ID: 1144777493

View in Genome Browser
Species Human (GRCh38)
Location 17:17792059-17792081
Sequence CCTTCCGTGGCCGTGGCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 164}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144777477_1144777493 28 Left 1144777477 17:17792008-17792030 CCAGGAGGGGACAGGGCTGTGTC 0: 1
1: 0
2: 3
3: 55
4: 373
Right 1144777493 17:17792059-17792081 CCTTCCGTGGCCGTGGCCCTGGG 0: 1
1: 0
2: 0
3: 16
4: 164
1144777486_1144777493 3 Left 1144777486 17:17792033-17792055 CCCATGTGGGTGGGGCTGGGCTG 0: 1
1: 0
2: 4
3: 72
4: 435
Right 1144777493 17:17792059-17792081 CCTTCCGTGGCCGTGGCCCTGGG 0: 1
1: 0
2: 0
3: 16
4: 164
1144777487_1144777493 2 Left 1144777487 17:17792034-17792056 CCATGTGGGTGGGGCTGGGCTGT 0: 1
1: 0
2: 6
3: 69
4: 682
Right 1144777493 17:17792059-17792081 CCTTCCGTGGCCGTGGCCCTGGG 0: 1
1: 0
2: 0
3: 16
4: 164
1144777485_1144777493 4 Left 1144777485 17:17792032-17792054 CCCCATGTGGGTGGGGCTGGGCT 0: 1
1: 1
2: 3
3: 57
4: 896
Right 1144777493 17:17792059-17792081 CCTTCCGTGGCCGTGGCCCTGGG 0: 1
1: 0
2: 0
3: 16
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144777493 Original CRISPR CCTTCCGTGGCCGTGGCCCT GGG Intronic
900465868 1:2825194-2825216 CCTCACCTGGCCCTGGCCCTGGG - Intergenic
900533109 1:3164450-3164472 CTGTACGTGGCCATGGCCCTCGG - Intronic
900615099 1:3561971-3561993 CCCTCCGTGGCCGAGTTCCTGGG + Intronic
902896547 1:19484320-19484342 CCTTGTGAGGCCGTGGCCTTGGG - Intronic
903134888 1:21302904-21302926 CCTGCCGTGGCCCTGGGCCTGGG + Intronic
903968031 1:27101927-27101949 CCTGCCCTGCCCGTGCCCCTCGG - Intronic
906231592 1:44169370-44169392 CTGTCAGTGGCAGTGGCCCTGGG + Intergenic
907319153 1:53592035-53592057 CCTCCCATGGCCCTTGCCCTGGG - Intronic
907450699 1:54543928-54543950 CTTGCCGTGACCGTGGCTCTGGG - Intronic
908456762 1:64311810-64311832 CCTACCCTAGCCCTGGCCCTGGG + Intergenic
915001825 1:152600982-152601004 CCTGCCGTGGCCATGGCTCTGGG + Exonic
915473137 1:156137608-156137630 CCTTCCCTGGCCCTGACCCTTGG + Intronic
921697100 1:218224125-218224147 CTTTCAGTCTCCGTGGCCCTAGG + Intergenic
922607117 1:226896472-226896494 CCTTCTCTGGCTTTGGCCCTGGG + Intergenic
922774247 1:228207626-228207648 CCGTCCCTGGCTGTGGCCCCCGG + Intronic
1063010011 10:2012411-2012433 CCTGGGGTGGCCATGGCCCTGGG + Intergenic
1063998491 10:11643066-11643088 CCTTGCATGGCCCTGGGCCTGGG - Intergenic
1064665304 10:17644459-17644481 TCTTCCTTGGCCCTGGCCCGAGG - Intronic
1070436382 10:76397654-76397676 CCTTTCTTGGCAGTGGCCATGGG + Intronic
1070782999 10:79148264-79148286 CCTTACCTGGGCCTGGCCCTGGG - Intronic
1073204401 10:101761296-101761318 CCTTCAGGGGCCGGGGCCTTTGG + Intergenic
1076761229 10:132606747-132606769 GCCTCCGTGGCCGTGGGCATGGG - Intronic
1077037009 11:500114-500136 CCTTCCCTGGACGGGGCTCTGGG + Intronic
1077230120 11:1454975-1454997 CCTTGTGAGGCCATGGCCCTAGG + Intronic
1077440728 11:2567480-2567502 CTTGCTGTGGCCTTGGCCCTGGG + Intronic
1083160485 11:60851223-60851245 CCTTCAGTGACCCTGGCCTTTGG + Exonic
1083199678 11:61112765-61112787 CCTTTCGTGGCTGTTGCTCTAGG - Intronic
1083547206 11:63557946-63557968 CCTTCCTTGATCGGGGCCCTTGG + Intronic
1083672569 11:64307276-64307298 CCTCCTGTGGCCCTGGCCCCTGG + Exonic
1084327995 11:68412773-68412795 CCTTCAGTGACCTTGGCCCTAGG + Intronic
1084966588 11:72747762-72747784 GCCCCCGTGGCCCTGGCCCTGGG - Intronic
1087118624 11:94549336-94549358 CCTTCAGTGGGCCTGGACCTTGG - Exonic
1094838603 12:34333753-34333775 CCCTCCGTGGGCGTGAACCTGGG - Intergenic
1094855950 12:34402900-34402922 CCCTCCGTGGCCGTGAACCAAGG - Intergenic
1097708573 12:62894233-62894255 ACTTCCGTGGCAGAGGCCCCAGG + Intronic
1105344598 13:19561140-19561162 CCTCCTGTGGCCCTGGCCCCTGG - Intergenic
1105516394 13:21094701-21094723 CCTTCCTTGGCCATGGCGGTGGG + Intergenic
1105535440 13:21260433-21260455 CCTCCTGTGGCCCTGGCCCCTGG + Intergenic
1105642606 13:22280939-22280961 ACTGCCCTGGCCCTGGCCCTAGG - Intergenic
1107412700 13:40172473-40172495 GCCCCCGTGGCAGTGGCCCTCGG - Intergenic
1113765392 13:112877784-112877806 ACATCCGGGGGCGTGGCCCTCGG - Intronic
1117554399 14:56869808-56869830 CCATCCGTGGCCCTGGCATTGGG - Intergenic
1119629583 14:76216199-76216221 CCTTTCTTGACCTTGGCCCTGGG + Intronic
1125417301 15:39467100-39467122 CCTTCCCTGGGCCTGGGCCTGGG + Intergenic
1128334294 15:66776233-66776255 CCTTCCATGGCAGTGACCCTGGG + Intronic
1128792042 15:70440712-70440734 CCTGCCTTGGGCATGGCCCTGGG + Intergenic
1129606500 15:77027805-77027827 CCTCCCGAGGCCGCGGCCCTCGG + Intronic
1129729356 15:77921071-77921093 CCTTTCCTGGCTGTGGCCTTGGG - Intergenic
1132640501 16:976175-976197 CCATCCGTGGCCCAGGCACTGGG - Intronic
1133719449 16:8481169-8481191 CCTCCTGTGGCTGTGGTCCTAGG + Intergenic
1134440394 16:14296367-14296389 CCTTCTGTGGCGCAGGCCCTCGG - Intergenic
1135976221 16:27110318-27110340 CCAGGCGTGGCCCTGGCCCTTGG + Intergenic
1136186714 16:28592674-28592696 TCTTCCGTGCCTGTGGCCCTGGG + Intronic
1136189340 16:28606468-28606490 TCTTCTGTGACTGTGGCCCTGGG + Intronic
1136317696 16:29463932-29463954 TCTTCCATGACTGTGGCCCTGGG - Intronic
1136398430 16:30005264-30005286 CCTTCCCTGGCCGGGGTTCTGGG + Exonic
1136432271 16:30203277-30203299 TCTTCCATGACTGTGGCCCTGGG - Intronic
1136476608 16:30517555-30517577 CCTGCCCTGGCCCTGGCCCTGGG - Intronic
1139950445 16:70665685-70665707 CACTCAGCGGCCGTGGCCCTGGG - Intronic
1141934221 16:87226560-87226582 CCTTCCATGACCTTGTCCCTTGG - Intronic
1142161560 16:88560401-88560423 CCTTCCGTGGCCGTGGAGACGGG - Intergenic
1143134696 17:4705204-4705226 CCTTCCTCGGCCGTGGCGGTGGG + Intergenic
1143536189 17:7541433-7541455 CCTCCCTCGGCCTTGGCCCTGGG - Intergenic
1144756631 17:17683468-17683490 CTTTCCTGGGACGTGGCCCTCGG + Intronic
1144777493 17:17792059-17792081 CCTTCCGTGGCCGTGGCCCTGGG + Intronic
1147793756 17:43028535-43028557 CCTCCCTTGGCCGTGGCCATAGG + Exonic
1148029424 17:44609213-44609235 CCTTCCATGGCCTCAGCCCTTGG - Intergenic
1148090105 17:45018388-45018410 CCTTGCCTGGCTGTGGCCTTGGG + Intergenic
1148857471 17:50586571-50586593 CCTTCTGTGAGCTTGGCCCTGGG + Intronic
1150575856 17:66430366-66430388 TCTTCCGGAGCCATGGCCCTGGG - Intronic
1151559145 17:74861493-74861515 CCCTCCGGGGCCGAGGCTCTGGG - Intronic
1151740664 17:75979605-75979627 GCTTCCGGGTCCGTGCCCCTAGG + Intronic
1151808200 17:76419923-76419945 CATTCCTCGGCCATGGCCCTCGG + Intronic
1152799680 17:82324957-82324979 CCTGCCCTGGCCCTGGCCCTGGG - Intronic
1153146801 18:2042436-2042458 CCTTCCTTGTCTGTCGCCCTCGG - Intergenic
1154500906 18:14997536-14997558 CTTAGCGTGGCCGTGGCCGTGGG - Intergenic
1157328830 18:46688696-46688718 CCCTCCGTGGCAATGTCCCTGGG - Intronic
1159724582 18:71940284-71940306 CCTTCCCTGACCTTGACCCTTGG + Intergenic
1160235119 18:77079335-77079357 CCCACAGTGGCCGTGGCCATGGG - Intronic
1160862158 19:1242014-1242036 CCCTCCGTGGCCGCCGCCCCCGG + Intronic
1161990370 19:7681158-7681180 CCGTCCGTGGCGAGGGCCCTGGG - Intronic
1162743430 19:12786217-12786239 CCTCCCGTGTCCCTGCCCCTGGG - Intronic
1163214252 19:15864150-15864172 GCTTCTGTGCCCGTTGCCCTGGG + Intergenic
1163435386 19:17292351-17292373 CCTGCCTTGGCCGTGGCGTTGGG + Exonic
1163460697 19:17435822-17435844 CCAGCCGTGCCCCTGGCCCTGGG + Exonic
1163612773 19:18309730-18309752 GCCTCCGCGGCCGCGGCCCTTGG + Exonic
1164419658 19:28077789-28077811 CCTTCCCTGGGAGTGGGCCTGGG + Intergenic
1166303779 19:41926573-41926595 CCTCCCGTGGCTCTGGCCCTGGG + Intronic
1166339662 19:42129899-42129921 CCTTGCCTGGCTGTGGCCATGGG - Intronic
1167794921 19:51702961-51702983 CCTTCCAAGCCCGGGGCCCTTGG - Intergenic
1202649787 1_KI270706v1_random:169904-169926 CCTTCTGTGGCCCTGGCCAGAGG + Intergenic
925181681 2:1821633-1821655 CCTTCAGTGGCCGGAGTCCTTGG + Intronic
925249620 2:2421452-2421474 CCTGAGGTGGCAGTGGCCCTAGG - Intergenic
925731777 2:6924281-6924303 ACTTCCGTGGCCGTGTTGCTGGG + Intronic
927038526 2:19204898-19204920 ACTGCCATGGCCCTGGCCCTGGG - Intergenic
927552136 2:24010061-24010083 CCGCCCGCGGCCGTTGCCCTCGG - Exonic
927847613 2:26479594-26479616 CCTTCCGGGGCCGAGGCCGCTGG + Exonic
930931234 2:56886086-56886108 CCTTCTGGAGCAGTGGCCCTAGG - Intergenic
932004686 2:67916319-67916341 CCTTCCTTGGCCGTGGCTGGGGG - Intergenic
934650131 2:96085876-96085898 CATCCCTTGGCCCTGGCCCTTGG - Intergenic
935078565 2:99770250-99770272 CCTGTCGTGGTCGTGGCCTTGGG - Intronic
935658989 2:105449234-105449256 CCTTACGTGCCTGGGGCCCTGGG - Intergenic
937325724 2:120988748-120988770 CCCCGCGTGGCCGTGGCCATAGG - Exonic
947043376 2:225949597-225949619 CTTTCAGTGGCAGTGGCCTTAGG - Intergenic
947742926 2:232493072-232493094 CCCTCCGTGCCAGGGGCCCTTGG - Intergenic
948004008 2:234592391-234592413 CCTGGGGTGGCAGTGGCCCTTGG - Intergenic
948275337 2:236704062-236704084 CCTGCGGTGGCCCAGGCCCTGGG - Intergenic
948987159 2:241532714-241532736 CCCTCCGTTTCCGTGGCCCCTGG - Intergenic
949045618 2:241871532-241871554 GCTGCCTTGGCCGCGGCCCTGGG + Intronic
1168856409 20:1012451-1012473 CCTTCTCTGGCCTTGCCCCTAGG - Intergenic
1169309244 20:4521356-4521378 CCAACCATGGCCGTGGACCTGGG + Intergenic
1171881579 20:30621362-30621384 CCTTCTGTGGCCCTGGCCAGAGG - Intergenic
1175888527 20:62305773-62305795 CCTGCCGTGGCCCTGGGCCGCGG + Intronic
1176256727 20:64156857-64156879 CCTTCCAAGGTCATGGCCCTGGG + Intronic
1176602033 21:8802643-8802665 CCTTCTGTGGCCCTGGCCAGAGG - Intergenic
1178215491 21:30592714-30592736 CCTTCTGTGGCTGTGGCTATAGG + Exonic
1180135736 21:45860796-45860818 CCTCCCCTGAGCGTGGCCCTGGG + Intronic
1180344317 22:11694194-11694216 CCTTCTGTGGCCCTGGCCAGAGG - Intergenic
1181601452 22:23954183-23954205 CCTTCCTTGGCTCTGGTCCTTGG - Intergenic
1181607054 22:23987154-23987176 CCTTCCTTGGCTCTGGTCCTTGG + Intergenic
1182520737 22:30883267-30883289 CCTTGTGTGGAGGTGGCCCTGGG + Intronic
1183187508 22:36300423-36300445 CCTGCCTCGGCTGTGGCCCTGGG - Intronic
1183442290 22:37830080-37830102 CCCCCCATGGCCATGGCCCTGGG - Intergenic
1185030508 22:48440606-48440628 CCCTCCATGGCCCTGTCCCTGGG + Intergenic
1185248257 22:49785021-49785043 CCTTCAGTGAGCGTGGCCCATGG - Intronic
950163904 3:10779522-10779544 CCTTCAGTGACTGTGGCCCAAGG + Intergenic
952315889 3:32231894-32231916 CCTTACATGGGGGTGGCCCTGGG + Intergenic
954373465 3:50182424-50182446 CCTTCCGTGGCCATGTGTCTGGG + Intronic
954677394 3:52323451-52323473 CCTGCAGTGCCAGTGGCCCTTGG + Intronic
954987500 3:54808625-54808647 CCTTCAGTGTCCCTTGCCCTAGG - Intronic
955380342 3:58433521-58433543 CCTTCCGGCGCCGTGGGCCTTGG - Intronic
960974832 3:123163568-123163590 ACTTCCTTGGCAGTGGCCCCTGG + Intronic
962708987 3:138069960-138069982 CCTTCCCTTTCCCTGGCCCTGGG - Intronic
964663925 3:159151525-159151547 CCTCCTGTGGCTGTGGCCCTAGG + Intronic
968148272 3:196317954-196317976 CCTTCCGTGGCCCAGGTCCCAGG + Intronic
969417893 4:7073081-7073103 CCTTCCCTTGACGTTGCCCTTGG + Intergenic
972390120 4:38606285-38606307 CCTTCCTTGGCCCAGACCCTGGG + Intergenic
972646679 4:40974405-40974427 CCTTCTGTGTCCTTGGCCCTGGG - Intronic
973365358 4:49204450-49204472 CCTTCTGTGGCCCTGGCCAGAGG - Intergenic
973395233 4:49588004-49588026 CCTTCTGTGGCCCTGGCCAGAGG + Intergenic
985541304 5:488877-488899 CCCTCCCTGGCCGCGCCCCTGGG - Intronic
986939991 5:12937699-12937721 CCTTCCCTGGCCGTTCCCTTAGG - Intergenic
991605367 5:68395675-68395697 CCAGCCCTGGCCTTGGCCCTGGG + Intergenic
999104986 5:149063034-149063056 CCTACCCTGGCCGAGGCCCTTGG + Exonic
999773666 5:154793938-154793960 CCTTCCGTGGCCGTGGACGGGGG + Exonic
1001588968 5:172852589-172852611 CTTTCAGTGTCCTTGGCCCTGGG - Intronic
1006357869 6:33571378-33571400 CCTTCCTTGGGCGGGGCCTTTGG - Intergenic
1006446761 6:34084119-34084141 CCCTCCATGGCCTTGGCTCTAGG - Intronic
1007257150 6:40537359-40537381 CTTTCCCTGGTTGTGGCCCTGGG - Intronic
1010222735 6:73461862-73461884 ACTTCCGAGGCTGTGGCCGTTGG + Exonic
1015757318 6:136620574-136620596 CGTTCTGTGGCCGTGGTCATAGG - Intronic
1017891706 6:158644626-158644648 CCTTCCGCGGCCAGGGCTCTAGG + Intronic
1018544975 6:164925178-164925200 CCTTACATGGCAATGGCCCTAGG - Intergenic
1018900768 6:168050681-168050703 CTTGCCGTGGCCAAGGCCCTGGG + Intergenic
1019633160 7:2060680-2060702 GCTGCCATGGCCGTGGCCCGGGG - Intronic
1020021965 7:4874529-4874551 CCTTCTCTGGCTGTGGCCCAGGG - Intronic
1024041780 7:45561561-45561583 CCTCCTGTGCCCCTGGCCCTGGG - Intergenic
1027200748 7:76062540-76062562 TCTTCAGTGGCCATGGCCATCGG + Intronic
1027213031 7:76165698-76165720 CCCCCCGTGGCCATGGCCCCAGG + Intergenic
1027319600 7:77003575-77003597 CCCTCCATGGCCCTGGCCTTAGG - Intergenic
1029402736 7:100355832-100355854 CCTGCCTTGCCCGTGGCCCATGG - Intronic
1034573845 7:151980485-151980507 GCTTCCTTGGCCCTGTCCCTCGG + Intronic
1035375151 7:158402745-158402767 CCCTGCCTGGCCATGGCCCTTGG - Intronic
1035754953 8:2023944-2023966 CCCTCCTGGCCCGTGGCCCTGGG - Intergenic
1038498914 8:28027127-28027149 CCTTCCGTGGCTGGGGGACTGGG - Intronic
1038630186 8:29234736-29234758 CCTTTCCTGACCTTGGCCCTGGG - Intronic
1042038910 8:64571126-64571148 CCTTCCCTGACCCTGGCCATCGG + Intergenic
1042860412 8:73307627-73307649 CCTTCCCTGGCAGTGACCTTAGG - Intronic
1045065064 8:98437154-98437176 ACTTCCTCGGCTGTGGCCCTTGG - Intronic
1045252957 8:100496566-100496588 CCCACCGTGGCCATGGCCTTGGG + Intergenic
1050602515 9:7267105-7267127 CCTGGCCTGGCCGTGGCCTTTGG + Intergenic
1058795615 9:108495698-108495720 CCTTCCGTGGCCTGGTGCCTGGG + Intergenic
1061300794 9:129703889-129703911 CCTGCCGTGCCCCTGGCTCTGGG - Intronic
1061811910 9:133167209-133167231 GCTTCCCTGGCCGTGGAGCTGGG + Intergenic
1203787794 EBV:137304-137326 CTTTCCGCGGTGGTGGCCCTCGG - Intergenic
1185538578 X:883875-883897 CCGTCCGGGGCTGTGTCCCTGGG + Intergenic
1189001941 X:36957510-36957532 CCTACCGCGGCCCTGGCCCGCGG - Intergenic
1190900851 X:54671946-54671968 CCTGGAGTGGCCGTGGCCGTGGG - Intergenic
1193664634 X:84300458-84300480 CCTGAGGTGGCCGTGGCCATGGG + Intergenic
1200080809 X:153575505-153575527 CCTCCACTGGCTGTGGCCCTCGG - Intronic
1201344186 Y:12965155-12965177 CCTTCCTTGGCAGTGGCACATGG + Intergenic