ID: 1144778729

View in Genome Browser
Species Human (GRCh38)
Location 17:17797468-17797490
Sequence CCTGCCCTCCGGGGGCTGGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 578
Summary {0: 1, 1: 0, 2: 4, 3: 56, 4: 517}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144778729_1144778737 -2 Left 1144778729 17:17797468-17797490 CCTCCCAGCCCCCGGAGGGCAGG 0: 1
1: 0
2: 4
3: 56
4: 517
Right 1144778737 17:17797489-17797511 GGCCCTGCCAGCCCCAGACAAGG 0: 1
1: 2
2: 5
3: 52
4: 509
1144778729_1144778745 15 Left 1144778729 17:17797468-17797490 CCTCCCAGCCCCCGGAGGGCAGG 0: 1
1: 0
2: 4
3: 56
4: 517
Right 1144778745 17:17797506-17797528 ACAAGGGCACAGAAACAGCCAGG 0: 1
1: 0
2: 2
3: 24
4: 319
1144778729_1144778738 -1 Left 1144778729 17:17797468-17797490 CCTCCCAGCCCCCGGAGGGCAGG 0: 1
1: 0
2: 4
3: 56
4: 517
Right 1144778738 17:17797490-17797512 GCCCTGCCAGCCCCAGACAAGGG 0: 1
1: 0
2: 4
3: 49
4: 439

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144778729 Original CRISPR CCTGCCCTCCGGGGGCTGGG AGG (reversed) Exonic
900113871 1:1020495-1020517 CCCCCCCTCCCGGGGCTTGGCGG - Intronic
900145229 1:1156326-1156348 CCTGTGCTCCGGTGGCTGAGTGG + Intergenic
900205020 1:1427945-1427967 CCTGCCCTCCGTGGCGGGGGCGG - Intergenic
900284169 1:1891283-1891305 CCGGCCCTGCGGGGACCGGGCGG + Intergenic
900291930 1:1927338-1927360 TCTGCACCCGGGGGGCTGGGTGG + Intronic
900313319 1:2045049-2045071 CCTGGCCTCGGGGAGCTGCGCGG - Intergenic
900375734 1:2353763-2353785 CCTGCTGTCCCGGGGCAGGGAGG + Intronic
900464497 1:2818451-2818473 CCTGCCCTGCAGGGGCTGCAGGG + Intergenic
900488139 1:2933185-2933207 CCTGCCCTCTGGGGCCTCGGGGG + Intergenic
900551303 1:3257303-3257325 TCTGCCCACCTGGGGTTGGGTGG + Intronic
900660119 1:3777966-3777988 CCTCCCCTGCTGGGGCTGGCAGG - Intergenic
900925773 1:5705342-5705364 CCTCCCCTCCAGGGAATGGGTGG + Intergenic
901323911 1:8355922-8355944 CCTGCCCTCTGGGGGCTGTCTGG - Intronic
901436072 1:9248178-9248200 CACGCACTGCGGGGGCTGGGGGG - Intronic
901665915 1:10826062-10826084 CCTGCCCTCAGGAAGCTGTGGGG - Intergenic
901794678 1:11673447-11673469 CCTGCCATCCTGGCCCTGGGAGG - Intronic
902575103 1:17372636-17372658 GCTGGCCTCGGGGGGCTGTGAGG + Intronic
902697523 1:18150339-18150361 CCTTCCTTACGGAGGCTGGGAGG + Intronic
902704017 1:18191991-18192013 CCAGCCCTCCTGGGCCGGGGAGG + Intronic
903233869 1:21937346-21937368 CCGGCGCTGCGGGGGCGGGGCGG - Intergenic
903277831 1:22232983-22233005 CCTGTCCCCCAAGGGCTGGGGGG + Intergenic
903284968 1:22270971-22270993 CCTGCACACTGGGGGATGGGGGG + Intergenic
903774634 1:25784985-25785007 CCTACCCTACGGGGTCAGGGAGG + Exonic
903986889 1:27234971-27234993 CCTGCCCTCCGCGGGCGCCGAGG + Intronic
904442218 1:30539314-30539336 CCTGAACTCCAGGGGCCGGGGGG - Intergenic
904591556 1:31618063-31618085 CCTGCACCTCGGGGGCTGGCGGG - Intronic
904805323 1:33127358-33127380 CGCGCCCTCTGGCGGCTGGGAGG + Intergenic
905206195 1:36344091-36344113 CCTGCCTCCCGGGGGGTGGGGGG - Intronic
905478327 1:38244403-38244425 CCTGCCGTGCGGGGGAGGGGCGG - Intergenic
905889052 1:41508345-41508367 CCTGGCCTCCTGGGACTTGGAGG + Exonic
905889347 1:41509869-41509891 CCTGCCTGCTGGGGCCTGGGTGG + Exonic
905945492 1:41898110-41898132 CCTGCCCCCAGGATGCTGGGAGG - Intronic
906436832 1:45803643-45803665 CCTGCCCAACGTGTGCTGGGTGG + Exonic
907345965 1:53780453-53780475 CCTGCCCTCCGGGAGCTTACAGG - Intronic
907526747 1:55058188-55058210 CCTGCCCCATGGGTGCTGGGGGG - Exonic
912413605 1:109493984-109494006 AGCGCCCTCTGGGGGCTGGGGGG - Intergenic
912787460 1:112618877-112618899 CCAGACCTCCTGGGGCAGGGCGG - Intronic
912911010 1:113759206-113759228 GCCGCCCTCAGGGCGCTGGGCGG - Exonic
915713717 1:157925094-157925116 CCAGCCCTCAGGGGGCCAGGCGG + Intergenic
916501724 1:165393163-165393185 CCTCCCCTGGGGAGGCTGGGCGG + Intergenic
916530042 1:165648242-165648264 CTGCCCCTCCGGGGGCTGGGGGG - Intronic
916908568 1:169318075-169318097 CCTGTGCTCCATGGGCTGGGAGG + Intronic
917749066 1:178038009-178038031 TCCGCTCTCCCGGGGCTGGGCGG - Intergenic
917973710 1:180225237-180225259 CCTGCTCTCCCGGGGCTCTGTGG - Intergenic
919640252 1:200039335-200039357 GCTGCCCGCCGGGAGCTCGGCGG + Intronic
919992472 1:202718052-202718074 CCTGCCCTCAGGGGCCTGCTGGG - Intergenic
920065966 1:203269922-203269944 CCTGCCCACCGGCTGCTGTGAGG - Intronic
920501913 1:206490867-206490889 CCTGTCCTCCGGCAGGTGGGTGG + Intronic
922731992 1:227953468-227953490 CCTGCTCTCCGAGGCCTTGGTGG - Intergenic
922740122 1:228009822-228009844 CCTGCCTCCCCAGGGCTGGGTGG + Intronic
922966372 1:229694337-229694359 TCTGACCTCCAGGGGCTGGGCGG - Intergenic
923119654 1:230978584-230978606 CCCGCAGTCCGGGGACTGGGGGG - Exonic
1063022850 10:2146800-2146822 CCTGCCCTCCAGGTGATGGAGGG + Intergenic
1063418338 10:5890595-5890617 CCTGGCCTCGGGGGGCAGCGCGG - Intronic
1063660643 10:8033606-8033628 CCTGTACTCCAGGGGCTTGGGGG + Intergenic
1065588382 10:27241523-27241545 CCTGGCTCCCTGGGGCTGGGTGG - Intronic
1065800189 10:29344800-29344822 CCTGCCCTCCTGGGGGAGGTGGG + Intergenic
1066758183 10:38730801-38730823 TCTGCCCCACGGGGACTGGGGGG - Intergenic
1067944968 10:50683561-50683583 ACTGGCCTCTGGGGCCTGGGTGG - Intergenic
1068060763 10:52064654-52064676 CCTGTGCTCCTGGGGCTGGGAGG - Intronic
1068762929 10:60733142-60733164 CCTGCCCTCCTGGGGGTGCCAGG - Intronic
1070154944 10:73827568-73827590 GCTGTCCCCCGAGGGCTGGGTGG + Intronic
1070711913 10:78689137-78689159 GCTGCCCGCCGTGGGCTGTGTGG - Intergenic
1070866470 10:79710432-79710454 ACTGGCCTCTGGGGCCTGGGTGG - Exonic
1070880261 10:79848563-79848585 ACTGGCCTCTGGGGTCTGGGTGG - Exonic
1071493931 10:86154917-86154939 CCTGCCCTCCTGGGGTTGCTGGG - Intronic
1071600922 10:86958386-86958408 CGTGCCCTCCATGGGCTGGAGGG - Intronic
1071633380 10:87232653-87232675 ACTGGCCTCTGGGGCCTGGGTGG - Exonic
1071646829 10:87364871-87364893 ACTGGCCTCTGGGGCCTGGGTGG - Exonic
1071902034 10:90131227-90131249 CCTTCCCTCCGGGGGTTAGGAGG - Intergenic
1071941325 10:90594735-90594757 CCTGCTCTCCTGAAGCTGGGGGG - Intergenic
1072059717 10:91798381-91798403 CGTGCGCTCCCGGGGCTGGACGG + Exonic
1072782104 10:98258128-98258150 CCTGCGCTCCGGGGCCCAGGTGG - Exonic
1074291072 10:112138376-112138398 CCTGCCCTCGAGGAGTTGGGAGG + Intergenic
1074960603 10:118441984-118442006 CCTACCCTCCAGAGGCTCGGGGG + Intergenic
1075531881 10:123236649-123236671 GCTGCCCTCTTGGGGGTGGGAGG + Intergenic
1075689186 10:124384367-124384389 CCTGCCCTCCGAGGCTTGGCAGG - Intergenic
1075739194 10:124683551-124683573 CATGCACTCAGGGGGCTGTGTGG - Intronic
1075909055 10:126107767-126107789 GCTGCCCTCAAGGGGCAGGGCGG - Intronic
1076366234 10:129922492-129922514 CCTGCCCTCCAGGGGCTATGGGG - Intronic
1076470419 10:130714448-130714470 CCTGCCCTCCCTGGACAGGGTGG - Intergenic
1076612802 10:131737001-131737023 CCTGCCCTCCCGAGGCTCGGGGG + Intergenic
1076904360 10:133354869-133354891 CCTGCCCTCCTGCGGGTGGAAGG + Intergenic
1077001404 11:324830-324852 CCAGCCCTACGGGGGCTTAGCGG + Intronic
1077289421 11:1782050-1782072 CCTGCTCCCTGGGGCCTGGGGGG - Intergenic
1077550248 11:3197023-3197045 CCTGCCATCCAGGGACTGGCTGG - Intergenic
1077997947 11:7469929-7469951 CCTGCAATGCGGGGGGTGGGAGG + Intergenic
1078527240 11:12110484-12110506 CCGGCCCCACGGGGGCGGGGCGG + Intronic
1079244412 11:18742444-18742466 CCTGTCCTCAGGGGGCAGTGGGG + Exonic
1079695570 11:23478035-23478057 ACTGCCCTGAGGAGGCTGGGAGG + Intergenic
1081578357 11:44334007-44334029 CCTGCGCCCCTGGGGCGGGGCGG + Intergenic
1081860928 11:46333050-46333072 CCTGCGCTCCGGGGGGGCGGGGG - Intronic
1082812098 11:57484593-57484615 CCTGCCCTCCTGGCCCTGGAAGG + Exonic
1082934107 11:58638898-58638920 CTTGGCCTCCTGGGTCTGGGTGG + Intergenic
1083479452 11:62934237-62934259 CCTGCCCTTCCTGGGCTGGTAGG - Intergenic
1083572740 11:63768877-63768899 CCAGCTCGCGGGGGGCTGGGGGG + Intergenic
1083573129 11:63770321-63770343 CCTGCGCTCAGGGGGGCGGGGGG + Intergenic
1083596259 11:63919426-63919448 CCTGCCGCCCCGGGGCTGCGGGG + Intergenic
1084375338 11:68773115-68773137 CCCGGTCTCCGGGGGCCGGGTGG - Intronic
1084965394 11:72741801-72741823 CCTTCCCTCTTGGGGCAGGGTGG - Intronic
1085053747 11:73392554-73392576 CCTGGCCTCTGGGGTCTGAGAGG + Intronic
1085446161 11:76602587-76602609 CTGGGCCTCCTGGGGCTGGGTGG + Intergenic
1085524605 11:77157045-77157067 CCTGGCCTCAGGGGTCTGCGTGG + Intronic
1086110298 11:83192060-83192082 CCAGGCCTCCGGAGGGTGGGGGG - Intergenic
1086342082 11:85857208-85857230 CGTGCCCTTCGAGGGCTTGGAGG - Intronic
1087105171 11:94401179-94401201 CCGGCCCTCGTGGGGCTCGGTGG + Exonic
1089587000 11:119516137-119516159 CCTGCTCTCTGAGAGCTGGGGGG + Intergenic
1091763279 12:3101818-3101840 CCTGCTCCCTGGTGGCTGGGAGG + Intronic
1091843634 12:3638150-3638172 GCTGCCCTCGGGGGGATGTGGGG + Exonic
1092242150 12:6841631-6841653 CCTGCCTTCCGGGGGACAGGGGG - Intronic
1094427022 12:30326819-30326841 CCTGCCATCAGGTGGCTGGCTGG + Intergenic
1095473911 12:42565836-42565858 ACTGCCCTCTGGGAGCTGCGAGG + Intronic
1096478086 12:51920915-51920937 TCTGCCTGCAGGGGGCTGGGGGG + Exonic
1097030701 12:56087430-56087452 CCTGCTCTCCAAGGGCAGGGAGG + Intronic
1100655134 12:96635982-96636004 CCTCCCCTCCAGGAGGTGGGAGG + Intronic
1101340916 12:103841282-103841304 CCTGCCCTCCCGCCGCTGCGGGG + Intergenic
1101957355 12:109222992-109223014 CCTGCCCTCCAGGTGCTCAGTGG + Intronic
1102197137 12:111033926-111033948 CGCGCCCTCCGGGGGTCGGGGGG + Intergenic
1102478092 12:113201796-113201818 CCTGCACACTGGGGGCAGGGAGG + Intronic
1104031015 12:125065737-125065759 CCGGGCCTGCGGGGGATGGGCGG + Intronic
1104205157 12:126631875-126631897 CCTGCCCTCCTGGATCTGGTTGG - Intergenic
1104983273 12:132583237-132583259 GCCGCCCGCCGGGGGCTCGGAGG - Exonic
1104987265 12:132604027-132604049 CGTGCCCTGCGGGGCCTGGTGGG + Intronic
1105431359 13:20340324-20340346 CCTGCCCTCCAGCCCCTGGGAGG + Intergenic
1106110715 13:26774184-26774206 CCTGCCCTCCTGGGGCTCTTGGG + Intergenic
1113902255 13:113803827-113803849 CCCGCACCCCTGGGGCTGGGAGG - Intronic
1114065270 14:19054494-19054516 CCTGCCCTCCTGCTGCTGAGAGG + Intergenic
1114096992 14:19345508-19345530 CCTGCCCTCCTGCTGCTGAGAGG - Intergenic
1114252285 14:20971574-20971596 CCTGCCCTCTGCTGGCTGGAAGG + Intergenic
1115147331 14:30240348-30240370 CCTGCCCTCAGGGGGAGGCGGGG + Intergenic
1115755124 14:36521300-36521322 TCTGCGCGCCAGGGGCTGGGAGG + Intergenic
1117377493 14:55129443-55129465 TCTGCCCTCCAGGAGCGGGGCGG + Intronic
1119406755 14:74403808-74403830 CATGCCCTGCTTGGGCTGGGCGG - Intergenic
1120030089 14:79631423-79631445 CCTGCCCTCTGCTGGCGGGGAGG + Intronic
1120145324 14:80972777-80972799 CCTGGTTTCCAGGGGCTGGGAGG - Intronic
1121405130 14:93715265-93715287 CCTGCCCTCCAGGGGTAGGGTGG - Intergenic
1121449655 14:93999074-93999096 CCTCCCCTCTGGGGGCTGGTGGG + Intergenic
1121482825 14:94291662-94291684 CCTGCGCTCACTGGGCTGGGTGG - Intronic
1121629733 14:95413500-95413522 CCTGCCTTGCAGGGGATGGGAGG - Intronic
1121790119 14:96692890-96692912 CCTGCCCATCGGGGGCTCAGAGG - Intergenic
1122227285 14:100287061-100287083 CCAGCCCTCCTTGTGCTGGGTGG - Intergenic
1122339340 14:101018233-101018255 CCTGCCTTCCAGGGGCTCAGAGG - Intergenic
1122417729 14:101558309-101558331 CCGGCCCTCGGGGGCCTGGCAGG - Intergenic
1122549867 14:102544148-102544170 GCTGGCATCTGGGGGCTGGGTGG - Intergenic
1122634360 14:103123273-103123295 CCTGCCCAGCGGGGGATGCGGGG - Intergenic
1122887618 14:104717362-104717384 CCTGCCCGGGGGGGACTGGGAGG - Intronic
1123449552 15:20351321-20351343 CGTGCCCTCCGTGGGCTGGAGGG + Intergenic
1123687599 15:22810173-22810195 CCTGCCCTGCGTGGGATGGGTGG + Intronic
1124141111 15:27077937-27077959 CCTCCCCGCCGGGGGTTTGGGGG + Intronic
1125662063 15:41402326-41402348 CCTGGCCTCCGGAGGCTAGACGG + Exonic
1125674104 15:41493617-41493639 CCTGCCCTCGGGGAGGTGGGAGG - Intronic
1126183007 15:45804248-45804270 CGTGCCCTCTGGAGGCTTGGAGG + Intergenic
1127142729 15:55993752-55993774 CGCGCGCTCCTGGGGCTGGGCGG + Intergenic
1127396941 15:58550600-58550622 CCTACCCTCAGGGGGCTCGGTGG + Intronic
1128305895 15:66598755-66598777 ACTGCCCTCAGAGTGCTGGGAGG + Intronic
1128689762 15:69714554-69714576 CCTGCCCTCCGAGAGCTCGGCGG - Intergenic
1129205243 15:74033446-74033468 GCTGCCCGCCAGGGTCTGGGCGG + Intronic
1129689048 15:77702908-77702930 CCTGCCCTCCAGGAGCTGCTGGG - Intronic
1129723704 15:77891200-77891222 CCTGCCCACTGGGGACTTGGAGG - Intergenic
1129731316 15:77934261-77934283 CCTGCCCTCCTGATGCTGGTTGG - Intergenic
1129752864 15:78077816-78077838 CCCTGCCTCCGGGGGCTGAGGGG - Intronic
1129810767 15:78507928-78507950 CCAGCCCTCCCGGGTCTGTGTGG + Intronic
1130551900 15:84894831-84894853 CCTGCCCTCCACGCTCTGGGTGG + Intronic
1132056032 15:98650352-98650374 CCCGGCGTCCCGGGGCTGGGCGG + Intronic
1132465390 16:75204-75226 CCAGCACTCCCGGGGCTGGTGGG + Intronic
1132466269 16:78685-78707 CCAGCCCTCCGGGTGCTGCCAGG + Intronic
1132556101 16:573339-573361 CCTGCCCTGGGGTGGCTGTGGGG + Intronic
1132622661 16:875120-875142 CCTGACCTCCGAGGCCTGGAAGG + Intronic
1132672970 16:1109278-1109300 CCTGAAGGCCGGGGGCTGGGGGG + Intergenic
1132681092 16:1142032-1142054 CGTGCCTCCCTGGGGCTGGGCGG + Intergenic
1132710715 16:1265912-1265934 CCTGCCTCCCGGCAGCTGGGTGG - Intergenic
1132851878 16:2028491-2028513 CTTGCCCTCCTGGGGCAGTGGGG - Intronic
1132880994 16:2161641-2161663 CCTGCCCTCTGGGAGCAGGGAGG - Intronic
1132995440 16:2820138-2820160 TGTGCCCTGCGCGGGCTGGGAGG + Intronic
1133061773 16:3179531-3179553 CCTGACCTGCTGGGGTTGGGAGG + Intergenic
1133155125 16:3868932-3868954 TCTGCCCTGCGGGGGTTGGTCGG - Intronic
1133217064 16:4299068-4299090 CACTCCCTCCAGGGGCTGGGAGG - Intergenic
1133270674 16:4609602-4609624 CCTGGCCTCCGGGAGGGGGGAGG + Exonic
1133706338 16:8358432-8358454 CCTGCCCTCCCGGTTCAGGGTGG + Intergenic
1134061593 16:11202708-11202730 CCTGCCCCCTGGGGGAAGGGAGG + Intergenic
1136261729 16:29082077-29082099 CCCGCCTTCCGGGGCCGGGGAGG + Intergenic
1136278751 16:29194720-29194742 CCTGCCTGCTGGCGGCTGGGTGG - Intergenic
1136502635 16:30680517-30680539 CCTGCCCTCAGGGTGTAGGGTGG - Intergenic
1136532981 16:30882350-30882372 TCTGCCCTCCTGGGGCTTGCAGG + Intronic
1136533934 16:30888078-30888100 CCTCCCCTCCTGGGCCCGGGAGG + Intronic
1136566362 16:31073118-31073140 CCTGCCCTCCAGGGGCTGCCTGG - Intronic
1136886403 16:33932762-33932784 CCTGCCTTCTGGGGTCTTGGGGG - Intergenic
1137441855 16:48504763-48504785 CCTGCCCTGCGGAAGCTGGTGGG + Intergenic
1137547806 16:49416355-49416377 CCTCTCCTCCCAGGGCTGGGTGG - Intergenic
1137600301 16:49751944-49751966 CTTGCCCTCCCTGGGCTGTGGGG - Intronic
1138420066 16:56893081-56893103 CCTGCCCGGCGGGGGCGGGGTGG + Intronic
1138604746 16:58081532-58081554 GCTGCCCTCGCTGGGCTGGGTGG + Intergenic
1139511544 16:67431001-67431023 CCTGCCCTGCGGGGGGTGCCGGG + Intronic
1139583114 16:67884831-67884853 CCCTCCCTCCGGGGGCTGGGCGG + Exonic
1140475836 16:75238876-75238898 CCTGCCTTTGGGAGGCTGGGAGG - Intronic
1141610418 16:85178050-85178072 CCTGACCTCAGGGTGCTGGTGGG + Intronic
1141611811 16:85185849-85185871 AGGGCCCTGCGGGGGCTGGGAGG + Intergenic
1141664359 16:85458265-85458287 CCTGCCCTCAAGGAGCAGGGAGG + Intergenic
1142070857 16:88090782-88090804 CCGACCCCCCGCGGGCTGGGAGG - Intronic
1142083142 16:88160801-88160823 CCTGCCTGCTGGCGGCTGGGTGG - Intergenic
1142112950 16:88341794-88341816 CATGCCCAGTGGGGGCTGGGCGG + Intergenic
1142172245 16:88628860-88628882 CCTGCCCCCTAGGGGCTGGGAGG - Intronic
1142308697 16:89299804-89299826 CCTGCCCTGTGTGGGCTGCGTGG + Intronic
1142403555 16:89873677-89873699 CGGGCCCTCCGGAGGCTGAGGGG + Exonic
1142509448 17:385119-385141 CCTGCCCTCAGGCTGCCGGGAGG + Intronic
1142631537 17:1229306-1229328 CCTGCCCGCCGGGCCCGGGGCGG - Intergenic
1142711142 17:1724752-1724774 CCTGCGCTCCGGGCGCGGCGGGG - Intronic
1142757326 17:2024036-2024058 CCTGCCCTCCCAGGGCCCGGGGG + Intronic
1142860006 17:2755678-2755700 CCTGCCCTCCGCGGGCCGCACGG - Intergenic
1143136783 17:4716620-4716642 CCTGCCCTCTGAGGGCCAGGGGG + Exonic
1143178131 17:4968181-4968203 CCTCCCCTCGGGGGACGGGGCGG + Exonic
1143373271 17:6453634-6453656 GGTGCCCTCCTGGGGCTGGAGGG - Exonic
1143512593 17:7404767-7404789 CCCGCCCTCCGGAGAATGGGGGG - Intergenic
1144658200 17:17051524-17051546 CCTCCCATCCTGGGGCGGGGTGG + Intronic
1144778729 17:17797468-17797490 CCTGCCCTCCGGGGGCTGGGAGG - Exonic
1145252508 17:21304293-21304315 CCTGCCCACTGGGGCATGGGAGG + Intronic
1145828253 17:27893367-27893389 CCTGCGCCCCGGGGACTGAGCGG + Intronic
1146885095 17:36465098-36465120 CCTGCCCTCCCGCAGCTGGAAGG - Intergenic
1147143652 17:38473280-38473302 CCTGCCTTCTGGGGTCTTGGGGG + Intronic
1147317220 17:39626810-39626832 CGTGTTCTCCTGGGGCTGGGAGG - Intronic
1147572343 17:41579155-41579177 CCTGATCCCCAGGGGCTGGGGGG - Intergenic
1147610855 17:41801197-41801219 CCAGCCTCCCGGGGGCAGGGCGG - Intergenic
1147644379 17:42025077-42025099 CCTGCCCCCTGGTGGCTGGAGGG - Exonic
1147679022 17:42227622-42227644 CAGGCCCTCCAGGAGCTGGGTGG + Exonic
1147686640 17:42289907-42289929 CAGGCCCTCCAGGAGCTGGGTGG - Exonic
1148462790 17:47847889-47847911 GCTGCCCTCCGGCAGCTGGAAGG + Exonic
1148641613 17:49192316-49192338 GCGCTCCTCCGGGGGCTGGGAGG - Intergenic
1148682787 17:49484265-49484287 CCTGCCTGCAGGGGGCTGTGAGG + Intergenic
1148715129 17:49710627-49710649 ACTACCCACCTGGGGCTGGGCGG + Exonic
1150283871 17:63944864-63944886 CCTGCCCTCAGGGCTGTGGGGGG - Intronic
1150293315 17:63993843-63993865 CCCTGACTCCGGGGGCTGGGAGG + Intergenic
1150328352 17:64274646-64274668 CCTGGTTTCCGGAGGCTGGGAGG + Intergenic
1150463437 17:65371914-65371936 CCTGGCATCAGGGAGCTGGGAGG - Intergenic
1151325730 17:73378937-73378959 CCTGCCCTCAGGAAGCTGGAGGG + Intronic
1151662391 17:75525725-75525747 CCTGCCCACGGGCTGCTGGGCGG - Exonic
1151680262 17:75619347-75619369 CCTGCCCACAGGAGGCTTGGAGG + Intergenic
1151767579 17:76140225-76140247 GGTGCCCCCCGGGGGCAGGGCGG + Exonic
1152073444 17:78145264-78145286 CCTGGCCTCGGGGCTCTGGGAGG + Intergenic
1152234181 17:79129994-79130016 GCTGCCCTGCGGGGACCGGGAGG + Intronic
1152238708 17:79151204-79151226 CCTGCCCTGGGAGGGCTGAGGGG + Intronic
1152339080 17:79714569-79714591 CGTGCCCTCCATGGGCTGGAGGG - Intergenic
1152550610 17:81028157-81028179 CCTGCCCTGGCGGGGGTGGGCGG - Intergenic
1152587878 17:81197135-81197157 CCTGCCCTCTGGGGACAGAGGGG + Intronic
1152617596 17:81345121-81345143 CCGGGGCTCCGGGGGCTAGGAGG + Intergenic
1152780883 17:82227035-82227057 CCTCCCCTCTGAGGGCAGGGAGG + Intergenic
1152794595 17:82300956-82300978 CCTGCCCTCTGGTGGCGGGACGG - Intergenic
1152840981 17:82568070-82568092 CCCGCTCCCCGGGGGCTGGAGGG - Exonic
1152894923 17:82905500-82905522 CCTGCCCTCCCGGCCCTGTGTGG + Intronic
1152894940 17:82905568-82905590 CCTGCCCTCCCGGCCCTGTGTGG + Intronic
1152894957 17:82905636-82905658 CCTGCCCTCCCGGCCCTGTGTGG + Intronic
1152894974 17:82905704-82905726 CCTGCCCTCCCGGCCCTGTGTGG + Intronic
1152894991 17:82905772-82905794 CCTGCCCTCCCGGCCCTGTGTGG + Intronic
1152895009 17:82905840-82905862 CCTGCCCTCCCGGCCCTGTGTGG + Intronic
1155025130 18:21934362-21934384 CCTGCCTCCCGGGGGAGGGGTGG + Intergenic
1157493932 18:48142249-48142271 CCTGTCCTGCAGGGGCTGGAAGG + Intronic
1159462285 18:68737069-68737091 TCTGCCCTCAGAGGGTTGGGAGG + Intronic
1160288879 18:77572198-77572220 CCTGGCCACAGGAGGCTGGGTGG + Intergenic
1160653428 19:246607-246629 CCTCCCCTCCGGGGACGCGGAGG - Intergenic
1160678716 19:404014-404036 CCTGCCCTGAGGGGTGTGGGGGG + Intergenic
1160678731 19:404045-404067 CCTGCCCTGAGGGGTGTGGGGGG + Intergenic
1160678762 19:404109-404131 CCTGCCCTGAGGGGTGTGGGGGG + Intergenic
1160678777 19:404140-404162 CCTGCCCTGAGGGGTGTGGGGGG + Intergenic
1160678792 19:404171-404193 CCTGCCCTGAGGGGTGTGGGGGG + Intergenic
1160678809 19:404204-404226 CCTGCCCTGAGGGGTGTGGGGGG + Intergenic
1160678824 19:404235-404257 CCTGCCCTGAGGGGTGTGGGGGG + Intergenic
1160678868 19:404330-404352 CCTGCCCTGAGGGGTGTGGGGGG + Intergenic
1160678883 19:404363-404385 CCTGCCCTGAGGGGTCTGAGGGG + Intergenic
1160678900 19:404396-404418 CCTGCCCTGAGGGGTGTGGGGGG + Intergenic
1160678915 19:404427-404449 CCTGCCCTGAGGGGTGTGGGGGG + Intergenic
1160678932 19:404460-404482 CCTGCCCTGAGGGGTGTGGGGGG + Intergenic
1160678948 19:404493-404515 CCTGCCCTGAGGGGTGTGGGGGG + Intergenic
1160678963 19:404524-404546 CCTGCCCTGAGGGGTGTGGGGGG + Intergenic
1160678978 19:404555-404577 CCTGCCCTGAGGGGTGTGGGGGG + Intergenic
1160678991 19:404586-404608 CCTGCCCTGAGGGGTCTGAGGGG + Intergenic
1160679018 19:404651-404673 CCTGCCCTGAGGGGTCTGAGGGG + Intergenic
1160679050 19:404717-404739 CCTGCCCTGAGGGGTGTGGGGGG + Intergenic
1160679141 19:404913-404935 CCTGCCCTGAGGGGTGTGGGGGG + Intergenic
1160679155 19:404944-404966 CCTGCCCTGAGGGGTGTGGGGGG + Intergenic
1160679196 19:405039-405061 CCTGCCCTGAGGGGTGTGGGGGG + Intergenic
1160867555 19:1262504-1262526 TCTGCCCTTCCAGGGCTGGGCGG - Intronic
1160887933 19:1360683-1360705 CTTGCCCTCCGGGGTCAGGGAGG + Exonic
1160906382 19:1453500-1453522 GCTGCCCTCGGGGGTCCGGGCGG - Exonic
1160908729 19:1465088-1465110 CCTGCCCACCGAAGGATGGGGGG - Intronic
1160953113 19:1676876-1676898 CATGCCCACGGGGGGCTGGAGGG + Intergenic
1161000424 19:1907953-1907975 CCTGCCCTCCAAGGGCGCGGCGG + Intronic
1161057607 19:2198476-2198498 CCTGTCCTCCGGGCCCGGGGGGG + Intronic
1161284938 19:3464030-3464052 CCTGCCCTGCCGGGGCGCGGGGG + Intronic
1161501921 19:4620930-4620952 CCTGCTGTCCAGGGTCTGGGGGG + Intergenic
1161565075 19:4997414-4997436 CCTGCCATCTGGGGGCGGCGAGG + Intronic
1161644651 19:5445654-5445676 CCTCCCCTCCTGGGCCTGGCTGG + Intergenic
1161722150 19:5909040-5909062 CAGGCCCACCGGGGGGTGGGTGG - Exonic
1162393855 19:10405002-10405024 CCCGCCCTCCCTGGCCTGGGGGG - Intronic
1162496381 19:11025366-11025388 CTTGCCCTCCTGGGGTGGGGTGG - Intronic
1163112473 19:15170024-15170046 CCTCCCCTCAGGGTACTGGGTGG - Intronic
1163154513 19:15432577-15432599 CCCGGGCTCGGGGGGCTGGGCGG + Intronic
1163561734 19:18023374-18023396 CCTGCCCTTAGGGGGCTTGTAGG - Intergenic
1163665968 19:18604243-18604265 GCTGCCCTCCCGGGGCTGGGCGG + Intronic
1163666488 19:18606274-18606296 CCAGGCCCCCGGGGGCTGGGGGG - Intronic
1163722206 19:18903636-18903658 TCAGCACTCCGGGAGCTGGGTGG - Intronic
1165099204 19:33428504-33428526 GCTGCCCTTCAGGAGCTGGGAGG + Intronic
1165882705 19:39054792-39054814 CCTGCCTTCTGGAGGCTCGGGGG + Intergenic
1166301082 19:41912641-41912663 CCTGCCCCCTGCGTGCTGGGGGG - Intronic
1166822984 19:45591897-45591919 CCTGGCCCACGGGGGCTGTGGGG + Exonic
1167010363 19:46803111-46803133 CCTGCCCTTGGGGGTCTGAGGGG + Intergenic
1167292233 19:48630650-48630672 CCTCCCTTGCGGGGGCGGGGAGG - Exonic
1167680389 19:50916603-50916625 CCAGCCCCCAGGGGGATGGGAGG - Intergenic
1167810843 19:51828883-51828905 CCTGCCCTCCAGGAGCTGCAGGG - Intergenic
1168280273 19:55302013-55302035 CCTGCCCCCGGTGGGGTGGGCGG + Intronic
1168319529 19:55500736-55500758 ACTGCCCCTCGGGGGCTTGGGGG + Exonic
1168702907 19:58452081-58452103 CCTGCCCTGGGGGGGTTGCGGGG + Intronic
1168705398 19:58467603-58467625 CCTGCCCTGGGGGGGTTGCGGGG + Exonic
1168722494 19:58561857-58561879 CCAGCACTCGGGGGGCTGGAGGG + Intergenic
925048830 2:795676-795698 CCTGCCCTGGGGGCCCTGGGGGG + Intergenic
925086946 2:1115945-1115967 CCTGCCCTCCAGGACCTTGGCGG + Intronic
925439554 2:3872599-3872621 CCTGCCCTCCGGGAGCTGACAGG - Intergenic
925511097 2:4626190-4626212 CAGGCCCTCCGTGGGCTGAGAGG + Intergenic
925897893 2:8487487-8487509 TCTGCCCTCCAGGGGCTGCCAGG + Intergenic
926197271 2:10771604-10771626 CCTCCCCTCCAGGGACAGGGAGG - Intronic
926668078 2:15546895-15546917 TCAGCCCTCCAGTGGCTGGGTGG - Intronic
926720962 2:15959829-15959851 CCAGCACTCCTGGGGATGGGGGG + Intergenic
927091760 2:19717820-19717842 CCTTCCCCCAAGGGGCTGGGTGG + Intergenic
927501931 2:23588818-23588840 CTTGTCTTCCGGGGGCTGGTGGG - Intronic
928169408 2:28993770-28993792 TCTGCCTTCTGGGGCCTGGGTGG + Intronic
929501292 2:42493637-42493659 CCTGCCCTCCGCTGGCCCGGGGG + Exonic
929501568 2:42494582-42494604 GCTTCCCTCCGCGGGCTGGCAGG - Exonic
930358074 2:50346227-50346249 CCTGGCCCCGGGGGGCGGGGAGG - Intronic
931252381 2:60544742-60544764 CTTGCCTTTCGGGAGCTGGGTGG + Intronic
931696011 2:64871116-64871138 CCTGCCCTGGTGGGGTTGGGAGG - Intergenic
932198447 2:69804578-69804600 CCTGATCTCCTGGCGCTGGGCGG - Exonic
932398960 2:71466592-71466614 CCTGCCCGCGGCGGGCGGGGAGG - Intronic
932398965 2:71466596-71466618 CCCGCCCGCCGCGGGCAGGGCGG + Intronic
933574921 2:84056366-84056388 GCTAACCTCTGGGGGCTGGGCGG - Intergenic
933983952 2:87575295-87575317 CCTGCTTTGCTGGGGCTGGGGGG + Intergenic
934563306 2:95324075-95324097 CCTCCCCTCCGTGGGCTGGCGGG + Intronic
934573568 2:95386320-95386342 CCTGCCCTGTGGGGTCTGTGCGG - Intergenic
935093284 2:99917318-99917340 CCTGCCCTCTGGCTTCTGGGTGG - Intronic
936309903 2:111375501-111375523 CCTGCTTTGCTGGGGCTGGGGGG - Intergenic
938482524 2:131673496-131673518 CCTGCCCTCCTGCGGCTGAGAGG + Intergenic
938828965 2:135033662-135033684 CCGCCCGTCCGGGGGGTGGGGGG - Intronic
942565743 2:177264111-177264133 CCGGCCCTTCCGGGGCTGCGCGG - Intronic
942928058 2:181457230-181457252 CCCGCGCTCTGCGGGCTGGGAGG + Exonic
944270559 2:197780928-197780950 CCTCCCCTATGTGGGCTGGGGGG + Intronic
944413258 2:199462246-199462268 CTTGCCCTCCTGGGGGCGGGAGG + Intronic
946397191 2:219449002-219449024 CCTGGCCTCTGGGGGATCGGCGG - Exonic
946402382 2:219475414-219475436 CCTGTCCCCCATGGGCTGGGAGG - Intronic
947566705 2:231198736-231198758 CCCGCCGTCCTGGTGCTGGGAGG + Intronic
948398202 2:237663036-237663058 CCTGCCCTGCGGGAGCCGGCAGG + Intronic
948449580 2:238060885-238060907 CCTCCCCGCTGGGGGCTCGGCGG + Exonic
948467195 2:238158271-238158293 CCTGCCCTGGTGGGGCTGAGCGG - Intergenic
948856008 2:240730961-240730983 GCTGCCCTCAGGGGGCTTGGAGG - Intronic
1168810124 20:699703-699725 CCTGCCCTCCAGGGACTGGCAGG - Intergenic
1168841096 20:910721-910743 CCTGCCCTCTGTGGGATGGCTGG + Intronic
1168930355 20:1618618-1618640 CCTGCCCTCTAGGGCCTGTGAGG + Intronic
1170226535 20:13996287-13996309 TTTGCCATTCGGGGGCTGGGGGG - Intronic
1170677679 20:18497305-18497327 CCTGCCTTCCGCTGGCTGCGTGG + Intergenic
1170858722 20:20082584-20082606 CAAGTCCTCCTGGGGCTGGGAGG + Intronic
1171207019 20:23289197-23289219 CCTGGACTCCTAGGGCTGGGAGG + Intergenic
1171232728 20:23500489-23500511 CCTGCCCCCCAGGGGCCTGGTGG + Intergenic
1172447623 20:35001423-35001445 CCTGTCCTCCTCGGCCTGGGCGG - Exonic
1172661878 20:36573930-36573952 GCTGCGCTCCGGGGGCCGGTGGG + Intronic
1172785643 20:37466584-37466606 CCTGTCTTCTGGGGTCTGGGAGG - Intergenic
1172846271 20:37931523-37931545 CCTGCACGGCGGGGGATGGGTGG - Intronic
1174186727 20:48711451-48711473 CCTGCCCACCGGGAGCTGACTGG - Intronic
1174206931 20:48846990-48847012 CCTACCCTCCAGGGGCTAGGAGG + Intergenic
1174210791 20:48876272-48876294 CCTGCCCACCTGAGGCTGGGTGG - Intergenic
1174454447 20:50639452-50639474 CCTGCCCCCGGGGAGCTGTGGGG - Intronic
1174472349 20:50770273-50770295 CCTGCCCCCGGGGAGCTGTGGGG + Intergenic
1174529496 20:51199640-51199662 CCTGCCCGCAGGGCCCTGGGTGG + Intergenic
1174870192 20:54174292-54174314 CCTGCCCGCCGGGGGAGGGCGGG - Intergenic
1175084942 20:56450629-56450651 CCTGCCTTCTTGGGGCTGGCTGG - Exonic
1175153639 20:56954736-56954758 CCTGCCATCCAGGGGCTTCGTGG - Intergenic
1175191224 20:57213225-57213247 GCTGGCCTCCGGGTGCTGGACGG - Intronic
1175371397 20:58495516-58495538 CCTGCCCTCGGGGCACAGGGGGG - Intronic
1175445002 20:59013819-59013841 CCTGCCCTCCAGGGACTTAGAGG - Intergenic
1175709231 20:61206080-61206102 CCTGGCTTCCTGGGGCTGGGGGG - Intergenic
1175970847 20:62686025-62686047 GGTACCCTCCGGGGACTGGGGGG + Intergenic
1175990456 20:62785950-62785972 CCTGCACCCCTGGGCCTGGGTGG + Intergenic
1176171498 20:63698364-63698386 CCAGCCCTCCGGGGCCTCGAGGG - Exonic
1176214809 20:63943008-63943030 CCTGCCTTCTGTGGGTTGGGAGG - Intronic
1177157348 21:17512980-17513002 CCTGCCGAGCGGGGGCTGGGAGG + Exonic
1178544193 21:33479717-33479739 CCGGCCTTCTGGGGGCTGTGGGG - Intronic
1179081145 21:38171897-38171919 GCTGACCTCCAGGGGCTGGTGGG - Intronic
1179511280 21:41875323-41875345 GCTGCCGTCCGGGGCCTGGCAGG - Intronic
1180038832 21:45265381-45265403 ACTGCCAGCCGGGAGCTGGGCGG - Exonic
1180068230 21:45423495-45423517 CGGGCCCTCCGGGGGGCGGGGGG - Intronic
1180483760 22:15777114-15777136 CCCGCCCTCCTGCGGCTGAGAGG + Intergenic
1180694385 22:17742586-17742608 ACTGCCCTCTGGTGGCTGTGGGG - Intronic
1181067960 22:20315520-20315542 TCTGCCATCAGGGGGCGGGGAGG + Intronic
1181990608 22:26833928-26833950 TCTGGCCTCAGGGGGCTGGGTGG + Intergenic
1182593237 22:31398401-31398423 ACTTCCCTCCCAGGGCTGGGTGG + Intergenic
1183232675 22:36592847-36592869 CCTGACCTCCTGGGGCTGCTGGG - Intronic
1183364697 22:37400654-37400676 CCTTCCCTCCAGGGGCTCAGGGG - Intronic
1183406086 22:37631353-37631375 CCTGCCTTCCTGGGGATGGAAGG - Intronic
1183743722 22:39681713-39681735 CCTGCCCTGCTGGGGGTGGGGGG + Intronic
1184096156 22:42317633-42317655 CATTCCCGCTGGGGGCTGGGGGG + Intronic
1184408396 22:44313033-44313055 GCTGCCATCCTGGGCCTGGGAGG - Intergenic
1184663835 22:45977357-45977379 ATTGCCCTCCGGGGACTGGGCGG + Intergenic
1184751368 22:46488295-46488317 CCTGCCCTCCTGGGGACAGGGGG + Intronic
1184754809 22:46509737-46509759 GCTGGCCTCAGGGAGCTGGGAGG + Intronic
1184810786 22:46830319-46830341 CCTACCCTCCAGGGGCTCGAAGG - Intronic
1185163562 22:49244117-49244139 CCTGGCCTCTGGGGGCTGGCCGG - Intergenic
1185208871 22:49555522-49555544 GCTGCCCTCCGAGGGCTGTGAGG - Intronic
1185208884 22:49555561-49555583 GCCGCCCTCCGAGGGCTGTGAGG - Intronic
1185219760 22:49623459-49623481 CCTGCCCAGCGGGGGCTCTGGGG - Intronic
1185245507 22:49770966-49770988 GCGCTCCTCCGGGGGCTGGGAGG + Intergenic
1185370566 22:50459099-50459121 CATGCCCTCCGGGTGCCGTGGGG - Intronic
949708232 3:6843117-6843139 CATGCCCTCTGGGGGCTTTGAGG + Intronic
950445264 3:13033804-13033826 ACTGCCCTCCCCAGGCTGGGTGG - Intronic
950460121 3:13116141-13116163 ACTGCCCTCAGGGAGCTGGGAGG - Intergenic
950502922 3:13375938-13375960 CCTCAGCTCTGGGGGCTGGGCGG - Intronic
950670800 3:14524311-14524333 CCTCCCCACCAGGGCCTGGGTGG - Intronic
951333525 3:21393840-21393862 CCTGCCCCAGAGGGGCTGGGGGG + Intergenic
953619966 3:44524713-44524735 CCTGCCATCGAGGGGATGGGTGG - Intergenic
953947627 3:47163530-47163552 CCGGCCATCCCGGGGCTCGGCGG - Intronic
955227744 3:57074935-57074957 CCTGCCCTCCAGGTCCTGGCAGG - Exonic
955412042 3:58661989-58662011 CCTGCCCTCCAGTGTCTGAGGGG + Intronic
961041924 3:123683704-123683726 ACAGGCCTCCGGGGGCTGTGGGG + Intronic
961825422 3:129596681-129596703 AGTTCCCTCCTGGGGCTGGGGGG + Intronic
962378523 3:134878054-134878076 CCTGCCCTCCGGGGGAAGGCTGG - Intronic
964721463 3:159770767-159770789 CCTCCCTTCAGGTGGCTGGGTGG + Intronic
966923979 3:184632815-184632837 CTTGCTCTGCTGGGGCTGGGAGG - Intronic
967466093 3:189807715-189807737 CCAGTCCTTAGGGGGCTGGGTGG + Intronic
968092414 3:195907592-195907614 CGTGCCCCCAGGGGGCTTGGCGG - Intronic
968148361 3:196318308-196318330 CCTGCGCACCGGCTGCTGGGCGG + Intronic
968454119 4:688640-688662 CCTGCTGTCCTGGGGCTGGGAGG + Intronic
968568185 4:1326021-1326043 CCTGCCTTCCAGGGGCTCAGAGG - Intronic
968584657 4:1410612-1410634 CGTGGCCTCCGGGGGCGAGGTGG - Intergenic
968664343 4:1812769-1812791 CTTGCCCTCCGGGTGCTGCAGGG - Exonic
968744381 4:2352207-2352229 GATGCCCTCAGGGAGCTGGGAGG + Intronic
969086989 4:4663997-4664019 CCTGCCCTCAGGTGGTTGTGAGG + Intergenic
969251973 4:5973990-5974012 CCTGGCTTCTGGGGGCAGGGAGG - Intronic
969343270 4:6555805-6555827 CCTGCCCCCCGGGTGCTTGCTGG + Intronic
969704180 4:8783070-8783092 CCCTCCCTCCCGGGGATGGGAGG + Intergenic
969721855 4:8896411-8896433 CCTGACCTCAGGAGGCTGGTGGG + Intergenic
970430645 4:15986176-15986198 CCTGCCCTCAGGGGCCTGGGTGG - Intronic
973662082 4:53118643-53118665 CCCGCCCTCTGGGTGGTGGGTGG - Intronic
974905073 4:68045246-68045268 ACTGCTCTCTGGGGGCTAGGGGG - Intergenic
978382535 4:108144657-108144679 CCTGCCCTCCAGCAGCTGTGTGG - Intronic
978489966 4:109302250-109302272 CCCTCCGTCCGGGGACTGGGTGG + Exonic
978795792 4:112706159-112706181 CCCGCCTTCCGGGGCCGGGGAGG - Intergenic
981110113 4:140925527-140925549 CCTCCCCTCCGATTGCTGGGAGG + Intronic
981688437 4:147480896-147480918 CCTGCCCTTCAGGGCCTGGAAGG + Intronic
983697828 4:170554355-170554377 CATGCCCTCCGGGGCCTTGGGGG - Intergenic
983904541 4:173169515-173169537 CCCGCCCGCCGGGGAGTGGGAGG + Intronic
983940221 4:173529393-173529415 CCGGGCGCCCGGGGGCTGGGGGG - Exonic
984337745 4:178415028-178415050 CCTGTGCTCTGGGGGCGGGGAGG + Intergenic
985128959 4:186723363-186723385 CCTTCCCTCCGGGAGCTCGCCGG - Intronic
985717029 5:1468416-1468438 ACTGCTCTCTGGGGGCTGAGTGG - Intronic
985784866 5:1888127-1888149 CCCTCCCTCAGGGAGCTGGGGGG + Intergenic
986172788 5:5327340-5327362 CCTGAGCCCCGGTGGCTGGGAGG - Intergenic
987195413 5:15520854-15520876 CCTGTCCTCCAGGGGTTGTGTGG + Intronic
987962085 5:24823838-24823860 CCTGCCTCCCTGGGGCTGAGTGG - Intergenic
990278934 5:54229355-54229377 CCTGCCCCCTGGTGGCTGGTGGG + Intronic
991041650 5:62182514-62182536 CCTGCCCATGGGGGCCTGGGAGG - Intergenic
992470030 5:77043588-77043610 CGTGCCATCCGGGGGGGGGGGGG - Intronic
992615446 5:78542465-78542487 CTTGCATCCCGGGGGCTGGGAGG + Intronic
995348509 5:111148515-111148537 CCTGCCATCAGGTGGCTGGCTGG + Intergenic
995724368 5:115169128-115169150 CCTGCCCGCGGGGGGCGGGCCGG - Intronic
995757358 5:115522120-115522142 CCTCCTCTTTGGGGGCTGGGTGG - Exonic
996900311 5:128537126-128537148 CCCTCTCTCCGGGGGTTGGGCGG - Intronic
997443849 5:133927205-133927227 GCTGCCCTCCTGGAGCTGAGTGG - Intergenic
997879901 5:137580228-137580250 CCTGCCCTCTAGGGGCTGGAGGG + Intronic
998174622 5:139894202-139894224 CCTGCCCGCTGGGTGCCGGGAGG - Intronic
999232209 5:150068370-150068392 CCTGACCTCAGGGGGCTCGGAGG - Intronic
999241180 5:150128343-150128365 CCTGCCCTGTGGTGGATGGGTGG - Intronic
1002063908 5:176642859-176642881 CCCGCCCACCTGGGGCGGGGGGG - Intronic
1002352023 5:178590053-178590075 GCTGCTCTCCGTGGGCTCGGCGG - Exonic
1002439599 5:179257452-179257474 CCTGGACTCCCCGGGCTGGGCGG - Intronic
1002449578 5:179311041-179311063 CCTGCACTCGGTGGGTTGGGGGG - Intronic
1002467716 5:179416120-179416142 GCTGCCCTCCTGGGGCTGGAGGG - Intergenic
1002597668 5:180334793-180334815 CCTGCCCTTGGAGGCCTGGGAGG + Intronic
1003403552 6:5810159-5810181 CCTGGCCTGGTGGGGCTGGGAGG + Intergenic
1006036194 6:31214611-31214633 ACTGCCCTCAGGGGGCTCTGTGG + Intergenic
1006474215 6:34244566-34244588 CCTGCCCTCCCTGGGCCTGGGGG + Intronic
1007341268 6:41192764-41192786 TCTGCCCTCAGGAGGCTGGGAGG + Intronic
1009598767 6:65771453-65771475 CCTGGCCCCCGGGGGCTCTGGGG + Intergenic
1009868266 6:69424942-69424964 CAGTCCTTCCGGGGGCTGGGCGG + Intergenic
1010404179 6:75483868-75483890 CCTGCTTGCTGGGGGCTGGGGGG + Intronic
1011164644 6:84432112-84432134 CCTGCCCTCAGATAGCTGGGAGG - Intergenic
1013236322 6:108200237-108200259 CCTGACCCCCGGGGCCCGGGAGG + Intergenic
1013311457 6:108898396-108898418 CATGCCCTCTCGGGGCAGGGTGG - Intronic
1015904984 6:138107538-138107560 CCTGCCCTGCCGGGCCGGGGCGG + Intergenic
1016569061 6:145492377-145492399 CATGCCCTCAGGGGCCTTGGGGG - Intergenic
1016772060 6:147862548-147862570 CTTGCACCCCGGGAGCTGGGAGG + Intergenic
1017040873 6:150307781-150307803 CCTGCCTCCTGGGAGCTGGGGGG + Intergenic
1017598455 6:156055571-156055593 CCTCCCCTACTGGGTCTGGGAGG - Intergenic
1017679611 6:156850068-156850090 TATGCTCTCCCGGGGCTGGGCGG - Intronic
1017875031 6:158517151-158517173 CCTCTCCTCTGGGGGCAGGGAGG - Intergenic
1018915280 6:168129103-168129125 CCTGACCTCCGAGGCCTAGGCGG - Intergenic
1018926324 6:168209432-168209454 CCTGGCCTCCTGGGGATGGTGGG + Intergenic
1018962454 6:168458268-168458290 CCTGCCCTGGGGGTCCTGGGAGG + Intronic
1018962476 6:168458330-168458352 CCTGCCCTGGGGGTCCTGGGAGG + Intronic
1019343009 7:517359-517381 CCTTCCCTCCGCGCGCGGGGAGG - Intronic
1019513704 7:1430504-1430526 CCTGCCCTGCCCGGGGTGGGAGG - Intronic
1019514341 7:1433150-1433172 TGTGCCCTCCGAGGACTGGGAGG - Intronic
1019564091 7:1671016-1671038 TCGTCCCTCTGGGGGCTGGGAGG + Intergenic
1019576057 7:1738158-1738180 CGCGCCCTCCGTGGTCTGGGTGG - Intronic
1020274218 7:6615251-6615273 CCTGCCCTCTAGGGGGTGGCAGG + Intergenic
1020445350 7:8262068-8262090 CCTGCCCTCCGGGGTCGGGGCGG - Intronic
1021365562 7:19773520-19773542 GCTGCGGTCCGGGGGCGGGGCGG - Intronic
1021879451 7:25079586-25079608 CCAGCACTCTGGGTGCTGGGCGG - Intergenic
1022133544 7:27425833-27425855 CCTCCCCTCCAGGGTCTGAGTGG - Intergenic
1023609256 7:41957273-41957295 CCGGCCTCCTGGGGGCTGGGAGG + Intergenic
1023913190 7:44569526-44569548 CCTGACCCCAGGGTGCTGGGTGG - Intronic
1024964023 7:55005609-55005631 CCTGTCCTGCGCGGGCTGGGGGG - Intergenic
1026438323 7:70419421-70419443 CCTACACACTGGGGGCTGGGGGG + Intronic
1026899400 7:74028510-74028532 GCTGCCCTGCGAGGGCTGAGGGG + Intronic
1027960534 7:84940100-84940122 GCTGGCCTCCGGGTGCGGGGTGG - Intergenic
1029144914 7:98439029-98439051 CCTGACGTCAGTGGGCTGGGAGG - Intergenic
1029188365 7:98755241-98755263 TCTGCACGCCAGGGGCTGGGGGG - Intergenic
1029420080 7:100467767-100467789 CCGCCCCACCGGGGCCTGGGAGG - Intronic
1029977628 7:104849440-104849462 CCTGGCTCCTGGGGGCTGGGTGG + Intronic
1030278391 7:107744074-107744096 ACTGCCTTCCGGAGGCCGGGAGG - Exonic
1032013611 7:128361779-128361801 CCTGCCCGCCCGGGTGTGGGGGG - Intergenic
1032857378 7:135846548-135846570 CCTGCCCTCTGGCGTCTGGGTGG + Intergenic
1033059804 7:138095383-138095405 CCTGCTCTCAGGGAGATGGGAGG + Intronic
1033424475 7:141231602-141231624 CCTGCTCCCTGGGGGCTGGAAGG + Intronic
1035512949 8:206341-206363 CCTCCCCTCCGGGGACGCGGAGG - Intergenic
1035641599 8:1188658-1188680 CCTGCCCCCGGAGTGCTGGGCGG - Intergenic
1035663801 8:1365502-1365524 CCTGCCATCCTGGACCTGGGAGG - Intergenic
1037099900 8:15032484-15032506 CCTGGCATCTGGGGCCTGGGTGG - Intronic
1037769306 8:21789434-21789456 CGAGCCATCCGGGGGCTCGGGGG + Intronic
1037823758 8:22148402-22148424 CCTGCCCTCCCGGGGCTCGCTGG - Exonic
1037832013 8:22195349-22195371 CCAGCCATCGGGGAGCTGGGTGG + Intronic
1038420561 8:27431494-27431516 CCTCCCCGCCTGGGGCTGGGTGG - Intronic
1038613261 8:29072147-29072169 GCTTCACTCAGGGGGCTGGGGGG + Exonic
1039885102 8:41650054-41650076 TCTGCCCCCCGGGGCCTGGCGGG + Intronic
1040559897 8:48514735-48514757 CCTGGCGTCCGGGGGCTGGCAGG + Intergenic
1041830076 8:62143915-62143937 CCTTCCCTCCGAGGGCTTGGAGG + Intergenic
1047423420 8:124726188-124726210 CCTGCCATCCTGTGGCTGCGTGG - Intronic
1048367507 8:133751173-133751195 CCTGGCCTCCTGGGGCTGTTGGG + Intergenic
1049183882 8:141238624-141238646 GCTGCCCTCCAGGGGCCAGGGGG - Intronic
1049187729 8:141267055-141267077 CCTGAACTGCGGGGGCTGGCAGG + Intronic
1049457483 8:142700894-142700916 CCTGGCCTCCGGGGGCTTCACGG + Intronic
1049519083 8:143079159-143079181 CCTGCCCTCAGGGGTCTTGCAGG - Intergenic
1049558398 8:143295272-143295294 CCTCCCCTCCCAGGACTGGGTGG + Intronic
1049566885 8:143344905-143344927 GCTGCTCTCCAGGTGCTGGGTGG - Intronic
1049729090 8:144166774-144166796 CCTGCCCTCTGAGGGCAGTGAGG - Intronic
1049791803 8:144475685-144475707 CCTCCTCTTAGGGGGCTGGGAGG + Exonic
1049820801 8:144632043-144632065 CCTGCCCTCCTGGGTCTGCCAGG + Intergenic
1050459320 9:5863660-5863682 CCTGCCCTTGGGAAGCTGGGTGG + Intergenic
1053188375 9:36037613-36037635 CCTGTCCCCCGGGGGCTGGCAGG + Intronic
1053323444 9:37120509-37120531 CCTTCCCTCCCGGGTCTGCGCGG + Intergenic
1054496155 9:65824997-65825019 GCTGCCTGCCGGGGGCGGGGGGG - Intergenic
1056852158 9:90093801-90093823 CCGGCCCTTCAGGGGCTGGCTGG + Intergenic
1057023459 9:91718573-91718595 GCTGCCATCCTGGGGCGGGGGGG + Intronic
1057208767 9:93188224-93188246 TCTGCCCTCCACAGGCTGGGGGG + Intronic
1057353947 9:94320431-94320453 GCTGGCCTCTGGGGCCTGGGTGG + Exonic
1057353962 9:94320476-94320498 GCTGGCCTCTGGGGCCTGGGTGG + Exonic
1057353978 9:94320521-94320543 GCTGGCCTCTGGGGCCTGGGTGG + Exonic
1057653787 9:96937114-96937136 GCTGGCCTCTGGGGCCTGGGTGG - Exonic
1057653803 9:96937159-96937181 GCTGGCCTCGGGGGCCTGGGTGG - Exonic
1059379075 9:113909324-113909346 CCTGTCCCCCTGGGTCTGGGTGG + Intronic
1060042142 9:120308844-120308866 CCTGACTTCCTGGGGGTGGGGGG + Intergenic
1061079256 9:128360494-128360516 CCGGCCCTCAGAGGGATGGGGGG - Exonic
1061420550 9:130471006-130471028 CCTGCCCTCGGGGAGCTGAGAGG + Intronic
1061849051 9:133403846-133403868 CCTGGGCCCCTGGGGCTGGGAGG + Intronic
1062027244 9:134346261-134346283 CCTGCCCTCCCGCGGCTTGCTGG + Intronic
1062057292 9:134475233-134475255 CTGGGCCTCAGGGGGCTGGGTGG + Intergenic
1062101906 9:134732914-134732936 CCTGCCTGCCGGCGGCGGGGCGG - Intronic
1062414114 9:136439357-136439379 CCTCCCTTCCGGCGGCTGCGGGG + Exonic
1062476042 9:136728028-136728050 GCTGGCCTCCGGGTGCGGGGTGG - Intergenic
1062568323 9:137173032-137173054 CCTGGCCTCCGTTGGCTGTGGGG - Intergenic
1062625949 9:137441572-137441594 CCCGCCCCCGGGGGGGTGGGAGG + Intronic
1062686019 9:137813896-137813918 CCATCTCTCCGGGGGCTGGGAGG - Intronic
1185736447 X:2500351-2500373 CCTCCCCTCCGGGGCCTGGCGGG + Intronic
1189371637 X:40433762-40433784 CCTCCCCTGCTGGGGATGGGGGG + Intergenic
1190337387 X:49270467-49270489 CCTGCCCACGGCGGGCTGCGCGG - Exonic
1192261062 X:69505984-69506006 CCCGGGCTCCGGGGCCTGGGAGG + Exonic
1194977459 X:100409170-100409192 TGCGCCCTCCGGGGTCTGGGGGG + Exonic
1195680525 X:107542703-107542725 CCTGCCCTCCTGTGGCTGATTGG + Intronic
1197727382 X:129785573-129785595 TCTGCAGTCTGGGGGCTGGGAGG - Intronic
1199772535 X:150983851-150983873 GGTGCCCGCCGGGGGCTGCGCGG + Intronic
1199846169 X:151694553-151694575 CCTGCCTTCCCGGGGCAGGGTGG + Intergenic
1200062262 X:153488868-153488890 CCTGCCCTCCTGCAGCTGAGGGG - Intronic
1200745257 Y:6898537-6898559 CCGGCCCTCAGTGGGTTGGGAGG + Intergenic
1201283989 Y:12363614-12363636 TCTGCCCTGTGGGGGCTGGGAGG + Intergenic
1201589667 Y:15601232-15601254 TCTGCCCTCCAGGGGATGTGTGG + Intergenic