ID: 1144771559

View in Genome Browser
Species Human (GRCh38)
Location 17:17762372-17762394
Sequence CAGTGTGGTTGGAGTGTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 289}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144771551_1144771559 21 Left 1144771551 17:17762328-17762350 CCTGGGGGTCAGGGGCATGGCAT 0: 1
1: 0
2: 2
3: 17
4: 237
Right 1144771559 17:17762372-17762394 CAGTGTGGTTGGAGTGTGCATGG 0: 1
1: 0
2: 3
3: 31
4: 289

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144771559 Original CRISPR CAGTGTGGTTGGAGTGTGCA TGG Intronic
900101978 1:965895-965917 CAGTGTGGGTGGCGTTTGCCTGG + Intergenic
900654429 1:3748054-3748076 AAGTGAGGGTGGAGTGTGAAAGG - Intergenic
900707378 1:4089160-4089182 CAGGGTGGTTGGAAGGAGCATGG - Intergenic
902192118 1:14771066-14771088 CAGTGTGGGAGGAGGGTGCGGGG + Intronic
904512220 1:31021290-31021312 CAGGGATGTTGGAGTGTACAGGG - Intronic
905584837 1:39108065-39108087 CTGTGTGGTGGCAGTGAGCATGG + Intronic
906553575 1:46688301-46688323 CAGTGTGTTTTGTCTGTGCATGG - Intronic
907686357 1:56615664-56615686 TACTGTGGTAGGAATGTGCATGG + Intronic
907903039 1:58759246-58759268 CAGTGTGGTTGTAGTGGGAGGGG - Intergenic
908606880 1:65807789-65807811 AAGTAGGGTTGGAGTGGGCAGGG + Intronic
909101752 1:71357490-71357512 CAGGGTGGTTGGAGGGTATAGGG + Intergenic
910809587 1:91222603-91222625 AAGTTTGGTTGTAGTGTGGATGG - Intergenic
913555075 1:119957907-119957929 CAGTGTAGTGGGAATGAGCATGG + Intronic
915049236 1:153049921-153049943 TAGTGTTGTTGGTGTGTGGATGG - Intergenic
915113303 1:153578575-153578597 CAGTGTGGCTGGAGCATGGATGG + Intergenic
919359333 1:196570966-196570988 CAGTGTGGTAGGAGTAGGCCAGG - Intronic
920193565 1:204211364-204211386 CAGTGTGGTTGGAGCATGGCAGG - Intronic
922051864 1:221998555-221998577 GAGTGTGCTTGGGGTGAGCATGG - Intergenic
922169749 1:223144285-223144307 CAGTGGGGTTCGGGTGGGCAGGG - Intergenic
922751146 1:228070576-228070598 TAGTGTAGTGGGAGAGTGCAGGG + Intergenic
923749153 1:236731011-236731033 CTTTATGATTGGAGTGTGCATGG + Intronic
924718896 1:246605127-246605149 CAGTGTGCTTGGAATGAACAGGG + Intronic
1063280034 10:4618326-4618348 CAGTGTGATTGGTGTGAGCTTGG - Intergenic
1064998807 10:21318924-21318946 CAGTGTGGTTAGAGGCTGCGAGG - Intergenic
1065828009 10:29589351-29589373 CAGTGTGGTGGGAATCTGGAGGG + Intronic
1066231224 10:33435752-33435774 CAGGGTGGTTGCAGGGTGGAGGG - Intergenic
1067397027 10:45930576-45930598 CAGTGTGGTAGCAGAGGGCAAGG + Intergenic
1067865343 10:49899677-49899699 CAGTGTGGTAGCAGAGGGCAAGG + Intronic
1067913788 10:50374730-50374752 CAGAGTGGTTGAAGTGAGAATGG - Intronic
1069621162 10:69838061-69838083 CACTGTGGGTGGAATGTCCAGGG - Intronic
1069844401 10:71361082-71361104 GAGTGTTGTTTGTGTGTGCATGG + Intronic
1070679600 10:78439340-78439362 GAGTGTGGTGGGAGTGGGGAGGG + Intergenic
1070797327 10:79224340-79224362 GAGTTTGGTTGGAGTTGGCAGGG + Intronic
1072740092 10:97904046-97904068 GAGTGTTTGTGGAGTGTGCAGGG - Intronic
1072740253 10:97904851-97904873 GAGTGTTTGTGGAGTGTGCAGGG - Intronic
1073047759 10:100650905-100650927 CAGTGTGGTGGGATTGGTCAAGG - Intergenic
1073640169 10:105244471-105244493 CAGTGGGATTGGAGTATGCATGG + Intronic
1076519064 10:131068478-131068500 CCGTGTTGTAGGAGGGTGCAAGG + Intergenic
1077536377 11:3126739-3126761 CACTGTGGGAGGAGTGTGCCAGG + Intronic
1078211029 11:9269624-9269646 GAGTGTGCCTGGAGTGTTCATGG + Intergenic
1078480940 11:11674738-11674760 CTGTCTGCTTGGAATGTGCAAGG + Intergenic
1078509595 11:11975639-11975661 CAGTGTGGGTGAAGTGGCCAAGG + Intronic
1078895074 11:15590837-15590859 CAGTGTGGCTGGAGTGGGTAGGG - Intergenic
1079006498 11:16794844-16794866 CAGGGTGGTGGGAGGGTGGAAGG - Intronic
1079153693 11:17924582-17924604 CACTGTGGTGGCAGTGTGGAGGG + Intronic
1079631406 11:22681580-22681602 CATTGTGGTTGGTGTTTGTAGGG - Intronic
1081775721 11:45674814-45674836 CAGTGAGGTGGGGGTGGGCAGGG + Intergenic
1083651196 11:64205884-64205906 CACTGGGGTTGGAGCATGCAGGG - Intergenic
1083764641 11:64836050-64836072 CAGTGTGCCTGGAGGGAGCATGG - Intronic
1084525571 11:69695859-69695881 CCCTGTGGTTCTAGTGTGCAGGG - Intergenic
1084579084 11:70011251-70011273 GAGTTTGGCTGGAGTGAGCAGGG + Intergenic
1084773014 11:71356671-71356693 CAGTGGGGTAGGGGTGGGCATGG + Intergenic
1085042847 11:73336777-73336799 CAGTGTGGTCGGATAGTGCTGGG + Intronic
1085278298 11:75314060-75314082 CAGTGTGGCTGGAGGGTGTGTGG - Intronic
1085851861 11:80130039-80130061 CAGGGTGGTTGTAGAGTGTATGG + Intergenic
1086857527 11:91883343-91883365 CAGAGTAGTTGGTGTGTTCATGG - Intergenic
1087211675 11:95451246-95451268 CAGAGTGGTTGGCATCTGCAAGG - Intergenic
1087366903 11:97231721-97231743 CAGTGTTGTGGAAGTGTGGAGGG + Intergenic
1087642027 11:100765287-100765309 CAGTTTGGATTGAGTGTGTAGGG - Intronic
1088285703 11:108185207-108185229 ATGGGTGGTTGGGGTGTGCATGG - Intronic
1088615641 11:111624976-111624998 CAGTGTGCTTGGTGTGTCCAAGG + Intronic
1089269925 11:117295088-117295110 CAGTGTGCATAGAGTGTGTAGGG + Intronic
1089455797 11:118625117-118625139 AAGTGTGGCTGAAGTGAGCAAGG - Intronic
1089751208 11:120652517-120652539 CAGCCTGGATGGAGTGTGCAGGG - Intronic
1090245093 11:125210473-125210495 CAGTGTTGGATGAGTGTGCATGG + Intronic
1091168510 11:133501099-133501121 CAGTGTGGGTGGTGGGAGCAGGG - Intronic
1091222789 11:133939109-133939131 CAGTGTGGTTGGAGTGCGCTGGG - Intronic
1093251441 12:16809151-16809173 AAGTGTGGTTGGATTGTGATAGG - Intergenic
1094216129 12:27944671-27944693 CAGTGAGGTAGGTGTGTGCTTGG - Intergenic
1094372739 12:29755749-29755771 CACGGTGTTTGGAGTGTGCTTGG - Exonic
1095585907 12:43848883-43848905 CAGTCTGGGAGGAGTGGGCAGGG + Intronic
1097801034 12:63914271-63914293 CACTGTGGTTGGAATTTGGAAGG - Intronic
1097956794 12:65494957-65494979 CAGGGAGGCTGGAGTGTGCCTGG + Intergenic
1098777657 12:74641733-74641755 CAGTGGTGTTGGTGTGGGCATGG - Intergenic
1101576517 12:106002037-106002059 CAGGGTGGTTGGAGTGAGCAAGG + Intergenic
1101623694 12:106417309-106417331 CAGTGTGGCTGGAGTGAGTGAGG + Intronic
1102729668 12:115097203-115097225 CTGAGTGGTTGGGGGGTGCAGGG - Intergenic
1102955766 12:117057832-117057854 CATTGTGGTTGCAGTGAGCCAGG - Intronic
1104371598 12:128228508-128228530 CAGTGTGGTAGGAGTGAGGGAGG + Intergenic
1104546069 12:129714057-129714079 CAGTGTGGTTGGAGGGAGGTAGG - Intronic
1104984132 12:132587143-132587165 CAGTGCGGCTGGAGGGTGGACGG + Intergenic
1105202337 13:18191135-18191157 CAGTGAGGTTGGAGTGGGTGGGG + Intergenic
1106114308 13:26803783-26803805 CAGAGTGGTTGGAATTTCCAGGG + Intergenic
1107329841 13:39287290-39287312 CAGTGTTATTGGTGTGTTCAGGG - Intergenic
1107809475 13:44186462-44186484 CAGCGTGGTTGGAGGGTGGCTGG - Intergenic
1112613447 13:100978727-100978749 CAGTGTTGTGGGAATGTACAAGG + Intergenic
1112648274 13:101360638-101360660 GAGTGTGGTTGGAGTCGTCAGGG - Intronic
1113939792 13:114012656-114012678 CAGTGTGTGGGGAGTGTGGAAGG - Intronic
1115459997 14:33649879-33649901 CAGAGTGGTTGTAGTGTGGAAGG + Intronic
1116335515 14:43651575-43651597 CAGTGCTGTTGGGGTGAGCATGG + Intergenic
1116735138 14:48679787-48679809 CAGTTTGGGTGGAGTTTGAAAGG - Intergenic
1117539937 14:56737177-56737199 CAGTATGGTTGGAGTGTGGCAGG - Intergenic
1118351701 14:64976810-64976832 CAGTGTGGCTGGGGTGGGGATGG - Intronic
1118734613 14:68692302-68692324 CAGTGAGGCTGGAGTCTGCTTGG - Intronic
1119877695 14:78074739-78074761 CAGTGTGCTTGGTGTCTGCAAGG + Intergenic
1120232203 14:81851978-81852000 AAGTTTTGTTGTAGTGTGCATGG + Intergenic
1120490228 14:85168778-85168800 CTGTGGGGTTGGCGGGTGCAGGG - Intergenic
1120764965 14:88320708-88320730 CAGGGTGGTTGCTGTGGGCATGG - Intronic
1121579724 14:95019481-95019503 TAGTGTGGAGGGTGTGTGCAAGG + Intergenic
1122027694 14:98889464-98889486 CAGTGGGGCTGGAGTGTAGAGGG + Intergenic
1122500602 14:102196525-102196547 GAGTGTGATTGGAGGGGGCAGGG + Intronic
1123106615 14:105844788-105844810 GGGTGGGGGTGGAGTGTGCAGGG + Intergenic
1124997262 15:34735911-34735933 CTGTGTGGATGGAGTTGGCAAGG - Intergenic
1125672363 15:41483293-41483315 CAGTGTGGTTTCAGTGTTGAAGG + Exonic
1128254210 15:66185213-66185235 CAGGGTGGGAGGAGGGTGCAGGG - Intronic
1128550630 15:68595998-68596020 CAGTGAGGTTTGAGTGTGGAGGG + Intronic
1128603218 15:69015344-69015366 CAGTGTGGTGGGCCTGTGCAAGG - Intronic
1131963638 15:97814655-97814677 AAGTGGGTTTGGAGGGTGCAAGG + Intergenic
1132376370 15:101330699-101330721 CAGTGAGGTTCCATTGTGCAAGG + Intronic
1133216251 16:4294194-4294216 CAGGGTGGTGGGGGTGTCCATGG + Intergenic
1133267177 16:4592155-4592177 AAGAGTGGTTGGAGACTGCAGGG + Intronic
1134069299 16:11250693-11250715 CAGGGTGGTTGGACAGTGGATGG - Intronic
1134292795 16:12916089-12916111 GAGTATTTTTGGAGTGTGCAGGG - Intronic
1136409408 16:30067381-30067403 CAGAATGGGTGGAGGGTGCAGGG + Intronic
1136590994 16:31217589-31217611 CAGAATGGTTGGTCTGTGCAGGG + Intronic
1136924317 16:34357827-34357849 CAGTGCTGTTGGTGTGTGAATGG - Intergenic
1136980256 16:35053979-35054001 CAGTGCTGTTGGTGTGTGAATGG + Intergenic
1137299458 16:47133720-47133742 CAGTGTGGTTGGCAAGTGGAAGG + Intronic
1137875179 16:51989873-51989895 CAGGGTGGCTGGGGTGTGCTGGG + Intergenic
1138069082 16:53972806-53972828 CAGTGTTTGTGGAGAGTGCAGGG + Intronic
1141575239 16:84959252-84959274 CAGTGTGTTTGGGGGGTGAATGG + Intergenic
1141745763 16:85925245-85925267 CAGTCTGGATGGAGTCTGCCAGG + Intergenic
1141886577 16:86896343-86896365 CAGTGTGCCTGCTGTGTGCACGG - Intergenic
1141980629 16:87547849-87547871 CAGGGTGTTTGGAGTGAGCATGG + Intergenic
1142431119 16:90027939-90027961 CAGGGTGGTAGGAGTGTGGAAGG + Intronic
1143210450 17:5183097-5183119 CAGTGTGGTAGGAATTTCCAGGG - Exonic
1143420053 17:6781684-6781706 CAGTGTACTTGGAGTATACAAGG - Intronic
1144011108 17:11149314-11149336 AAGTGTGGTTGATGAGTGCAAGG + Intergenic
1144073692 17:11698543-11698565 CAGTGTGGGTGGTGTTTCCATGG + Intronic
1144771559 17:17762372-17762394 CAGTGTGGTTGGAGTGTGCATGG + Intronic
1146719826 17:35116261-35116283 CAGTGGGGTAGAGGTGTGCAGGG - Intronic
1147650738 17:42060461-42060483 CAGTGTGCTGGGTGTGTGCAGGG - Intronic
1148033867 17:44643070-44643092 CAGTGTAGTTGGCTTCTGCATGG - Intergenic
1148241001 17:45999226-45999248 CAGTGTGGTCAGAGTTTACAGGG - Intronic
1149444855 17:56705533-56705555 CAGTCTGGCTGCAGTGTGAAGGG - Intergenic
1149613007 17:57971397-57971419 CAGGCTGGTTGGAGGGTGGAAGG - Intergenic
1151086793 17:71389533-71389555 CACTGTGGTAGGAGAGGGCAAGG - Intergenic
1151724247 17:75875365-75875387 CAGTGTGAGTGGAGGGGGCACGG + Intronic
1152574599 17:81134513-81134535 CAGTGTGGTGAGAGTGGCCATGG + Intronic
1153777476 18:8466637-8466659 CAGTGTGGATGTGGCGTGCATGG - Intergenic
1153798045 18:8642853-8642875 CTGTGTGGTTGCTTTGTGCAAGG + Intergenic
1154164824 18:12006798-12006820 CAGGGTGGTTACAGTGTGTATGG + Intronic
1155867739 18:30987406-30987428 CACTATGGTTGCATTGTGCATGG + Intergenic
1155869042 18:31002990-31003012 CAGTGTGGTGAGAGTGGACAAGG - Intronic
1155885932 18:31208025-31208047 CAGGGTGGTTGCAGTGGGAAGGG - Intergenic
1158392233 18:57053029-57053051 CAGTATGGCTGGAGTGTGCATGG - Intergenic
1158666203 18:59434910-59434932 CAGTGGGGCTGAAGTCTGCAAGG - Exonic
1159737547 18:72119417-72119439 CAGTGTGGTAGGACAGTGGAAGG - Intergenic
1159891960 18:73961402-73961424 CAGTGGGGTCAGAGTGTACAAGG + Intergenic
1160355650 18:78226350-78226372 CACTGTTGTTGCAGTGTGAACGG + Intergenic
1161649419 19:5475118-5475140 CAGTGTGGCTGGAGTGAGCTGGG + Intergenic
1162192886 19:8960894-8960916 AAGTGTGGTTGATGTGTCCAAGG + Exonic
1162312620 19:9915954-9915976 CAGTGTAGTTGGAGTGAGCCAGG + Intronic
1163188819 19:15660401-15660423 CAGTGTCTGTGGAGTTTGCAGGG - Exonic
1163598818 19:18235774-18235796 CAGTGTGGCTGGAGGGTGGGAGG - Intronic
1163720133 19:18894870-18894892 CCGTCTGGCTGGAGGGTGCAGGG - Intronic
1166328889 19:42067511-42067533 CAGAGTGGGAGGAGTGTGAAGGG + Intronic
1166516709 19:43452610-43452632 CAGTGTCATTGGAATGTGAAAGG + Intergenic
1168472330 19:56649734-56649756 CAGTGTGGCTGGAGGGTGGGAGG + Intronic
928748719 2:34446359-34446381 CAGTGTGGTGGGAATGTTCTAGG + Intergenic
929229719 2:39547045-39547067 CTGTGAGGGTGGAGTATGCAGGG - Intergenic
930633960 2:53785013-53785035 CAGTGTGGCTGGAGTGTAAGAGG - Intronic
931603341 2:64026588-64026610 CAGTCTGGATGCAGTGTGAATGG - Intergenic
932314346 2:70769490-70769512 GAGTGTGGAAGGAGGGTGCAGGG - Intergenic
934935002 2:98459031-98459053 CAGTGTGATTGGAGCATTCATGG + Intronic
937787712 2:125921916-125921938 CAGTGGGGTTGGAGTGGGTATGG - Intergenic
938967782 2:136403988-136404010 CAGTTTGGATGGAGGGTGGATGG - Intergenic
939012170 2:136859624-136859646 TGGTGTGGCTGGTGTGTGCAAGG + Intronic
939172155 2:138708917-138708939 CAGACTGGTTTGTGTGTGCATGG - Intronic
940845493 2:158637491-158637513 CAAAGTGGTTAGAATGTGCAAGG - Intronic
942681980 2:178486319-178486341 GTGTGTGGTTGGAGTGTGTGGGG + Intronic
942743583 2:179206850-179206872 CAGTGTGGTTGGTGGGGGCAAGG + Intronic
943070485 2:183135342-183135364 CAGTGTGTCTGGGGTGTTCAAGG + Intronic
944791899 2:203139452-203139474 CAGGGAGGTTGGAGTGTGTCTGG + Intronic
945297327 2:208183559-208183581 CAGTGTGGTGGGAATTTGGAGGG + Intronic
946904789 2:224405824-224405846 CAGGGTGGTTGTGTTGTGCATGG + Intergenic
1168792708 20:590622-590644 CAGTGTGATTGGAGAGAGGATGG + Intergenic
1168997665 20:2145116-2145138 GAGTGTCGCTGGAGAGTGCAAGG - Exonic
1170226245 20:13995043-13995065 CAGGGCAGTTGGAGTGAGCACGG + Intronic
1170693742 20:18638583-18638605 CAGTGTGGCTGGAGCTTGGAGGG + Intronic
1170724069 20:18910352-18910374 CACTGAGGTGGGAGTGTGCTTGG + Intergenic
1170789176 20:19493806-19493828 CAGTGTTTCTGGAGTGTGGAGGG - Intronic
1172782776 20:37447135-37447157 CAGTGTGTGTGGTGTGTGAAAGG + Intergenic
1172971551 20:38876623-38876645 CATTTTGTTTGGAGAGTGCAGGG - Intronic
1174160929 20:48549899-48549921 CCATGTGGTAGGAGTGTGCCTGG - Intergenic
1174618575 20:51856020-51856042 CAGTGGGGGTGGGGTCTGCAAGG + Intergenic
1174727249 20:52876078-52876100 CAGTGTGGTTGGAGTAGGGATGG + Intergenic
1176095095 20:63337831-63337853 CAGTGTGGCTGGTGTGTGGGAGG + Intergenic
1176715615 21:10346873-10346895 CAGTGAGGTTGGAGTGGGTGGGG - Intergenic
1178043817 21:28671593-28671615 CAGTGTGGTAGGAGTGGGGTGGG + Intergenic
1179942816 21:44650740-44650762 CAGTGAGGGTGGAGAGTCCAGGG + Intronic
1180602732 22:17033080-17033102 CAGTGAGGTTGGAGTGGGTGGGG + Intergenic
1182279451 22:29209370-29209392 CAGTGGGGTTGGTGAGGGCAGGG - Intronic
1182585324 22:31341494-31341516 GAGTGTTGCTGGAGTGTGCTGGG + Intronic
1182683399 22:32100925-32100947 CAGTGTGGTTGGTGCTTGCCTGG + Intronic
1183090139 22:35516741-35516763 CTGTGTTGTGGGAGTGGGCAGGG - Intergenic
1183167402 22:36158271-36158293 CACTGTTGATGGAGTGTGAAAGG + Intronic
1184271365 22:43386156-43386178 CAAGGTGGTTGGTGTGTGCACGG + Intergenic
1185052585 22:48561650-48561672 CAGTGGGGTTGGGGGGTCCAAGG - Intronic
950139890 3:10608196-10608218 CAGTGTGGATGGAGTGAGGAGGG - Intronic
950475015 3:13209623-13209645 CAGTGTGGTCCGAGAGGGCACGG - Intergenic
950713532 3:14831182-14831204 CAGTGTGGGTGGAGTGCAGAAGG + Intronic
952228047 3:31399433-31399455 CAGTGTAGTTGGGGTGTGAATGG - Intergenic
952288161 3:31988183-31988205 CATTGTGTTTTGAGTGTGAAGGG + Intronic
952486644 3:33818424-33818446 CAGTGTGGCAGGAGAGAGCAAGG - Intronic
953983989 3:47427451-47427473 GAGTGTGGCTGAAGTCTGCAGGG + Exonic
954363644 3:50135094-50135116 CAGTGTGGCTGGCTTGTGCTTGG + Intergenic
954456528 3:50602669-50602691 CAGAGTGGTTGGAGAGTGGCTGG - Intergenic
956410583 3:68974275-68974297 CAGTGTGGCTGGTGTGATCAAGG - Intergenic
957268250 3:77995621-77995643 AAATGTGGTTGGAGTGTTGAGGG - Intergenic
957603493 3:82369065-82369087 CAGTTTTGTTGCAGTGTGGACGG + Intergenic
957986784 3:87582305-87582327 CAGGGTGGTTGGAGTTTCCTTGG - Intergenic
959095985 3:101956427-101956449 CAGTGAGGTTGGAATATGAAGGG - Intergenic
959365289 3:105450679-105450701 CAGAATAGATGGAGTGTGCAAGG + Intronic
961388761 3:126539526-126539548 CGGTGTGTGTGGTGTGTGCATGG - Intronic
961461760 3:127054841-127054863 AAGTGGAGTTGGAGTGTTCAAGG - Intergenic
961961040 3:130855394-130855416 CCGTGGGGTTGGAGGGTTCACGG + Intronic
962887387 3:139640057-139640079 CAGTGAGGTGGGACAGTGCATGG + Intronic
962985731 3:140534190-140534212 CAGGCTGGTTGGAGTGTGTCTGG - Intronic
968947083 4:3670778-3670800 CAGTGTGTCCGGAGCGTGCAGGG + Intergenic
969567571 4:7987811-7987833 AAGTGGGGATGGGGTGTGCAAGG + Intronic
969703031 4:8778056-8778078 CAGTGTGATTGGAAAGTGAATGG + Intergenic
970156837 4:13150388-13150410 CAGTGTGACTGGACCGTGCATGG + Intergenic
970315475 4:14824965-14824987 CAGTGTGGCATGAGTGAGCAGGG + Intergenic
970519282 4:16865831-16865853 GAATGTGTTTGGAGTGTCCATGG - Intronic
974084198 4:57242179-57242201 CAGTGTGATTGGAATGGGGAAGG + Intergenic
975240654 4:72054260-72054282 CAGTGTTGTTGGTGTAAGCACGG + Intronic
975321092 4:73011245-73011267 CACTGTTGTTGGGGTGGGCATGG - Intergenic
975547137 4:75571347-75571369 CAGTGTGTCTGGAGTGGGAAAGG - Intergenic
978457070 4:108906216-108906238 CAGTGTGGCTGGAGTATGTGAGG - Intronic
982166456 4:152617875-152617897 CAGTGTGGCCTGAGAGTGCAAGG - Intergenic
983344309 4:166507057-166507079 CACTGTGGCTTGAGTGGGCAAGG + Intergenic
984153458 4:176164029-176164051 CAGGGTGGTGTGTGTGTGCATGG - Intronic
984836701 4:184028961-184028983 CAAAGTGGTTGGAGTGTGTATGG + Intergenic
985849121 5:2375574-2375596 CAGTGGGGTTGGGGTGTTCTGGG + Intergenic
988437706 5:31194704-31194726 GAGAGTGGTTGGAGTGCGCTTGG + Intronic
989201843 5:38771813-38771835 CAGTGGGGCTGCAGTTTGCATGG - Intergenic
991565802 5:68003141-68003163 CACTGTGGTTGCAGTGTGGCTGG + Intergenic
992441485 5:76801274-76801296 CTGTGTGGCTGGAGAGAGCATGG + Intergenic
995833293 5:116376897-116376919 CTGTGTGGGTGGGGTGTGGATGG + Intronic
996434606 5:123421065-123421087 CAGTTTAGTAGCAGTGTGCAAGG - Intronic
997358702 5:133280769-133280791 CAGCGTGGCTGGAATGTGGAGGG - Intronic
997643641 5:135466171-135466193 CAGAGCGGTTGGAGAGTGAATGG + Intergenic
998163356 5:139826107-139826129 CACTGGGGTTGGAGTGGTCATGG + Intronic
999955774 5:156700019-156700041 CAATCTGGTTGGAATGTGGAGGG + Intronic
1002073937 5:176697051-176697073 CTGTGTGGTGGGAGTGAGCATGG - Intergenic
1004086107 6:12451193-12451215 AAGTGTGGCTGGAGAGGGCAGGG + Intergenic
1004644135 6:17543293-17543315 CAGAGTGGATGGTCTGTGCAAGG - Intronic
1005122323 6:22403296-22403318 CAGTGTCCTTGGAGGGTGGAAGG - Intergenic
1005250418 6:23939734-23939756 CAGTGTGGTCTGAGTGTGGTTGG - Intergenic
1005430637 6:25753303-25753325 CAGTAAGGTTGGTGTGTCCAAGG + Intergenic
1006610437 6:35291414-35291436 GAATGGGGTTGGAGTGGGCAGGG - Intronic
1006929388 6:37678592-37678614 CAATGTGGCTGGAGTGGGGAGGG - Intronic
1007657985 6:43464143-43464165 GAGTGAGGTAGGAGTGTGCAGGG - Intergenic
1008139318 6:47813615-47813637 CAGTCTGGTGGCAGTGTGGAAGG + Intronic
1011399988 6:86950393-86950415 CAGTGTGGTGGGAAGGTCCATGG + Intronic
1015154554 6:130077688-130077710 CAGTGTGGCTGGAGTTTCCAGGG - Intronic
1015814998 6:137200375-137200397 CATTATGGTTGGAGTATGAAAGG - Intronic
1016439276 6:144066879-144066901 TTGTGGGGTGGGAGTGTGCATGG - Intergenic
1018299809 6:162389175-162389197 CAGTGAGGGTGGTGTGCGCAGGG + Intronic
1023529414 7:41137037-41137059 CAGTGGGGTTGGTGTGACCAGGG - Intergenic
1023706451 7:42946437-42946459 CAGTGTGCTGTGTGTGTGCATGG + Intronic
1023874791 7:44281112-44281134 CCGCGTGGTTGCTGTGTGCACGG - Intronic
1024282054 7:47726494-47726516 CATTCTGGCTGGAGGGTGCAGGG + Intronic
1024673314 7:51616177-51616199 CGGTGTGGTGGGAGTGTGAAAGG + Intergenic
1024985922 7:55193112-55193134 AAGTTTGGTTGGACTTTGCAGGG - Intronic
1026973002 7:74479308-74479330 CTGCATGGCTGGAGTGTGCAGGG - Intronic
1032254192 7:130284123-130284145 CAGTGTGGATGGAGTGATGAGGG + Intronic
1032885980 7:136138786-136138808 CATTGTGCTGGGAGTGTGGATGG + Intergenic
1032983658 7:137313895-137313917 CAGTCTAGTTGGTCTGTGCATGG - Intronic
1033437484 7:141346605-141346627 CAGTGTGTGTGGAGTGTGTATGG - Intronic
1034359611 7:150482655-150482677 CATTATGGTTGCAGTGTGAAAGG - Intergenic
1034379228 7:150675410-150675432 CATTATGGTTGCAGTGTGAAAGG - Intergenic
1034758965 7:153653042-153653064 CACTCTGGTGGGAGTGTGAATGG + Intergenic
1035282393 7:157786165-157786187 CCGTGTGGTTTGTGTGAGCAGGG - Intronic
1035379928 7:158431364-158431386 CAGTGTGCCTGGTGTGTGCCTGG - Intronic
1037102753 8:15067238-15067260 CAGGGTGGGTGTAGTGTGCAGGG - Intronic
1037623786 8:20590265-20590287 CAGGCTGGTTGGAGTTTGTAAGG - Intergenic
1037911692 8:22747567-22747589 CAGGGTGAGTGGGGTGTGCATGG + Intronic
1039050227 8:33485726-33485748 CAGTGTGCTTACAGTGTGCCAGG + Intronic
1039742912 8:40398429-40398451 CAGTGTGGTGGCAGAGTGCTAGG + Intergenic
1040102282 8:43516389-43516411 TAGGGTGGTGGGAGTGTGGAGGG + Intergenic
1040478893 8:47805865-47805887 GAGTGGGGTGGGAGTGAGCAGGG - Intronic
1041620855 8:59967206-59967228 GAGTGTGGGGTGAGTGTGCATGG - Intergenic
1041706608 8:60852988-60853010 CAGAGTGGTGGGAGTGTGGACGG + Exonic
1046417191 8:113933107-113933129 CAGTGTGGTTAGAGGGTGTGTGG - Intergenic
1048107861 8:131430967-131430989 CAGTGAGGTTGGAGGGTGGGAGG - Intergenic
1049466625 8:142753895-142753917 AGGTGGGGGTGGAGTGTGCAGGG + Intergenic
1051273162 9:15374685-15374707 CAGTGCGGTTGGTGGGAGCATGG + Intergenic
1051411028 9:16789462-16789484 GAGTGTTGTTGAAGTGTGTAGGG - Intronic
1052831741 9:33221404-33221426 CAGTGTGCCTGGAGGGTTCAGGG - Intronic
1057906698 9:98988972-98988994 CAGCGTGTGTGCAGTGTGCATGG - Intronic
1058007654 9:99935899-99935921 CAGTGTGGCTAGTGTGAGCAAGG + Intronic
1058806743 9:108600224-108600246 CAGTGTGCAAGAAGTGTGCATGG + Intergenic
1059567560 9:115398302-115398324 CAGTGTGGTTGGCATGGGAAGGG - Intronic
1060179725 9:121525491-121525513 CAATGTGGGTGAAGGGTGCATGG - Intergenic
1060280510 9:122213005-122213027 CAGTGTGATGGGAGTGTCCAGGG - Intronic
1061029180 9:128069156-128069178 CCGCGGGGTTGGAGTGTGGACGG + Intronic
1061135583 9:128731537-128731559 CAGAGTGGCTGGCATGTGCAGGG + Intronic
1061141303 9:128768814-128768836 ATATGTGGTTGGAGTGTGCGTGG - Intronic
1061203579 9:129150656-129150678 CACTGTGGTGGGAGTGGGGACGG + Intergenic
1061712359 9:132497184-132497206 GGGTGGGGTTGGAGGGTGCAGGG + Intronic
1061770471 9:132916293-132916315 CAGAGTGGTTGCAGTGGGGAGGG - Intronic
1061789490 9:133051616-133051638 CAGTGTGGCCGGAGTGTAGAGGG - Intronic
1062186628 9:135221900-135221922 CAGTGTGTCTGGAGGGAGCAAGG - Intergenic
1185447701 X:268172-268194 CAGTGTGGGTGGGGCCTGCAGGG + Intergenic
1186838275 X:13459435-13459457 GAGTGTTTTTGGAGTGTCCAGGG + Intergenic
1188703840 X:33301311-33301333 CTGTCTGTTTGGAGTGGGCAGGG - Intronic
1189752696 X:44238628-44238650 AAGTGTGCTTGGGATGTGCAAGG - Intronic
1190120184 X:47652647-47652669 CACTGAGGTGGGAGTGTGCCTGG + Intronic
1192234521 X:69287200-69287222 CAGAGTGGATGGAAAGTGCAAGG + Intergenic
1192609509 X:72553669-72553691 CTGTGGGATTTGAGTGTGCATGG - Intronic
1193022003 X:76801286-76801308 TAGTGTGCTTGGAGGGTCCATGG - Intergenic
1193423788 X:81316317-81316339 CCGTGTTGTTGGGGGGTGCACGG - Intergenic
1193698813 X:84739819-84739841 CAGGGTGGTTGGAGAGAGGAGGG - Intergenic
1194746745 X:97636590-97636612 GAGTGGAGTTGGAGTGTGCATGG - Intergenic
1195792895 X:108608156-108608178 CATTGTGGGTGGAGTGTAAATGG - Intronic
1196542628 X:116926942-116926964 AAGTTTTGTTGGAGTGTGGATGG + Intergenic
1196683613 X:118493313-118493335 CAGTGTGGCTGGAGCGTAGAAGG - Intergenic
1196764353 X:119229452-119229474 CATTATGGTTGGAGTGTTGAGGG + Intergenic
1197297042 X:124731503-124731525 TAGTGTGGTTGAAGTGTGACAGG + Intronic
1197960375 X:131998670-131998692 CAGTGTGGTTGCAAGGTGCAGGG - Intergenic
1199859125 X:151783936-151783958 CAGTATGGCTGGATAGTGCATGG + Intergenic
1200554518 Y:4618881-4618903 CACTGTGATTTGAGTGTGCTAGG - Intergenic