ID: 1144772094

View in Genome Browser
Species Human (GRCh38)
Location 17:17765657-17765679
Sequence CCGTTTCACAAGAGGGAAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 144}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144772087_1144772094 13 Left 1144772087 17:17765621-17765643 CCAGGTACACGTGTGAGGAATCT 0: 1
1: 0
2: 0
3: 1
4: 60
Right 1144772094 17:17765657-17765679 CCGTTTCACAAGAGGGAAGACGG 0: 1
1: 0
2: 0
3: 9
4: 144
1144772086_1144772094 16 Left 1144772086 17:17765618-17765640 CCACCAGGTACACGTGTGAGGAA 0: 1
1: 0
2: 1
3: 2
4: 77
Right 1144772094 17:17765657-17765679 CCGTTTCACAAGAGGGAAGACGG 0: 1
1: 0
2: 0
3: 9
4: 144
1144772088_1144772094 -10 Left 1144772088 17:17765644-17765666 CCCTGCAAGTCACCCGTTTCACA 0: 1
1: 0
2: 0
3: 6
4: 108
Right 1144772094 17:17765657-17765679 CCGTTTCACAAGAGGGAAGACGG 0: 1
1: 0
2: 0
3: 9
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144772094 Original CRISPR CCGTTTCACAAGAGGGAAGA CGG Intronic
900562061 1:3312121-3312143 CCATTTCACACGTGGGAAGGTGG - Intronic
905365031 1:37446248-37446270 CCTTTTCACAAGATGGCAGGAGG - Intergenic
908502838 1:64761369-64761391 CAGTTTCAAAAGAGGGAGAAGGG + Intronic
909206037 1:72759045-72759067 CCATTTCAAAAGAGGGAAGGAGG + Intergenic
911783446 1:101913185-101913207 GCCTTTCATGAGAGGGAAGATGG - Intronic
912263952 1:108136527-108136549 TTTTTTCACAAAAGGGAAGATGG - Exonic
912309502 1:108605739-108605761 CCTTTTCACATTAGGTAAGAGGG + Intronic
913502102 1:119480753-119480775 ACATTTCAAAAGAGGGCAGAAGG + Intergenic
914934787 1:151968827-151968849 CAACTTCTCAAGAGGGAAGAGGG + Intergenic
915171630 1:153982169-153982191 CCGTTTCCCTAGAGGGAGAAGGG + Exonic
918007164 1:180552581-180552603 CTCTTTCTCTAGAGGGAAGATGG - Intergenic
918894123 1:190317471-190317493 CCCTTTGGCAAGAGGGAAGAAGG - Intronic
920130935 1:203731333-203731355 CATTTTCCCAGGAGGGAAGATGG - Intronic
922723674 1:227912273-227912295 CTGTCTCAAAAAAGGGAAGAAGG - Intergenic
923149780 1:231222452-231222474 CATTTTTACAAGAGGGAATAGGG + Intergenic
924181727 1:241445791-241445813 CAGTTTCAAAAGAGGGACCAAGG + Intergenic
1063892950 10:10649069-10649091 CCGTTTCAAAAGGGGATAGATGG - Intergenic
1065270055 10:24020257-24020279 TAGTTTTACAAGAGGGAAGTTGG + Intronic
1069464044 10:68622265-68622287 CCTTGTCCAAAGAGGGAAGAGGG - Intronic
1069991972 10:72321608-72321630 CCATTTCACAAGTGGAAAAATGG - Intergenic
1072790245 10:98312524-98312546 CCATGCCACAAGTGGGAAGAGGG - Intergenic
1074151079 10:110760315-110760337 CCCTTTCCCAAGAAGGGAGAAGG - Intronic
1076299386 10:129413293-129413315 TCATCTCAGAAGAGGGAAGACGG + Intergenic
1078252262 11:9625947-9625969 CACTGTAACAAGAGGGAAGAAGG - Intergenic
1079513989 11:21245222-21245244 CTATTTCACAGCAGGGAAGAAGG - Intronic
1084714932 11:70867604-70867626 TCGATTCTCAAGAGGGAACATGG - Intronic
1085824107 11:79824904-79824926 ACGTCTCACAAGAGTCAAGAAGG - Intergenic
1086001268 11:81988342-81988364 CCTTTTCACAAGCTGGAATAAGG + Intergenic
1090377166 11:126298948-126298970 CCGTTGTTCCAGAGGGAAGAAGG - Intronic
1091228024 11:133969708-133969730 GGGTTTCACATGAGGGAAGGTGG - Intergenic
1091538769 12:1439810-1439832 CCTAATCTCAAGAGGGAAGAGGG - Intronic
1096871402 12:54594755-54594777 CAGACACACAAGAGGGAAGAAGG - Intergenic
1097991466 12:65839358-65839380 TCGTTTCTCAAGAAGGATGAGGG + Intronic
1099717367 12:86312526-86312548 CCGTTTTATAAGAGCGAAGCTGG - Intronic
1102774389 12:115506071-115506093 TCTTTTCACAAGAGGCAAAACGG - Intergenic
1102993293 12:117330000-117330022 ATGTTTCACAAGTGAGAAGACGG - Intronic
1103311300 12:120011119-120011141 CCGAGTCACAAGATGGAAGATGG - Intronic
1103985917 12:124767443-124767465 CCATTTCACAGATGGGAAGACGG - Intergenic
1104587422 12:130058497-130058519 GCATTTCACAGGAGGAAAGAGGG - Intergenic
1110304371 13:73968017-73968039 CTGTTTCACCATAGGGCAGAAGG - Intronic
1115887255 14:37986222-37986244 CCTTTTCCCCAGAGGGCAGAGGG + Intronic
1118011950 14:61618557-61618579 CAGTTTCAGAAGAGGCTAGAAGG - Intronic
1129331726 15:74831328-74831350 CAGCTTCACAGGAGGGGAGAAGG + Exonic
1129829148 15:78656596-78656618 TCGTTTCACAACAGGGATGTTGG + Intronic
1130059997 15:80562893-80562915 CCATTTCACCAGAAGGTAGACGG + Intronic
1131114117 15:89783733-89783755 GCTTCTCACAAGGGGGAAGAGGG + Intergenic
1135524180 16:23201268-23201290 CAGTTTGAAAAGGGGGAAGAGGG - Intronic
1140460819 16:75138333-75138355 ACGTTTAACAAGTGGGAAGTTGG - Intergenic
1140925115 16:79575217-79575239 CCACTTCACAATAGGGGAGAGGG - Intergenic
1141814240 16:86398779-86398801 CAGCTTCACAAGCAGGAAGAAGG - Intergenic
1142128245 16:88420797-88420819 CCATTTCACAGGTGGGAAAACGG + Intergenic
1142191715 16:88721199-88721221 ACGTTTTAGAAGAAGGAAGAAGG - Exonic
1143085941 17:4416207-4416229 CCATTTCACCAGACAGAAGAGGG - Intergenic
1144772094 17:17765657-17765679 CCGTTTCACAAGAGGGAAGACGG + Intronic
1145105036 17:20108024-20108046 CCTTTTAACAAGAGGGATGACGG - Intronic
1150026747 17:61683922-61683944 CCGTTTCAAAACAGAGAAGATGG - Exonic
1151734694 17:75931825-75931847 CCAGATCACAAGAGGGAGGAGGG + Intronic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1159025651 18:63180389-63180411 CCGTTTCACAAAGGAGGAGAAGG - Intronic
1162375859 19:10305032-10305054 CCGTTTCACCAGTGGGAGAATGG - Exonic
1163451177 19:17378400-17378422 CCGTCTCACAAAGGGGAAAAGGG - Intergenic
1168497831 19:56869127-56869149 CCTTCTGACAACAGGGAAGAAGG + Intergenic
926238284 2:11066399-11066421 CCGTTTCAAAAGACAGAAGGTGG + Intergenic
927197491 2:20558533-20558555 CCGTTTCTGAAGAGGGAAACTGG - Intergenic
927203733 2:20593958-20593980 CCATTTCAGAAGAGGGACGTGGG + Intronic
927211896 2:20644154-20644176 CCTTTTCACAAGAGGCCAAATGG + Intronic
927639222 2:24836280-24836302 CCGTAGAACAAGAGGGTAGATGG - Intronic
927715913 2:25352734-25352756 CTGCTTCTCCAGAGGGAAGAGGG + Intergenic
928144125 2:28756440-28756462 CTGTTTCACAAGAAAGAAAAGGG - Intronic
928669408 2:33585350-33585372 CCGTGGCAGAAGAGGCAAGATGG - Exonic
929195650 2:39181679-39181701 CCTTATAAGAAGAGGGAAGATGG + Intronic
931874263 2:66495306-66495328 TCTTTTGACAAGAGAGAAGACGG + Intronic
932257839 2:70302184-70302206 CCGGTTCCCAAGCGGGAGGAGGG - Intergenic
933076606 2:77935810-77935832 GTGTTTCAGAAGAGGGAGGATGG + Intergenic
937474526 2:122203132-122203154 CAGTTTCAATAGAGGGAAGGGGG + Intergenic
938085317 2:128396123-128396145 CCGTTTTACAGGAAGGAAGAAGG + Intergenic
940907910 2:159185252-159185274 CCCTTTCACAAAAGGGAAATGGG + Intronic
943741150 2:191410474-191410496 CCATTTTACAATAGGGATGAGGG - Intronic
944191621 2:197009985-197010007 CCCTTTAAAAAGAAGGAAGAAGG + Intronic
948547314 2:238742109-238742131 CAGATTCACAGGAGGGAAAATGG + Intergenic
948952862 2:241265814-241265836 CCCTTTCTAGAGAGGGAAGACGG - Intronic
1177189119 21:17830040-17830062 CCTATTCAGAAAAGGGAAGAAGG + Intergenic
1178917282 21:36713287-36713309 CCGTTTCCTTAGAGGAAAGAGGG + Intronic
1180877933 22:19183768-19183790 CCGTTTCACCAGTGGGCAGCAGG - Intronic
1185105189 22:48864956-48864978 ACCTGTCCCAAGAGGGAAGAAGG - Intergenic
952112566 3:30140954-30140976 TTGATTCACAAGAGGGAAGAAGG - Intergenic
953465221 3:43113994-43114016 CCTTTTCCCAAGAGGGAGGTGGG + Intergenic
955776270 3:62437149-62437171 ACGTTTCACAAGACAGAAGTAGG + Intronic
957449534 3:80360470-80360492 CCTTTTCAGAGGAGGGTAGAGGG + Intergenic
958863276 3:99469877-99469899 AGCTTTCACAAGAGGGAAGCAGG + Intergenic
962418718 3:135208118-135208140 CCCTGTGGCAAGAGGGAAGATGG + Intronic
964130249 3:153279009-153279031 CAGTTTCAAGAGAGGGAGGAGGG - Intergenic
966635524 3:182129059-182129081 CCATTTCACAGAAGGGAAAACGG - Intergenic
968346882 3:198015957-198015979 CAGTTTGGGAAGAGGGAAGATGG + Intronic
970907615 4:21235400-21235422 ATGTTTGACAAAAGGGAAGAAGG - Intronic
972603463 4:40592840-40592862 CAGTTTCACAAGAAGAAATAAGG - Intronic
981056427 4:140366868-140366890 GCGTTTGGCAAGAAGGAAGAAGG + Intronic
983279964 4:165667953-165667975 CAGATTCACCAGAGGGAAAAGGG + Intergenic
986046161 5:4040288-4040310 CCATTTCACAAAAGGGAGGTTGG - Intergenic
986269357 5:6217757-6217779 CCGCAGCATAAGAGGGAAGAAGG - Intergenic
986627498 5:9736389-9736411 CCACTTCACAAGAGAGCAGATGG - Intergenic
991503305 5:67299039-67299061 CCCTTAGACAAGAGGGTAGATGG + Intergenic
994742760 5:103642108-103642130 CCAGCTCACAAGAGGCAAGAAGG + Intergenic
995096653 5:108243640-108243662 CAGTTTGACAAAACGGAAGAAGG - Intronic
996490278 5:124086602-124086624 CAGTTTCCCAAGAAGGAGGAAGG - Intergenic
996744554 5:126835229-126835251 AAGGTTCATAAGAGGGAAGATGG + Intronic
997142480 5:131397524-131397546 CAGATTGAAAAGAGGGAAGAAGG - Intronic
997639207 5:135437586-135437608 CTGTTTCAGGGGAGGGAAGAGGG - Intergenic
998058850 5:139103334-139103356 CCTTTTAAAAAGAGGGAGGAAGG - Intronic
1000231849 5:159323089-159323111 CTGCTTCACAAAAAGGAAGATGG - Exonic
1000362278 5:160458864-160458886 ACATTTCACAAATGGGAAGAAGG - Intergenic
1003516968 6:6825737-6825759 CCATTTCACAGCAGGGAGGAGGG + Intergenic
1006931048 6:37688681-37688703 CCGTTTCACGAGAGCAGAGAGGG - Intronic
1006973087 6:38067367-38067389 CCATTTCACAGGTGTGAAGATGG + Intronic
1008204327 6:48635036-48635058 CCGTTTCCTAAGAGGGAAAGAGG + Intergenic
1008226259 6:48920427-48920449 CCGTTTCAAAAGAGGGAAATTGG - Intergenic
1011716029 6:90105998-90106020 GAGCTTCAGAAGAGGGAAGAAGG + Intronic
1011988145 6:93475979-93476001 CCATTTATCAAAAGGGAAGAAGG + Intergenic
1011988948 6:93487872-93487894 CCTTTTAACAAAAGGGCAGAAGG - Intergenic
1013879346 6:114876427-114876449 CTCTTTCACAAGAGAGAAGCTGG + Intergenic
1014848727 6:126313507-126313529 CAGTGTCAGAGGAGGGAAGAGGG - Intergenic
1015889786 6:137958876-137958898 CAGTTTTACAAGATGGAAGAAGG - Intergenic
1017794088 6:157825268-157825290 CCGTTTGAAAAAAGAGAAGACGG + Intronic
1019709115 7:2510317-2510339 CCATTTCACAGATGGGAAGATGG - Intergenic
1023127210 7:36966281-36966303 CCATTTCACAAATGGGAATACGG - Intronic
1027595384 7:80167364-80167386 CAGTGTCACAAAAGTGAAGATGG + Intronic
1027896180 7:84049039-84049061 TCTTTTCACAAAAGGTAAGAAGG + Intronic
1028747917 7:94348459-94348481 CCATTTCACAAGAGGCACAAAGG + Intergenic
1028780550 7:94730522-94730544 CACTTTCACAAAAAGGAAGAGGG + Intergenic
1029256304 7:99271996-99272018 CCATATAAAAAGAGGGAAGATGG - Intergenic
1030422169 7:109321193-109321215 CCCTTACAAAAGAGGCAAGAGGG - Intergenic
1032439055 7:131928053-131928075 CCATTCCACAGGAGGGAAGGAGG - Intergenic
1033545998 7:142400597-142400619 CCATTTTACAAAAGGAAAGAGGG - Intergenic
1035259448 7:157652379-157652401 CCGTCTCACAGGGGAGAAGAAGG + Intronic
1036489568 8:9212379-9212401 CCGTTTCACAGGTGAGAACATGG - Intergenic
1037758001 8:21723826-21723848 CCGCTGCACAAGCGGGATGAAGG - Intronic
1037945235 8:22985632-22985654 CCTTTTCCCAACAGGGAGGAAGG + Intronic
1039475208 8:37835904-37835926 CCTTTTCCCAACAGGGCAGAGGG + Intronic
1039867475 8:41517932-41517954 CCGTTTCCCAGGAGGGAGGGAGG + Intergenic
1046777859 8:118182864-118182886 CCTTTTCACCAAAGGGAATAGGG + Intergenic
1047192054 8:122687139-122687161 GCGTTTAAGTAGAGGGAAGAAGG - Intergenic
1047647686 8:126886163-126886185 GTGTTTAAGAAGAGGGAAGAAGG - Intergenic
1048260888 8:132944160-132944182 CAGCTTCACAGAAGGGAAGAGGG - Intronic
1053096178 9:35329855-35329877 CCATGGCAGAAGAGGGAAGAGGG + Intronic
1053151110 9:35743747-35743769 AAGCTTCAGAAGAGGGAAGAAGG + Intronic
1053558499 9:39163432-39163454 CCTTTTCAGAAGAGCGAAGTTGG - Intronic
1053822617 9:41983657-41983679 CCTTTTCAGAAGAGCGAAGTTGG - Intronic
1054138615 9:61455509-61455531 CCTTTTCAGAAGAGCGAAGTTGG + Intergenic
1054140709 9:61527310-61527332 CAGTTAGACAAGAGGAAAGAAGG - Intergenic
1055281046 9:74675112-74675134 CCATTTCAAAAGATGGAAGTTGG + Intronic
1062288273 9:135783312-135783334 CCAGCTCAGAAGAGGGAAGAGGG + Intronic
1192633887 X:72800470-72800492 GCATTTTAAAAGAGGGAAGAAGG - Intronic
1192647823 X:72920331-72920353 GCATTTTAAAAGAGGGAAGAAGG + Intronic
1197814643 X:130484667-130484689 CCTTTTCAGAAGAGGTAAAATGG - Intergenic