ID: 1144779357

View in Genome Browser
Species Human (GRCh38)
Location 17:17800050-17800072
Sequence GGAACCTGCAGGAGTCCTGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 211}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144779357_1144779368 20 Left 1144779357 17:17800050-17800072 CCGACAGGACTCCTGCAGGTTCC 0: 1
1: 0
2: 1
3: 21
4: 211
Right 1144779368 17:17800093-17800115 ACCCAGCAGATGGTGGCCTTGGG 0: 1
1: 0
2: 0
3: 21
4: 198
1144779357_1144779364 10 Left 1144779357 17:17800050-17800072 CCGACAGGACTCCTGCAGGTTCC 0: 1
1: 0
2: 1
3: 21
4: 211
Right 1144779364 17:17800083-17800105 GGCCTTGCTTACCCAGCAGATGG 0: 1
1: 0
2: 1
3: 8
4: 148
1144779357_1144779366 13 Left 1144779357 17:17800050-17800072 CCGACAGGACTCCTGCAGGTTCC 0: 1
1: 0
2: 1
3: 21
4: 211
Right 1144779366 17:17800086-17800108 CTTGCTTACCCAGCAGATGGTGG 0: 1
1: 0
2: 1
3: 12
4: 160
1144779357_1144779367 19 Left 1144779357 17:17800050-17800072 CCGACAGGACTCCTGCAGGTTCC 0: 1
1: 0
2: 1
3: 21
4: 211
Right 1144779367 17:17800092-17800114 TACCCAGCAGATGGTGGCCTTGG 0: 1
1: 0
2: 1
3: 17
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144779357 Original CRISPR GGAACCTGCAGGAGTCCTGT CGG (reversed) Intronic