 1:145211386-145211408 GAGCCCAGTGGGCCTGGCCATGG - Intergenic
914524776 1:148455348-148455370 GAGCCCAGTGGGCCTGGCCATGG - Intergenic
914598899 1:149180485-149180507 GAGCCCAGTGGGCCTGGCCATGG + Intergenic
914641625 1:149611786-149611808 GAGCCCAGTGGGCCTGGCCATGG + Intergenic
914827377 1:151145723-151145745 TGGCCCTGTTTCCCTGGCCTGGG - Intronic
915903388 1:159862010-159862032 CTGCCCCTTGGCCCTGGCCTTGG + Intronic
917451686 1:175152464-175152486 CAGCCCAGTGCGCCGGGTCTGGG - Intergenic
918914423 1:190616364-190616386 CAGCACAGGGACCCTGGGCTTGG + Intergenic
920581222 1:207109625-207109647 CAGCTCTGTGGCCATGGCCTAGG + Intronic
920921669 1:210302628-210302650 CAGCTCAGTTTCCCAGGACTTGG + Intergenic
922672575 1:227522271-227522293 GAGCCCAGTCACCATGGCCTTGG - Intergenic
922865926 1:228861614-228861636 CTGCACAGGGTCCCTGTCCTGGG - Intergenic
923460309 1:234204461-234204483 CAGCCCAGAGTCCTTGGCAGGGG - Intronic
924380382 1:243458216-243458238 GAGGCCAGGGTCCCTGGCCAGGG - Intronic
1062992381 10:1832605-1832627 CACCACAGTGTCCCTGCCCCAGG - Intergenic
1063148680 10:3318538-3318560 CGGCCCAGTCTCCCGGGCCACGG + Intergenic
1063455950 10:6182808-6182830 CAGTCCAGTGTCCATGGCCAGGG + Intronic
1065293195 10:24251448-24251470 CAGATCAGAGGCCCTGGCCTGGG + Intronic
1066269814 10:33811171-33811193 CAGCTCAGTGCCCCTGACCTTGG + Intergenic
1067090724 10:43264754-43264776 CAGCCCAGCGCCCCTCCCCTGGG + Intronic
1067372587 10:45699261-45699283 CAGCCCGGTGTCCATGTCCTTGG - Intergenic
1067387190 10:45826863-45826885 CAGCCCGGTGTCCATGTCCTTGG + Exonic
1067418938 10:46130388-46130410 CAGCCCGGTGTCCATGTCCTTGG - Intergenic
1067447086 10:46357744-46357766 CAGCCCGGTGTCCATGTCCTTGG - Intergenic
1067504290 10:46836977-46836999 CAGCCCGATGTCCATGTCCTTGG - Intergenic
1067552156 10:47243740-47243762 CTGCACAGAGTCCCTGGCTTTGG - Intergenic
1067590297 10:47503016-47503038 CAGCCCGGTGTCCATGTCCTTGG + Exonic
1067637417 10:48011118-48011140 CAGCCCGGTGTCCATGTCCTTGG + Intergenic
1067808071 10:49407014-49407036 CAGACCTCTGTCCCTGGCCTGGG - Intergenic
1067876072 10:50009216-50009238 CAGCCCGGTGTCCATGTCCTTGG - Exonic
1068218237 10:54010569-54010591 CTGCCCAGTGCCTCTGGACTTGG + Intronic
1069422584 10:68260540-68260562 CAGCCCATTGGACCTGGCCAGGG - Intergenic
1069697580 10:70398304-70398326 TGGTCCAGTGTCCCTGACCTAGG - Intergenic
1069805165 10:71117816-71117838 CAGCACAGAGACCCTGGGCTTGG - Intergenic
1070134014 10:73675547-73675569 CAGCCCGGTGTCCATGTCCTTGG + Exonic
1071566212 10:86672704-86672726 CAGCCCGGAGGACCTGGCCTGGG - Intronic
1071569885 10:86691033-86691055 CAGCCCACTCACCCTGGCCGGGG - Intronic
1073248536 10:102107906-102107928 CCCCCCAGTGGCCCTGGGCTGGG - Exonic
1073350582 10:102816875-102816897 CAGGCCAGCCACCCTGGCCTGGG + Intergenic
1074112242 10:110430914-110430936 CAGCCCTGTTACCCTAGCCTTGG - Intergenic
1075906113 10:126083392-126083414 CTGCCCAGAGGCCCTGCCCTGGG - Intronic
1076433856 10:130426205-130426227 CAGGCCAGTGTCCCCGTCCTGGG - Intergenic
1076677363 10:132154015-132154037 CAGCCCAGTGCCCCTCCCCGGGG - Intronic
1076686401 10:132200211-132200233 CAGTCTAGAGTCCCTGGCCCTGG - Intronic
1077305308 11:1866322-1866344 CAGCACTGAGTGCCTGGCCTGGG - Intronic
1077921026 11:6641716-6641738 CAGCTCAGGCTCCCTGACCTGGG + Exonic
1078733529 11:13998686-13998708 CTGGCCAGTGTGCCAGGCCTTGG - Intronic
1079348596 11:19674077-19674099 CAGCCAAGTGCCTCTGGCCTGGG + Intronic
1080937616 11:36880882-36880904 CAGCTCAGTGACCATGGGCTGGG - Intergenic
1081521189 11:43882676-43882698 CAGCCCAGGCTCCCTGAACTCGG - Exonic
1081545912 11:44071402-44071424 TGGCTCAGTGGCCCTGGCCTGGG + Intronic
1081583839 11:44370790-44370812 CAGCCCAGTGTCCTTAGCCATGG + Intergenic
1081673204 11:44953193-44953215 CAGGACAGTGTCCCTGTCCTTGG + Intergenic
1081993960 11:47352009-47352031 CAGCCCAGGGACCTGGGCCTGGG - Intronic
1083158103 11:60837988-60838010 CAGCCCCATGTCCCAGTCCTAGG + Intergenic
1083347398 11:62003205-62003227 CAGCCCACTGTCCCTGTCCCTGG + Intergenic
1083673173 11:64311231-64311253 CTGGCCAGTGTTCCAGGCCTTGG + Intronic
1083725892 11:64627885-64627907 CTGCCCAGAGACCCGGGCCTGGG + Intronic
1083859831 11:65414152-65414174 CAAGCCACTGTGCCTGGCCTGGG - Intergenic
1084667263 11:70583099-70583121 CAGCCCAGTGCCCCTGCCCCAGG - Intronic
1085651736 11:78274380-78274402 CAATCCAGTGTCCCTGTCCCTGG - Intronic
1085768644 11:79306072-79306094 CAGCCCAGTCACCCTGTCCGTGG - Intronic
1087496318 11:98894422-98894444 CAGCACAGGGACCCTGGCCCTGG + Intergenic
1089213243 11:116820313-116820335 CAGAACAGGGTCCCTGGCCCTGG - Intergenic
1089951769 11:122534727-122534749 CAGTCCAGAGGCCCTGGCCCTGG + Intergenic
1090412279 11:126517545-126517567 CAGCCCTGGGGTCCTGGCCTTGG - Intronic
1090418468 11:126557141-126557163 CAGGCCAGGGTCCTTGGCCTGGG - Intronic
1090751364 11:129749039-129749061 CAGCCCAGGCTCTCTGACCTGGG - Intergenic
1094214463 12:27925690-27925712 CAGCCACCTGTACCTGGCCTGGG + Intergenic
1095226802 12:39686941-39686963 CAGCACTGTGCCCCTGCCCTAGG - Intronic
1096113366 12:49041426-49041448 CTGCCCAGTGCCCCTGGCTGCGG + Exonic
1096497025 12:52044467-52044489 CGGGCCAGAGTCCCTGGCCCAGG - Intronic
1096529590 12:52234372-52234394 CAGCCCTGAGTTCCTGGCTTTGG - Intronic
1100181387 12:92090311-92090333 CACCCCAGTTTTGCTGGCCTCGG - Intronic
1100444619 12:94649911-94649933 CCGCCCTGTCTCCCTGTCCTCGG - Intronic
1102261590 12:111446499-111446521 CAGCCCATTGGACCTGGACTTGG - Intronic
1102442224 12:112972063-112972085 CAGCAGAGTGGCCCTGGCCTGGG + Exonic
1102720637 12:115013294-115013316 GAGCCCAGAGACCCTGGGCTGGG - Intergenic
1102733712 12:115138371-115138393 CAGCCTGGTGTCCCAGCCCTGGG - Intergenic
1103274475 12:119700205-119700227 CAGCCCACAGTCCCAGCCCTGGG - Intronic
1106224146 13:27772568-27772590 CAGCCCAGTCACCATGGCCAAGG - Intergenic
1106454205 13:29912260-29912282 CAGCACAGTGTCCTTGTCATGGG - Intergenic
1107369532 13:39729178-39729200 CAGACCAGGGTCCCTGGCCCGGG - Intronic
1109277340 13:60317367-60317389 CATCCCAGTCTCTCTGGTCTTGG - Intergenic
1111402621 13:87761079-87761101 CAGGTCACTGCCCCTGGCCTAGG + Intergenic
1112567082 13:100560954-100560976 CAGCCCACTATCCCAGGCCCTGG - Intronic
1114069306 14:19095283-19095305 CAGCCCATCAACCCTGGCCTAGG - Intergenic
1114092955 14:19304719-19304741 CAGCCCATCAACCCTGGCCTAGG + Intergenic
1117063902 14:51989721-51989743 CGGCCGCGTGTCCCTGACCTGGG + Intronic
1118933417 14:70264062-70264084 CAGCACAGGGACCCTGGGCTCGG - Intergenic
1119153282 14:72385638-72385660 CAGCCTTGTGTCCCTGGGCAGGG - Intronic
1119524988 14:75315789-75315811 CAGACCAGTGCCCCAGTCCTCGG + Intergenic
1119555407 14:75548635-75548657 CAGCCCAGTGTCCACATCCTAGG - Intergenic
1119896892 14:78227826-78227848 CATCCCAGTTTTCCTGGCCAAGG - Intergenic
1121849733 14:97209919-97209941 CAGCTCTGTCTCCATGGCCTGGG - Intergenic
1122266269 14:100548360-100548382 CAGCCCATTGTGCCTGCCCTAGG - Intronic
1122340929 14:101028077-101028099 CGGCCCACTCACCCTGGCCTGGG - Intergenic
1122556854 14:102585238-102585260 CAGCCCCCTGTCCCAGGCCCTGG - Intergenic
1122723064 14:103732772-103732794 GGGCCCAGCCTCCCTGGCCTGGG - Intronic
1122723267 14:103734276-103734298 CAGCCCCGTCTACCTGGCCCTGG + Exonic
1122834947 14:104426198-104426220 CAACTCAGTTTCCCTGGGCTGGG + Intergenic
1122938721 14:104971804-104971826 CAGCCCTGTGCCCATAGCCTGGG + Intronic
1202895272 14_GL000194v1_random:2980-3002 AAGGCCAGTGTGCCAGGCCTGGG + Intergenic
1124252166 15:28113997-28114019 CAGCACAGTGTCTCGGGCCTGGG - Intronic
1125411542 15:39411268-39411290 CTGCCCAGTTTCCCAGACCTAGG + Intergenic
1126178177 15:45758132-45758154 CAGCCCAGTGTATCTGTCCTTGG - Intergenic
1127350041 15:58142100-58142122 GAGCCCAGTTGCCCTGCCCTGGG + Intronic
1128185408 15:65640109-65640131 CAGCCCAGGCTGACTGGCCTGGG + Intronic
1128260534 15:66229781-66229803 CAGCTCTGTGTCCTTGTCCTGGG - Intronic
1128308207 15:66613838-66613860 CAGCCCAGGGTTCTGGGCCTGGG + Intronic
1129206751 15:74041784-74041806 CTGGCTAATGTCCCTGGCCTAGG - Intronic
1129469420 15:75742518-75742540 CAGCACAGGGTCCCTGGCCCCGG - Intergenic
1129707893 15:77805068-77805090 CAGCCCAGGGTGCAAGGCCTGGG - Intronic
1129834654 15:78694545-78694567 CAGCTCAGTGTTCCTGGTCTTGG - Intronic
1129842163 15:78750642-78750664 GAGCCCTGTGTTTCTGGCCTGGG + Intergenic
1129887554 15:79049193-79049215 CAGCTGAGAGTCCCAGGCCTGGG + Intronic
1130137028 15:81190042-81190064 CAGGCCAGGGCCCCTGGCCAGGG + Intronic
1130412387 15:83657856-83657878 CAGCCCTGTGTCCCTGTCCGTGG + Intronic
1131176245 15:90211445-90211467 CTGCCCAGAGTCCCTGGTCAGGG + Intronic
1132206377 15:99988779-99988801 CTGCACAGTGTCCTTGGCCAGGG + Intronic
1132468827 16:90440-90462 GAGGCCAGTGACCCTGGGCTTGG + Intronic
1133062143 16:3181920-3181942 CCACCCAGTGTCCCTGGCTCCGG - Intergenic
1134065716 16:11226690-11226712 CCTCCCTGTGTCCCTGCCCTTGG - Intergenic
1134512977 16:14863746-14863768 CAGTGCAGTGGCCCTGCCCTTGG + Intronic
1134680269 16:16120183-16120205 CAGCCCAGTACACCTGGCCCAGG + Intronic
1134700615 16:16262235-16262257 CAGTGCAGTGGCCCTGCCCTTGG + Intronic
1134971210 16:18532424-18532446 CAGTGCAGTGGCCCTGCCCTTGG - Intronic
1135745691 16:25014920-25014942 CTGCCCATTGTCCCTGCCCCGGG - Intronic
1136109383 16:28055086-28055108 GAGCCCAGTGGCCCTGGCTCTGG + Intronic
1136639518 16:31550971-31550993 CTCCCCAGGGTCCCTGGCGTCGG - Intergenic
1136665243 16:31805557-31805579 CTCCCCAGGGTCCCTGGCGTCGG + Intergenic
1137373319 16:47929010-47929032 AAGCCCAGTGTGCCTGGAGTTGG + Intergenic
1137533603 16:49300217-49300239 CTCCCCAGTGTTACTGGCCTTGG - Intergenic
1138630521 16:58290939-58290961 CAGGCCAGTGCCCCTGCCTTTGG - Exonic
1138950783 16:61909902-61909924 CAAGCCAGTGTTCATGGCCTTGG + Intronic
1139657143 16:68395967-68395989 CAACTCAGTGTGCCTGGCCTGGG + Intronic
1139666245 16:68458820-68458842 CAGGCCAGTGCCCATGCCCTAGG - Intergenic
1139699454 16:68698682-68698704 CAACCCTGTGTCCTGGGCCTGGG + Exonic
1139914382 16:70419081-70419103 CAGACCAGAGTCCCTCGCCATGG - Intronic
1140744101 16:77965727-77965749 CATCCTAGAGCCCCTGGCCTGGG - Intronic
1140872473 16:79120015-79120037 CAGCCCAGTGGCCGTGGCCTGGG + Intronic
1140916378 16:79497472-79497494 CTGCCCAAGGTCACTGGCCTAGG + Intergenic
1141673407 16:85504828-85504850 CAGGCCGGTGGCTCTGGCCTTGG + Intergenic
1142689144 17:1594438-1594460 ACACCCAGCGTCCCTGGCCTTGG + Intronic
1142753100 17:1999980-2000002 CAGGCCAGGGTCCCTGGGCCTGG + Intronic
1142856227 17:2731799-2731821 TAGCCCAGGGACCTTGGCCTAGG + Intergenic
1143034899 17:3989207-3989229 CAGCCCAGGGCAGCTGGCCTCGG + Intergenic
1143166370 17:4899173-4899195 GAGCACAGTGGCCCTGGCCCGGG - Intronic
1143487292 17:7261894-7261916 CAGCCCCTTGTACATGGCCTGGG + Exonic
1143624819 17:8103730-8103752 CCGCCCAGTGTTCCAGGACTCGG + Intronic
1144771165 17:17760442-17760464 CAGCCCAGTGTCCCTGGCCTGGG + Intronic
1146290863 17:31606128-31606150 GAGCCAAGTATCCCTGGACTAGG + Intergenic
1146554303 17:33810481-33810503 CAGACCAGTGTTCCTGCACTTGG - Intronic
1147437301 17:40424978-40425000 CAGCACAGTGTCCCTTACTTTGG - Intergenic
1149660885 17:58333378-58333400 CAGCCCAGGGCCCCTGGCTGGGG + Intergenic
1151436987 17:74103847-74103869 CAGCCCAGTGGCCTCGACCTTGG - Intergenic
1151880001 17:76889125-76889147 CAGCTCGGTGTACCTGGCATGGG - Intronic
1152014530 17:77741787-77741809 CAGCCCTGAGACCCTGCCCTGGG + Intergenic
1152223618 17:79082551-79082573 CAGGCCGGTGCCCCTGGCGTGGG + Intronic
1152598488 17:81249656-81249678 CAGCCCAGTCCCCGTGGTCTTGG - Intronic
1152791513 17:82282803-82282825 CAGCCCTGCGTCCCTGGCTCAGG + Intergenic
1152795802 17:82305560-82305582 CAGCTCAGTGTCCCTCAGCTGGG - Intergenic
1152905351 17:82967468-82967490 CAGCACAGTGGCCCTCACCTGGG + Intronic
1153675766 18:7454712-7454734 CAGCTGAGTGTCTGTGGCCTTGG - Intergenic
1155401142 18:25441063-25441085 CAGCCCACTGTCCACGGCCTAGG + Intergenic
1156615915 18:38783969-38783991 CTGCCTTGTGTCCCTGCCCTAGG - Intergenic
1157578532 18:48759746-48759768 CAGACCACTGTTCCTGCCCTGGG + Intronic
1157621269 18:49018619-49018641 CAGGCCTCTATCCCTGGCCTGGG + Intergenic
1157737409 18:50062388-50062410 CAGACCAGTGTTCCTGTTCTTGG - Intronic
1158557237 18:58485506-58485528 GAGCCCACAGTCCATGGCCTTGG + Intronic
1159507990 18:69360618-69360640 CAGCACAGGGACCCTGGGCTTGG - Intergenic
1160385647 18:78494768-78494790 TTCCCCAGTGTCCCTGGTCTTGG - Intergenic
1160838376 19:1135487-1135509 CAGCCCAGGGTCCCTGGAGCAGG + Intronic
1160957225 19:1699337-1699359 CAGCCCAGGGTCACAGGACTGGG - Intergenic
1161013676 19:1972222-1972244 CAGCCAAGCGTCCCTGCGCTGGG - Intronic
1161039689 19:2103612-2103634 CTGCCTCTTGTCCCTGGCCTTGG - Intronic
1161320959 19:3641330-3641352 TAGCCCAGGGTCTCTTGCCTGGG + Intronic
1161509024 19:4660481-4660503 AACCCCCGTGCCCCTGGCCTGGG + Intronic
1161805277 19:6439985-6440007 CAGCCCCTTGTCCCTTCCCTAGG + Intronic
1162438594 19:10679092-10679114 CAGCCCGTTGGCTCTGGCCTAGG - Exonic
1162462042 19:10819026-10819048 CAGCCCCTTGCCCCTGGCCGAGG + Intronic
1162475140 19:10895386-10895408 CAAGCCACTGTGCCTGGCCTAGG + Intronic
1163300486 19:16442647-16442669 TCGACCAGTTTCCCTGGCCTGGG + Intronic
1163320372 19:16571485-16571507 CTGCCCAGAGTCCCTGCCCGGGG + Intronic
1163466308 19:17470277-17470299 CAGACCAGGGCCCCAGGCCTGGG - Intronic
1164680168 19:30129230-30129252 AAGCCGAGTCTCCCTGTCCTCGG - Intergenic
1165009232 19:32831775-32831797 CAGCCCAGTTCCCCAGGCCAAGG + Intronic
1165151383 19:33762571-33762593 CACCCCAGTGTCGCTGCGCTGGG + Intronic
1165747186 19:38236822-38236844 CAGCCCAGTGACACTGACTTTGG - Intergenic
1165937533 19:39398334-39398356 GACCCCAGGGTCCTTGGCCTAGG + Exonic
1167279093 19:48556098-48556120 CAGCGCAGTGTCCTTTGCCTGGG + Intronic
925016202 2:525975-525997 CAGGCCAGTGTCCATGGACAGGG + Intergenic
925059793 2:881805-881827 GCTCCCAGTGTCCCTGTCCTGGG - Intergenic
925163101 2:1700615-1700637 CCTCCCACTGTGCCTGGCCTTGG - Intronic
925342634 2:3147797-3147819 CACCCCAGCGTCCCCGGCCCTGG + Intergenic
925577665 2:5377229-5377251 CTGCACTGTGTGCCTGGCCTGGG + Intergenic
926761353 2:16281545-16281567 CAATCCAGTGTCCATCGCCTTGG - Intergenic
927302751 2:21535351-21535373 CAGCATTGTGTCCCTGGTCTAGG + Intergenic
927497486 2:23560727-23560749 CTGCCCAGTGTGCCTGGCAGAGG + Intronic
927687196 2:25179211-25179233 CAGCCTGGTGTCCCTCTCCTGGG - Intergenic
927894956 2:26775683-26775705 CAGCCCCGTGTCCCTGCCCCTGG - Intronic
929711154 2:44267940-44267962 CAGCCCAGTATCCCTGGGAGAGG - Intergenic
931642691 2:64395768-64395790 AGGCCCAGGGTCCCTGCCCTTGG + Intergenic
932576223 2:72963744-72963766 CAGCCCAGCCTCCCTGGCACTGG - Intronic
932720922 2:74138633-74138655 CAGTCCAGTCTTCCTAGCCTGGG - Intronic
932803130 2:74760528-74760550 CAGCCCAGTGTATCTGTCCTTGG - Intergenic
933938330 2:87225125-87225147 AGGGCCAGTGTCCTTGGCCTTGG + Intergenic
934763544 2:96868862-96868884 CGCCCCAGGGACCCTGGCCTGGG + Intronic
935051824 2:99530813-99530835 CAGCCCAGAGTCCAGAGCCTGGG - Intergenic
936010021 2:108919687-108919709 CTGCCCAGTGTCCCAGGCTCTGG + Intronic
936354805 2:111740650-111740672 AGGGCCAGTGTCCTTGGCCTTGG - Intergenic
937454872 2:122032506-122032528 CAGCCAAGTCTCACTGGACTTGG + Intergenic
938386147 2:130868780-130868802 CAGCCCAGTGCGGCTGGCTTTGG - Intronic
938791955 2:134684459-134684481 CTTCCCATTGTCCTTGGCCTTGG - Intronic
942072758 2:172330162-172330184 CATCCTAGTGCCCCTGCCCTTGG - Intergenic
945306623 2:208265393-208265415 CAGCCCAGTTTTCCTGGAGTTGG - Intronic
946251958 2:218419321-218419343 GAGCCCAGTGTGTCTGCCCTGGG + Intronic
946654597 2:221932821-221932843 CAGTCCAGTGTTGCTGGTCTTGG + Intergenic
946715170 2:222546619-222546641 CAGCCCTTTGTCACTGACCTTGG - Intronic
947301066 2:228689141-228689163 CTCCCCAGAGACCCTGGCCTGGG + Intergenic
947500774 2:230669160-230669182 CAGCCCTGTGTCCCCAGCCCTGG + Intergenic
947824047 2:233092255-233092277 CAGCCCAGAGTCCCCAGCCCTGG - Intronic
947883633 2:233544467-233544489 CAGCCCTGCTTCCCTGACCTTGG - Intronic
948570917 2:238916703-238916725 CAACCCAGTGGGCCTGCCCTGGG + Intergenic
948793620 2:240391465-240391487 CAGCCCAGGGCCCGGGGCCTTGG + Intergenic
948992209 2:241560928-241560950 CAGCGCTGTCTCCCTGCCCTTGG + Intronic
1168830964 20:845149-845171 CAGCCCCGTGTCCCCTGCCGAGG + Exonic
1168849000 20:963906-963928 CAGCCTCGTGTGCCTGTCCTGGG + Intronic
1168969960 20:1924295-1924317 GAGCCCAGTGTGCATGGCCCAGG + Intronic
1169197807 20:3692828-3692850 CATCCCAGTGGGCTTGGCCTAGG + Intronic
1171133026 20:22672806-22672828 GAGCCCAGTGCCTCTGTCCTTGG - Intergenic
1176013089 20:62910983-62911005 CTCCACAGTGTCACTGGCCTCGG + Exonic
1176017529 20:62943436-62943458 CTGCCCTAAGTCCCTGGCCTGGG + Intronic
1176019009 20:62953160-62953182 CAGGACAATGCCCCTGGCCTGGG - Intronic
1176028061 20:62996251-62996273 CGGCACTGTGTCCCTGTCCTTGG - Intergenic
1176107089 20:63394568-63394590 CAGACAAGAGTCCCTGGACTGGG - Intergenic
1176219047 20:63961422-63961444 CAGGCCAGTGCCCCAGCCCTTGG + Intronic
1176614973 21:9018967-9018989 AAGGCCAGTGTGCCAGGCCTGGG + Intergenic
1180180305 21:46115959-46115981 CAGCCCAGCGCCCCAGGGCTGGG + Intronic
1180255412 21:46624129-46624151 CAGCCAAGTGGGCCTCGCCTGGG - Intergenic
1180487777 22:15817846-15817868 CAGCCCATCAACCCTGGCCTAGG - Intergenic
1180758978 22:18184371-18184393 CACCCCAGTGTGCCTGGCATGGG + Intergenic
1180769265 22:18368162-18368184 CACCCCAGTGTGCCTGGCATGGG + Intergenic
1180777047 22:18494233-18494255 CACCCCAGTGTGCCTGGCATGGG - Intergenic
1180809769 22:18751571-18751593 CACCCCAGTGTGCCTGGCATGGG - Intergenic
1180827137 22:18871391-18871413 CACCCCAGTGTGCCTGGCATGGG + Intergenic
1180876179 22:19176281-19176303 CAGCACAGTGTCCCTGCACAGGG + Intronic
1181036821 22:20173747-20173769 CAGCCCAGTGTCTGTGGAGTGGG + Intergenic
1181195907 22:21185794-21185816 CACCCCAGTGTGCCTGGCATGGG - Intergenic
1181213621 22:21307330-21307352 CACCCCAGTGTGCCTGGCATGGG + Intergenic
1181306541 22:21920384-21920406 CAGACCAGTGTCCCTGGCTAGGG + Exonic
1181439891 22:22930334-22930356 CTGCCCAGAGACCCAGGCCTGGG + Intergenic
1181512593 22:23395528-23395550 CAGCACAGGGTCCCTGTCCCTGG - Intergenic
1181581217 22:23829143-23829165 CAGCCCTGTGTTCCTGGCCAGGG + Intronic
1182585103 22:31340453-31340475 CAGCCAGGTGTGCCTGGACTTGG - Intronic
1182754029 22:32664327-32664349 TGGCCAAGTCTCCCTGGCCTTGG - Intronic
1182838073 22:33360785-33360807 CAGCCCAGTGGCGGTGGGCTGGG - Intronic
1183253085 22:36744034-36744056 CACCTCAGGGTCTCTGGCCTGGG + Intergenic
1183770935 22:39925266-39925288 CATCCCATTGTCCCCAGCCTGGG - Intronic
1184048487 22:41987408-41987430 CTCCCCAGGGGCCCTGGCCTGGG - Intronic
1184227035 22:43135015-43135037 GAGCCCTGTGGCCCTAGCCTGGG - Intronic
1184403996 22:44289678-44289700 CAGCATAGTGCCCATGGCCTGGG - Intronic
1184848294 22:47102422-47102444 CAGCCCTGGGCACCTGGCCTTGG - Intronic
1185070543 22:48653455-48653477 CACCACAGTGGCCCTGGCCAGGG - Intronic
1185245694 22:49771632-49771654 CTGCCCCGGGGCCCTGGCCTTGG - Intergenic
1185419715 22:50728651-50728673 CAACAAAGTGGCCCTGGCCTGGG - Intergenic
1203230894 22_KI270731v1_random:109047-109069 CACCCCAGTGTGCCTGGCATGGG + Intergenic
1203277282 22_KI270734v1_random:97296-97318 CACCCCAGTGTGCCTGGCATGGG + Intergenic
949693009 3:6662314-6662336 CAGCCCAGGGACCCTGGGCCTGG + Intergenic
949918756 3:8985420-8985442 CTTCCCAGTGACCCTGGCCTTGG - Exonic
950021881 3:9793140-9793162 CAGCCGGGGGTCCCTGGCCGGGG - Exonic
950565774 3:13768699-13768721 CAGCCGAGTCTCCTTTGCCTTGG + Intergenic
952906154 3:38140307-38140329 CAGCCAAGAGTCCCCTGCCTAGG - Intronic
952966372 3:38623513-38623535 AAGCACAGTGTCCCTGCTCTAGG - Intronic
953588979 3:44233323-44233345 CAGCCCTGTGACCTTGGGCTAGG - Intergenic
953791490 3:45951221-45951243 CAGCCCAGTGTCTAATGCCTGGG - Intronic
953842445 3:46400105-46400127 CACCCCAGCCTCCCGGGCCTGGG + Intergenic
954292030 3:49654854-49654876 TAGCCCTGTGTGCCTGGCCCAGG + Exonic
954460238 3:50622428-50622450 CTGCCCAGAGTTCCTGGCTTTGG + Intronic
954581948 3:51707684-51707706 GAGCCCAGTGCCCCTGCCCTGGG + Intronic
954697337 3:52434850-52434872 CATCCCAGCAACCCTGGCCTGGG + Exonic
956187145 3:66573582-66573604 GAGCGCAGTTTCTCTGGCCTGGG + Intergenic
956836372 3:73099511-73099533 CAGCAGATGGTCCCTGGCCTAGG + Intergenic
961083364 3:124045058-124045080 ATGCCCATTGTCCCTGGGCTGGG - Intergenic
961213687 3:125143796-125143818 CAGGGCAGCCTCCCTGGCCTGGG + Intronic
961431533 3:126887574-126887596 TAGCCCAGTGTCCCTGGGCTGGG + Intronic
961617042 3:128190900-128190922 CAGCTCACTGTGCCTCGCCTGGG + Intronic
961617093 3:128191426-128191448 CAGCTCACTGTGCCTGGCCTGGG + Intronic
961680840 3:128598944-128598966 CAGCCCTGTGTGCACGGCCTGGG - Intergenic
961741868 3:129038275-129038297 CAGCCCAATGTCCACGTCCTAGG + Intronic
963952799 3:151221488-151221510 CAGCACAGAGACCCTGGGCTGGG - Intronic
964520718 3:157563641-157563663 CAGCACAGGGACCCTGGCCCTGG + Intronic
967259607 3:187629146-187629168 CCTCCCAGTCTCCCTGGCCAGGG + Intergenic
968683762 4:1941472-1941494 GAGCTCAGTCTCCCTGGCCTAGG + Intronic
968963716 4:3758879-3758901 CAGCCCTGGGTACCTGGCTTGGG - Intergenic
969100186 4:4762830-4762852 CAGCCCGGTGACTTTGGCCTGGG + Intergenic
969222923 4:5773075-5773097 CACCGCAGTGTCCCTGGCACAGG + Intronic
969476370 4:7424673-7424695 CAGCCCAGAGTCCCTGTGCCGGG + Intronic
969509474 4:7609604-7609626 CTGCTCTGTGTCCTTGGCCTAGG + Intronic
969955295 4:10883545-10883567 CAGCACAGAGTCCCTGGACTGGG + Intergenic
970400239 4:15710249-15710271 CAGGCCACAGTACCTGGCCTTGG + Intronic
970607860 4:17697343-17697365 CTCCCCAGAGTCACTGGCCTAGG - Intronic
971508411 4:27392374-27392396 GAACCCACTGTACCTGGCCTTGG + Intergenic
972530519 4:39957506-39957528 CAGGCCACTGTGCCTGGCCCAGG - Intronic
972667841 4:41184259-41184281 CAGACCAGTATCCCTGGCTGGGG + Intronic
972857146 4:43120643-43120665 CAGCACAGGGACCCTGGGCTTGG + Intergenic
983558142 4:169076673-169076695 CAGCGAAGTCTCCCTGGCATGGG - Intergenic
984608407 4:181810892-181810914 CATCCCAGCTTCCCTGGCCTGGG + Intergenic
984774244 4:183466950-183466972 CAGCACAGGGACCCTGGCCCTGG - Intergenic
985444206 4:190012058-190012080 CAGTCCACTGTCCCTGGGCCCGG - Intergenic
985481364 5:113000-113022 CAGACCCGTGGCCCTGTCCTGGG - Intergenic
985534363 5:455252-455274 CAGCCTAGTGGCCATGGCCCGGG - Intronic
985599547 5:819588-819610 CAGCCGGGAGTTCCTGGCCTTGG + Exonic
985618412 5:938400-938422 CAGCCCAGTGGCCCTGGCTTTGG + Intergenic
985853127 5:2403462-2403484 CAGCCCAGGGGCAGTGGCCTGGG - Intergenic
986180126 5:5385368-5385390 CAGCCCCTTGTCTCTGGGCTTGG + Intergenic
986410536 5:7474907-7474929 CTGCCCATTGTGGCTGGCCTGGG - Intronic
988365109 5:30288851-30288873 CACTCCAGTGTCCCTGGTCGTGG + Intergenic
988526816 5:31994378-31994400 CAGCCCAGTGTCTGTGGCAGTGG + Intronic
989983701 5:50671383-50671405 GAGCCCAGTGGGCCTGGCCATGG + Intronic
990986902 5:61649038-61649060 CAGCCCTGTGCCCCTAGGCTGGG - Intronic
991411083 5:66346473-66346495 CTGCCCAGTGTCCCTAGGTTTGG + Intergenic
991583836 5:68182832-68182854 CAGCCCTGTGTTCCTGACCTAGG - Intergenic
992738102 5:79744334-79744356 CTGCCCAGTGTCCCATGCCCAGG + Intronic
993475335 5:88357594-88357616 CAGGCCTTTGTCCCTGGCTTTGG - Intergenic
997516885 5:134496238-134496260 CATGTCAGTCTCCCTGGCCTAGG - Intergenic
997590587 5:135069767-135069789 CAGGCCATTGTCCCTAGCCCGGG + Intronic
998460212 5:142304423-142304445 CTGCCCAGTTCCCCTGGGCTGGG - Intergenic
999473662 5:151878593-151878615 CAGCACAGGGACCCTGGGCTTGG - Intronic
1001311775 5:170616309-170616331 CACCTCAGTGTGCCTGGCCCAGG - Intronic
1001342713 5:170862201-170862223 CAGACCAGTGTCCCGGTCCCCGG - Intronic
1001527589 5:172439836-172439858 CAGCCCAGTGTCTCAGTCGTCGG - Intronic
1002255973 5:177958828-177958850 CTGCCCAGTGGCCCCGTCCTGGG - Intergenic
1002709218 5:181184167-181184189 CCGCCCAGGGTCCCTCGCCCCGG - Intergenic
1006442961 6:34063381-34063403 CAGCCCAGTGTCACTGCCTTTGG - Intronic
1006490219 6:34380843-34380865 CGGCCCAGTGTCCTTCACCTAGG + Intronic
1007211418 6:40195945-40195967 CAGTCCAGTGGCCCAGGCCGAGG - Intergenic
1007275038 6:40667101-40667123 CAGCCCAATTTCCCTGGGCAGGG - Intergenic
1007367184 6:41403094-41403116 GAGGGCATTGTCCCTGGCCTGGG - Intergenic
1007711607 6:43827855-43827877 CAGCCCAGTGTCTCTGGGCCTGG + Intergenic
1007721594 6:43888442-43888464 AAGCCCAGTGTCCTTGGCACAGG + Intergenic
1008872567 6:56289897-56289919 CAGCCCAGTGGCTGTGGGCTGGG - Intronic
1013109014 6:107050114-107050136 CAGACCAGTGTCCTTGACCTTGG + Intronic
1016934836 6:149441847-149441869 CAGGACAGTGTTCGTGGCCTTGG + Intergenic
1017024794 6:150172309-150172331 CTGTCTAGTCTCCCTGGCCTAGG - Intronic
1018176501 6:161182789-161182811 GTGCCCAGTGTCCCTCTCCTGGG - Intronic
1018343891 6:162881728-162881750 CACCCCACTGTCTCTGGTCTTGG - Intronic
1018344012 6:162882209-162882231 CACCCCACTGTCTCTGGTCTTGG - Intronic
1018652381 6:166003044-166003066 CAGGCCTGTGTCCTGGGCCTTGG - Intergenic
1019301476 7:306163-306185 CAGCCCAGGGTCTCAGGCGTCGG + Intergenic
1019526987 7:1484920-1484942 CAGCACAGAGACCCTGCCCTGGG - Intronic
1020086961 7:5315745-5315767 AAGCCCAGTGGCCCAGGCCATGG - Intronic
1020105465 7:5420503-5420525 CAGCCTTGGGACCCTGGCCTCGG - Intronic
1022616840 7:31940508-31940530 CAGGCCAGTGTTGCTGGCCCAGG + Intronic
1023017450 7:35982275-35982297 CACCTCAGTGTCCCTGGGCCTGG + Intergenic
1023287030 7:38631142-38631164 CGTCCCAGCGTCCCTGGCCCCGG + Intronic
1023394085 7:39736097-39736119 AAGGCCAGTCTCCCTGGTCTAGG - Intergenic
1023865244 7:44235285-44235307 CTGCCCAGCAGCCCTGGCCTTGG + Intronic
1023956889 7:44893735-44893757 CAGCACGGGGTGCCTGGCCTGGG - Intergenic
1024222417 7:47298992-47299014 CAGCCCTGGGTCCCTTGCATGGG - Intronic
1025207349 7:57001408-57001430 AAGCCCAGTGGCCCAGGCCATGG + Intergenic
1025664588 7:63575478-63575500 AAGCCCAGTGGCCCAGGCCATGG - Intergenic
1026194990 7:68164935-68164957 CAGCCCCTTGTCCCTGTGCTAGG + Intergenic
1026873092 7:73865136-73865158 CAGCCCAGAGAGCCTGGCCCAGG - Exonic
1027186018 7:75971415-75971437 AAGCCCAGTGCCCCTTGCCCAGG - Intronic
1027233929 7:76286891-76286913 CAGCCCAGGGTCACAGGCATAGG + Exonic
1032214639 7:129948527-129948549 GAGCCCAGTGCACCTGGCCCAGG - Intronic
1033165441 7:139035533-139035555 CAGCCCCGCGTCCCCGGCCCGGG + Intronic
1034445997 7:151114720-151114742 CAGCCCCGTGCCCCTCGCCATGG + Intronic
1034546694 7:151794129-151794151 CAGGCCAGGGTCCTTGGCCTTGG - Intronic
1034803579 7:154068502-154068524 GGGCCCAGTGGCCCCGGCCTTGG + Intronic
1034972014 7:155425096-155425118 CAGCCTAGTGGCCCTGGACCTGG + Intergenic
1034978371 7:155460770-155460792 CAGGCCAGTGGGCCTGGCTTTGG - Intronic
1035056535 7:156039939-156039961 CAGCCGGGTGTCCCAGGCCTCGG + Intergenic
1037969351 8:23161001-23161023 CATACCAGGCTCCCTGGCCTTGG - Intronic
1037985207 8:23286676-23286698 CTGCCCAGGGTCCCTGGACTAGG - Intronic
1038363964 8:26912008-26912030 CACCCCAGTGTCCTTAACCTTGG - Intergenic
1039503210 8:38032765-38032787 CAGCCAGGTTTCCCTGGCTTAGG - Intronic
1040573205 8:48627470-48627492 CAGCCCAGCTTCCAGGGCCTGGG + Intergenic
1040671614 8:49698108-49698130 CTGCTCAGCATCCCTGGCCTGGG - Intergenic
1041520710 8:58752867-58752889 CAGCACACTGTGCCTGGGCTAGG - Intergenic
1042082417 8:65070280-65070302 AACCACAGTGTTCCTGGCCTTGG - Intergenic
1044508594 8:93049370-93049392 CCACCCAGTCTCCCTGGCATTGG + Intergenic
1044944159 8:97375324-97375346 TATCCCAGTGTGGCTGGCCTTGG - Intergenic
1045214203 8:100130365-100130387 CAGCCCAGGGACCCTGGGCCAGG + Intronic
1045724936 8:105161096-105161118 CAGGCCACTGTCCATGGCCTAGG - Intronic
1047510442 8:125511706-125511728 CAGCCCAGTGTGCCAGCTCTTGG - Intergenic
1047510447 8:125511731-125511753 CAGCCCAGTGTGCCAGCTCTTGG - Intergenic
1047510452 8:125511756-125511778 CAGCCCAGTGTGCCAGCTCTTGG - Intergenic
1048581483 8:135732725-135732747 CAGCCCAGTGTCCCAGGGCTGGG + Intergenic
1048733486 8:137470998-137471020 GTGGCCAGTCTCCCTGGCCTTGG - Intergenic
1049194843 8:141309094-141309116 CGGATCAGTGTCCCTGGCCAGGG - Intergenic
1049203933 8:141354647-141354669 GAGTCCAGAGTCCCTGGCCCTGG + Intergenic
1049382545 8:142324727-142324749 CAGCCCAGGCTCCCTGGCACCGG + Intronic
1049853360 8:144846414-144846436 GTGCACAGTGTCCCTGGGCTTGG + Intronic
1052387158 9:27835692-27835714 CTGCCCAGTCTCCCTGGCACCGG + Intergenic
1052541542 9:29817185-29817207 CAGCCCTGTGCCCATGTCCTGGG + Intergenic
1052916390 9:33926941-33926963 CTGCCCAGCTCCCCTGGCCTCGG - Intronic
1053412637 9:37925528-37925550 CCGCCCAGTGTCCCCTGCCCAGG + Intronic
1056960735 9:91120350-91120372 CAGCCCAGTGTGTCTAGGCTGGG + Intergenic
1058283682 9:103150206-103150228 CAGCACAGAGTCCCTGGGCCTGG - Intergenic
1058349871 9:104009154-104009176 CAGCCTAGTGGCACTGGCCAGGG - Intergenic
1058602472 9:106684906-106684928 CTTCCCAGAGTCCCTGGGCTTGG + Intergenic
1059308754 9:113374241-113374263 CAGCCCATGGGCCCGGGCCTTGG + Exonic
1059567564 9:115398307-115398329 CAGCCCAGTGTGGTTGGCATGGG - Intronic
1060175942 9:121497840-121497862 CAGCCCTGTGGCCCTGGAGTTGG + Intergenic
1060195858 9:121622889-121622911 AAGCCCAGTGGCCCTGGCAATGG - Intronic
1060797356 9:126521897-126521919 AAGCCCACTGGCCCAGGCCTGGG + Intergenic
1060823379 9:126673908-126673930 CAGGCCTGTGTACCTGGCCACGG - Intronic
1061251222 9:129427658-129427680 CTGCCCAGTGTCCGGCGCCTGGG + Intergenic
1061396064 9:130343812-130343834 CAGCCCTGTGGCCTTGGGCTCGG + Intronic
1061406398 9:130395022-130395044 CAGCCCAGCATCCCTAACCTGGG - Intronic
1061938893 9:133873621-133873643 AAGCCCTGTGTCCCAGGGCTGGG + Intronic
1061956216 9:133962507-133962529 CAGCCCAGGTGCCCTGGGCTGGG - Intronic
1062036970 9:134386706-134386728 GACCCCAGTGGTCCTGGCCTCGG - Intronic
1062601651 9:137321064-137321086 CCTCCCACTGCCCCTGGCCTGGG - Intronic
1062628524 9:137453638-137453660 CAGCCCAGCGGCCCTGGCAGGGG + Intronic
1185734491 X:2486645-2486667 CTGCCCTGCGTCCCCGGCCTCGG + Exonic
1189253488 X:39619740-39619762 CAGCCAAGTCTCACTGGCCTGGG - Intergenic
1189478470 X:41375167-41375189 CAGCACAGTCAGCCTGGCCTGGG + Intergenic
1189658884 X:43277556-43277578 CACTCCCCTGTCCCTGGCCTTGG - Intergenic
1191020862 X:55858757-55858779 CAGCACAGGGACCCTGGGCTTGG + Intergenic
1192203766 X:69082955-69082977 GAGCCCAGTCAGCCTGGCCTGGG + Intergenic