ID: 1144779446

View in Genome Browser
Species Human (GRCh38)
Location 17:17800501-17800523
Sequence CAGGGACAGGATGGGGTGGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 829
Summary {0: 1, 1: 1, 2: 6, 3: 70, 4: 751}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144779446_1144779463 23 Left 1144779446 17:17800501-17800523 CCGACCACCCCATCCTGTCCCTG 0: 1
1: 1
2: 6
3: 70
4: 751
Right 1144779463 17:17800547-17800569 ATGCACACACAAGGTCCTGCTGG 0: 1
1: 0
2: 4
3: 10
4: 177
1144779446_1144779459 14 Left 1144779446 17:17800501-17800523 CCGACCACCCCATCCTGTCCCTG 0: 1
1: 1
2: 6
3: 70
4: 751
Right 1144779459 17:17800538-17800560 TAACCGCCCATGCACACACAAGG 0: 1
1: 0
2: 2
3: 3
4: 97
1144779446_1144779464 30 Left 1144779446 17:17800501-17800523 CCGACCACCCCATCCTGTCCCTG 0: 1
1: 1
2: 6
3: 70
4: 751
Right 1144779464 17:17800554-17800576 CACAAGGTCCTGCTGGACTGAGG 0: 1
1: 0
2: 3
3: 8
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144779446 Original CRISPR CAGGGACAGGATGGGGTGGT CGG (reversed) Intronic
900120810 1:1047953-1047975 CAGGGCCAGGAAGGGGTGAGGGG - Intronic
900226694 1:1536402-1536424 AGGGGAGAGGATGGGGTGCTGGG - Intronic
900284976 1:1894681-1894703 CAGGGAGAGGGCGGGGTGGTAGG - Intergenic
900370481 1:2329888-2329910 AAGGGACAGGCTGGGCTGCTGGG + Intronic
900619610 1:3580737-3580759 CAGGGCCAGGGTGGGATGGCAGG + Intronic
900700779 1:4047477-4047499 CAGGGAGAGGAAGGGGAGGAAGG + Intergenic
900701065 1:4048935-4048957 GAGAGACAGGAAGGTGTGGTGGG - Intergenic
900972852 1:6001051-6001073 CAGAGACAGCATGGGGTGTCAGG + Intronic
901769828 1:11524602-11524624 TGGGCACTGGATGGGGTGGTAGG - Intronic
901769957 1:11524967-11524989 TGGGCACAGGATGGGGTGGCAGG - Intronic
901864858 1:12098851-12098873 CAGGAAGAGGATGAGGAGGTGGG - Intronic
902239678 1:15080313-15080335 TAGGGACACGTTGGGGTGGGAGG + Intronic
902292201 1:15442665-15442687 CAGGGTGAGGATGGGGTGTCAGG - Intronic
902637050 1:17741447-17741469 CAGGGACAGGTGGGGCTGATTGG + Intergenic
903302204 1:22387094-22387116 CTGGGACTGGGTGGGGTGGAGGG + Intergenic
903608100 1:24589705-24589727 CAGGGACAGGGTGGTGTGGTAGG + Intronic
903686737 1:25137201-25137223 CAGGAAGAGGGTGGGGTGGGGGG - Intergenic
903858921 1:26353778-26353800 CAGGGAGAGGATGGGCAGGAAGG - Intronic
903867397 1:26409742-26409764 GAGGGACTGGGTGGGCTGGTGGG - Intergenic
903999113 1:27328262-27328284 CAGAGAAAGCATGGGGTGGGAGG + Intronic
904495229 1:30882704-30882726 CTGAGAGAGGATGGGGTGGGAGG - Intronic
904658741 1:32069052-32069074 TAGTGACTGGTTGGGGTGGTTGG - Intergenic
904773475 1:32893638-32893660 CAGGGGCGGGACGGGGTGGACGG + Intronic
905006208 1:34712387-34712409 CAGGGGCAGGAGGTGATGGTGGG - Intergenic
905043014 1:34976125-34976147 CAGGGAGACGCAGGGGTGGTGGG + Intergenic
905293302 1:36938177-36938199 CAGGGGCAGGAAGTGGTGGATGG + Intronic
905379916 1:37554393-37554415 CAGCGACAGGCTTGGGTGGCGGG + Intergenic
905385159 1:37597905-37597927 GAGGGACAGTGTGGGGTGGAAGG - Intergenic
905563482 1:38945167-38945189 CAGAGAATGGATGGGGGGGTTGG + Intergenic
905901292 1:41583469-41583491 CAGGGGCAGGAGGGGCTGGGTGG + Exonic
906187267 1:43871491-43871513 GAGGGAGAGGATGGGGTGTGAGG + Intronic
906187273 1:43871510-43871532 GAGGGAGAGGATGGGGTGTGAGG + Intronic
906187279 1:43871529-43871551 GAGGGAGAGGATGGGGTGTGTGG + Intronic
906187297 1:43871584-43871606 GAGGGAGAGGATGGGGTGTGAGG + Intronic
906187321 1:43871679-43871701 GAGGGAGAGGATGGGGTGTGAGG + Intronic
906187340 1:43871733-43871755 GTGGGAAAGGATGGGGTGGGAGG + Intronic
906187373 1:43871844-43871866 GTGGGAGAGGATGGGGTGGGAGG + Intronic
906304865 1:44710851-44710873 CAGGGACTGGAGGGAGTGGAAGG - Intronic
906528075 1:46508104-46508126 CTGGGACAGGATGGGGTGGGTGG - Intronic
906557310 1:46724084-46724106 AAGGGGAAGGATTGGGTGGTAGG + Intergenic
906559825 1:46748344-46748366 CAGTGACAGAATTGGGAGGTAGG - Intergenic
906647816 1:47488600-47488622 CAGCCACAGGCTGGGGTAGTGGG - Intergenic
906652434 1:47522199-47522221 CAGGCTGAGGATGGGGTGGCAGG - Intergenic
907394309 1:54178599-54178621 GAGGGACAGGCTGAGGTGGGAGG + Intronic
907743868 1:57193219-57193241 CAGGGACCGGGTGGGGTGGGTGG - Intronic
907942577 1:59103775-59103797 CATGGACACGGCGGGGTGGTGGG + Intergenic
908161155 1:61409811-61409833 AAGAGACAGGGTGGGGTGGTAGG + Intronic
908728253 1:67199372-67199394 TAGGGTGAGGATGGAGTGGTGGG - Intronic
909631630 1:77774567-77774589 CAGGGACAGCATGGCCTGGATGG + Intergenic
910023060 1:82616329-82616351 CAGTGACAGGAGCTGGTGGTAGG - Intergenic
910149657 1:84126539-84126561 TGGGTACAGGATGGGGAGGTGGG + Intronic
910465278 1:87492605-87492627 CAGAAGGAGGATGGGGTGGTTGG + Intergenic
912449259 1:109759301-109759323 GATGGACAGGATGGAGTTGTAGG + Exonic
912499398 1:110112189-110112211 GAGGGAAAGGACAGGGTGGTGGG - Intergenic
912674457 1:111664569-111664591 CAGGGAGAGGAAGGGGGTGTAGG - Intronic
912843492 1:113059632-113059654 CAGGGACAAGATGGTTTGCTGGG + Intergenic
913094101 1:115499935-115499957 CAGGGGCAGGTGGGGGTGGGTGG + Intergenic
913430782 1:118788773-118788795 CTGGGACAGGATGGAGTTCTCGG + Intergenic
914335826 1:146714382-146714404 CATGGACTGGGTGGGGTGGTGGG - Intergenic
914360104 1:146927677-146927699 CAGAAGGAGGATGGGGTGGTTGG + Intergenic
914462884 1:147900992-147901014 AAAGGACAGGAAGGGGGGGTGGG + Intergenic
914865840 1:151428076-151428098 CAGAGCCAGGTTGGGATGGTGGG - Intronic
915477371 1:156161086-156161108 CAGGGGCAGGACTGAGTGGTGGG + Intronic
915586706 1:156847657-156847679 CAGGAGCAGGTTGGGGGGGTGGG + Intronic
915603154 1:156935175-156935197 CAGGGACAGGGTGGGGAAGAGGG + Exonic
916504014 1:165411406-165411428 CAGGGATAGCAAGGAGTGGTTGG - Intronic
916584237 1:166136364-166136386 CAGGGACAGGGTGTGAGGGTTGG + Intronic
916881053 1:169019700-169019722 CAGAGGATGGATGGGGTGGTGGG - Intergenic
916932120 1:169589309-169589331 GTGGGACAGGAAGGGGTGGTAGG + Exonic
917471464 1:175329557-175329579 GATGGACAGGGTGGGGTGTTAGG + Intronic
917526912 1:175796302-175796324 CTGGGTCAGGGTGGGGAGGTGGG - Intergenic
918910526 1:190562811-190562833 CAGGCACAAGATGGGGGGATGGG - Intergenic
919640109 1:200038805-200038827 CCGGGCCAGGGTGGGGTGGGAGG + Intronic
919744133 1:200998343-200998365 GAGGGTCCGGATGGGGTGGAGGG + Intronic
920576260 1:207062951-207062973 CAGGGGCAGGAAGGGGTTATAGG + Intronic
920692840 1:208159862-208159884 GAGGGACAGCAGGGGCTGGTGGG + Intronic
921165185 1:212502011-212502033 CAGGGAGATGGTGGGGAGGTGGG + Intergenic
921482258 1:215676784-215676806 CAGGGGCAGCAAGGGGTGCTTGG - Intronic
922482336 1:225947707-225947729 CAAGGGCAGGATGTGGGGGTTGG - Intergenic
922578563 1:226680210-226680232 CATGGAAAGGCTGGGGAGGTGGG - Intronic
922612600 1:226941124-226941146 CAGGGGCAGGTTTGGGTGTTGGG + Intronic
922644323 1:227270747-227270769 CAGGCATGGGATGTGGTGGTGGG - Intronic
923545923 1:234923249-234923271 CAGGGAAAAGGTGGGGGGGTTGG - Intergenic
923965923 1:239139018-239139040 CAAGCACAGGATGTTGTGGTGGG + Intergenic
1063030656 10:2231766-2231788 GTGGGACTGAATGGGGTGGTTGG + Intergenic
1063030671 10:2231822-2231844 GTGGGACTGAATGGGGTGGTTGG + Intergenic
1063030686 10:2231878-2231900 GTGGGACTGAATGGGGTGGTTGG + Intergenic
1063030702 10:2231934-2231956 GTGGGACTGAATGGGGTGGTTGG + Intergenic
1063030718 10:2231990-2232012 GTGGGACTGAATGGGGTGGTTGG + Intergenic
1063030748 10:2232102-2232124 GTGGGACTGAATGGGGTGGTTGG + Intergenic
1063030778 10:2232214-2232236 GTGGGACTGAATGGGGTGGTTGG + Intergenic
1063030794 10:2232270-2232292 GTGGGACTGAATGGGGTGGTTGG + Intergenic
1063030824 10:2232382-2232404 GTGGGACTGAATGGGGTGGTTGG + Intergenic
1063437378 10:6045312-6045334 CAACGAAATGATGGGGTGGTGGG + Intronic
1063460873 10:6214359-6214381 CACGGACAGGGAGGGGTTGTGGG - Intronic
1063578571 10:7284277-7284299 CTGGGCAAGGATGGGGTGGAGGG - Intronic
1063979692 10:11443748-11443770 CAGGGACACGATGGGGAGTAGGG - Intergenic
1065011384 10:21423907-21423929 CAGGAACAGGTTGGATTGGTGGG - Intergenic
1065334669 10:24644438-24644460 CAAGGTCAGGGTGGGGTAGTTGG - Intronic
1065748148 10:28860666-28860688 CAGGGAAAGGATGGGTTGGGAGG + Intronic
1066512501 10:36117394-36117416 CAGGGACAGGGAGGGGTGGCTGG - Intergenic
1067088844 10:43256434-43256456 CAGGGAAAGAAAGGGCTGGTTGG + Intronic
1067567751 10:47350626-47350648 AGGGGACAGCAGGGGGTGGTGGG - Exonic
1068147130 10:53086473-53086495 CAGGGCCTGTATGGGGTGGGGGG - Intergenic
1068615115 10:59105809-59105831 CAGTGCCGGGATGGGGTGTTAGG + Intergenic
1069659242 10:70112671-70112693 GAGGGGCAGGGTGGGGAGGTGGG + Exonic
1069770452 10:70895429-70895451 AAGGGGCAGGAAGGGGTGGGGGG + Intergenic
1069783631 10:70974180-70974202 CGGGGAGAGGATGGGGTCTTTGG + Intergenic
1069797659 10:71063573-71063595 CAGGGACAGGAGGGTGGGCTTGG + Intergenic
1069880988 10:71593058-71593080 CCGGTACAGGAGAGGGTGGTGGG + Intronic
1070156678 10:73839732-73839754 CAGGGGCAGGCTGAGGAGGTAGG + Intronic
1070162142 10:73873300-73873322 CAGGGACTGGATGAGGGGGTGGG - Intronic
1070287506 10:75094620-75094642 CAGGGCCAGGCTGGTGGGGTTGG + Intronic
1070644886 10:78195041-78195063 CAGGGACCAGCAGGGGTGGTAGG + Intergenic
1071966393 10:90857303-90857325 CAGGGACACGATCAGGTAGTTGG + Exonic
1072446106 10:95500110-95500132 CCGGGAGTGGGTGGGGTGGTGGG - Intronic
1072505319 10:96060475-96060497 CCGGGGTGGGATGGGGTGGTTGG + Intronic
1072620237 10:97074821-97074843 CTGGGAGAGGATGGGGGGATTGG - Intronic
1073291257 10:102414396-102414418 GAGGGAGGGGATGGGGTGCTGGG - Intronic
1073444213 10:103571218-103571240 CAGGGGCAGGGTGTGGTGCTGGG - Intronic
1074150550 10:110755879-110755901 CAGGGCCAGGCTGAGGTGGTTGG - Intronic
1074503226 10:114044410-114044432 CAGGGACATGATGAAGAGGTTGG - Exonic
1074716888 10:116228158-116228180 CCGGGAGATAATGGGGTGGTGGG - Intronic
1074939792 10:118223390-118223412 CATGGACATGATGGGGTTGGGGG - Intergenic
1075686137 10:124366621-124366643 CAGGGAGAGGAAGGGTTGGGAGG + Intergenic
1075925219 10:126245843-126245865 CACGGAGAGGATGGGGTGACAGG + Intronic
1076076725 10:127539130-127539152 CAGGGACTGGATGAGGTTCTGGG - Intergenic
1076368323 10:129936299-129936321 CAGAGACAGGAGGGGGTGGTGGG - Intronic
1076474765 10:130744238-130744260 CAGGGACGGCAGGGGGTGCTGGG - Intergenic
1076655641 10:132021796-132021818 CGGGGAGAGGGTGGGGTGGGTGG + Intergenic
1076806688 10:132862421-132862443 CAGGGAGAGGACAGGGTGGGTGG + Intronic
1076852195 10:133098738-133098760 CTGGCACAGGATGGGGTACTTGG - Exonic
1077096640 11:801806-801828 GAGGGACGGGGTGGGGTGGAAGG + Intronic
1077406900 11:2386772-2386794 CTGGGCCAGGAGGGGGTGGGAGG - Intronic
1077413959 11:2415863-2415885 CAGTGCCATGATGGGGAGGTGGG + Intronic
1077672435 11:4168155-4168177 CAGGGGCTGGAGGGAGTGGTGGG - Intergenic
1078074922 11:8149865-8149887 GAGGGACAGTATCAGGTGGTTGG - Intronic
1078258696 11:9683741-9683763 CAGTGACAGAGCGGGGTGGTAGG - Intronic
1080053995 11:27886291-27886313 CAAGGACAGGCTGGGATGGAGGG + Intergenic
1081406556 11:42705435-42705457 CAGCGGCGGGATGGGGCGGTGGG - Intergenic
1081652606 11:44834400-44834422 CAGGGAGAGGACTGAGTGGTTGG + Intronic
1082114232 11:48310467-48310489 CAGAGAAAGAATGTGGTGGTAGG + Intergenic
1083026952 11:59559191-59559213 CATTGACAGGATGGGGATGTGGG - Intergenic
1083291258 11:61691539-61691561 CAGGGCCAGGTTGGGTTGGGGGG - Intronic
1083334111 11:61912901-61912923 CAGGGGCTGGATGGGGGGGCAGG + Intronic
1083334943 11:61916996-61917018 GAGGGACAGGTTGGGAGGGTGGG + Intronic
1083633396 11:64107339-64107361 CAAGGCCAGGAGGGGGTGGGGGG - Intronic
1084189263 11:67491631-67491653 CAGGGTCAGGATGGGGGCCTGGG - Intergenic
1084646512 11:70461999-70462021 CAGGAACAAAATGGGGTGGGTGG - Intergenic
1084650135 11:70484740-70484762 CTGGGACAGGATGGGCTGGCAGG + Intronic
1085382196 11:76130152-76130174 CAGGTAAAGAATGGGTTGGTGGG - Intronic
1085785235 11:79442330-79442352 CAGGGATGGGTTGGGGTGGGTGG + Intergenic
1086566801 11:88236511-88236533 CAGGGAGGGGATGGAGTGGGTGG - Intergenic
1086860853 11:91923320-91923342 GAGGGACAGGATGTGTTGGGTGG - Intergenic
1087209680 11:95434392-95434414 GAGAGAGAGGATGGGGGGGTGGG - Intergenic
1088719371 11:112578353-112578375 CAGGGATAAGATGGGGAGATTGG + Intergenic
1089498391 11:118919134-118919156 TAGGGAGGGGATGGTGTGGTGGG - Intronic
1090021957 11:123136444-123136466 CAGGGAGAGGAGGGTGGGGTGGG - Intronic
1090830808 11:130419759-130419781 CGGGGACGGGTGGGGGTGGTTGG - Intronic
1091057298 11:132430899-132430921 TAAGGACAGGATGGGGGGATGGG + Intronic
1091231578 11:133991243-133991265 CGGAGACAGGATGTGGTGGGTGG - Intergenic
1091282398 11:134389606-134389628 CAGGGACCCGTGGGGGTGGTGGG + Exonic
1091300130 11:134502335-134502357 CATGGACGGGGTGGGGTGTTGGG + Intergenic
1091543366 12:1482919-1482941 CTGGGGTAGGATGGGGTGATTGG - Intronic
1091673217 12:2467579-2467601 CAGAGACAGCAGGGGGTGGCGGG + Intronic
1091960709 12:4691802-4691824 GAGGGCCAGGATGGGGGGGGGGG + Exonic
1092077226 12:5684015-5684037 CAGGGACAGGAGGGAGTGCAGGG + Intronic
1092124490 12:6065799-6065821 CAGAGGCAGGATGAGGTGGGAGG + Intronic
1092238776 12:6825187-6825209 CAGTGACTAGATGGGGTGGTGGG - Intronic
1092418781 12:8312882-8312904 CTGGGTCAGGATGTTGTGGTCGG - Intergenic
1092509965 12:9144390-9144412 AAGAGGCAAGATGGGGTGGTTGG + Intergenic
1093603311 12:21057879-21057901 CAGGGATGGGATGGGATGGGAGG - Intronic
1094523779 12:31218752-31218774 CAGGGACAGGAAGAAGTGGCTGG + Intergenic
1095709791 12:45276052-45276074 CAGAGGCAGGATGGGGTAGATGG - Intronic
1096209053 12:49748357-49748379 CAGGGACAGCAGGGGCTGGTAGG - Intronic
1096477125 12:51915140-51915162 CAGGGTCAGGGTGGGGTTGGGGG - Intronic
1096541648 12:52311137-52311159 CAGGGGCAGAGTGGGCTGGTAGG + Intergenic
1096798617 12:54094403-54094425 CAGGGCAAGAATGAGGTGGTTGG - Intergenic
1097591135 12:61576823-61576845 CAGGTATAGGAAGGGGTGGAGGG + Intergenic
1097685269 12:62685024-62685046 CAGAGCCAGGAAGGGGTGGCGGG - Intronic
1101032519 12:100674570-100674592 CAGGGACTGGTTGGGATTGTTGG + Intergenic
1101079769 12:101171019-101171041 CAGGAGCAGGATGGTGTCGTGGG + Intronic
1101216716 12:102593107-102593129 TAGGCACAGGATGGGGGGCTGGG + Intergenic
1101408716 12:104452196-104452218 CAGGGAGAGAAGGGGGTGTTGGG - Intergenic
1102606762 12:114073769-114073791 CAGGGAGAAATTGGGGTGGTAGG + Intergenic
1102780854 12:115563329-115563351 CAGGAAAAGGATGAGGTGGCGGG - Intergenic
1103630071 12:122252963-122252985 CAGGGACATGTTGGGTTGGTAGG - Intronic
1103938087 12:124486996-124487018 CAGGGGTAGGATGGGGTGGGAGG - Intronic
1104219347 12:126767097-126767119 CAGAGAGAGGATGGGAAGGTGGG - Intergenic
1104335221 12:127888306-127888328 TAGAGGCAGGATTGGGTGGTTGG + Intergenic
1104532416 12:129584563-129584585 CGGAGACAGGCTGGGGTGGATGG + Intronic
1104649708 12:130522706-130522728 CAGGGAGAGGAGGAGGAGGTGGG + Intronic
1104845787 12:131846083-131846105 CAGGGGCAGGTGGGGGTGGCAGG + Intronic
1104971547 12:132533085-132533107 CAGGGAGAGGCTGGGTTGGGAGG - Intronic
1105213641 13:18272282-18272304 CTGGGACAGGGTGGAGTGGAGGG - Intergenic
1105563951 13:21524770-21524792 CAGAGGCAGGAATGGGTGGTGGG - Intronic
1105618571 13:22044930-22044952 GGGGGACAGGATGGGGTTGGTGG + Intergenic
1105636479 13:22220526-22220548 CAGGGAGGGGCTGGGGTGGCGGG - Intergenic
1105854524 13:24362201-24362223 CAGGGACTGGGTGGGGCGGGGGG - Intergenic
1105948551 13:25210015-25210037 GAGGGACAGCATGGGCTGGAAGG - Intergenic
1106593499 13:31117974-31117996 TACTAACAGGATGGGGTGGTGGG - Intergenic
1107006602 13:35619505-35619527 CAGATACAGGATGTTGTGGTTGG - Intronic
1107513504 13:41107588-41107610 CAGGGACAGGTGGTGGGGGTTGG - Intergenic
1108048123 13:46402540-46402562 GAGGGAGAGGAGGTGGTGGTTGG + Intronic
1108082341 13:46749373-46749395 CAGGGGCTGGGTGGGGAGGTGGG + Intronic
1108220834 13:48232295-48232317 CCAGGACAGAATGGGGTGGAAGG + Intergenic
1108228255 13:48312838-48312860 CAGGCACAGGATGGATTGGATGG - Intronic
1109520859 13:63508790-63508812 CAGGGACATGATGGAGTTGAAGG - Intergenic
1110570638 13:76999280-76999302 CAGTGACAGGATGCAGTGTTTGG + Intronic
1111633798 13:90877386-90877408 CATGCACGGGATGGTGTGGTCGG + Intergenic
1111726276 13:92013463-92013485 TAGGCACAGGATGGGGTAGGTGG + Intronic
1112669089 13:101614045-101614067 CAGGGACAAGAGGGGTGGGTGGG + Intronic
1112706848 13:102080034-102080056 CCGGGCAAGGATGGGGTGGGAGG + Intronic
1112972053 13:105273258-105273280 CAGGGACAGGATGGTTGGGCTGG + Intergenic
1113769456 13:112898930-112898952 GGGGCACAGGGTGGGGTGGTGGG - Intronic
1113982796 13:114290232-114290254 CAGGGACAGTCTGTGGTTGTAGG - Intronic
1114532248 14:23403309-23403331 CAGGGACAGCAGTGGGTGGGGGG + Intronic
1114535515 14:23419783-23419805 CATGGACAGAAAGGGGAGGTGGG + Intronic
1115638860 14:35318407-35318429 CAGGGACTGGAGGTGGTAGTGGG - Intergenic
1115772972 14:36685936-36685958 CAGGGAAAAGATAGGGTGGGGGG - Intronic
1118714267 14:68548187-68548209 GAGGTAGAGGAAGGGGTGGTGGG - Intronic
1118839663 14:69500978-69501000 CAGATCCAGGATGGGGTGGGCGG + Intronic
1118862490 14:69675391-69675413 CAGGGCCAGGAGGAGGTGCTGGG - Intronic
1118960430 14:70524938-70524960 AAGAGCCAGGATGGGGTGGGTGG + Intronic
1119034532 14:71218435-71218457 AAGGGCCAGGAGGGGGTGGAGGG - Intergenic
1119852332 14:77874979-77875001 CAGGGACAGGAGGGGCTTGGTGG + Intronic
1120301144 14:82708626-82708648 TAGGGATAGGAAAGGGTGGTGGG + Intergenic
1122062527 14:99146048-99146070 CAGGAACAGCCTGGAGTGGTGGG - Intergenic
1122502963 14:102213559-102213581 CAGTGACAGGATGGGATTTTAGG + Intronic
1122550807 14:102548661-102548683 CAGGGAGAGTATGGGGAGGGGGG + Intergenic
1122631572 14:103109693-103109715 CAGGGACAGGGTGGAGAGGGAGG - Intronic
1122700999 14:103589124-103589146 CAGGGGCAGGAGGTGGTGGTGGG - Intronic
1122814893 14:104307485-104307507 CAGTGCCAGGATGGGGTGTGAGG + Intergenic
1123075648 14:105666219-105666241 CAGGGACAGGAGGGGACTGTGGG + Intergenic
1123112493 14:105879899-105879921 CTGGGGCAGGAAGGGGTGGCAGG + Intergenic
1123450276 15:20355600-20355622 CAGGGAGGGGAGGGGCTGGTGGG + Intergenic
1124017141 15:25886939-25886961 CTGGCACAGAATGGGGAGGTTGG - Intergenic
1124694521 15:31852954-31852976 CAGGGACAGGCTGAGGAGGTGGG + Intronic
1124879554 15:33628586-33628608 CAGGGCCAGGTTAGGGTGGAGGG + Intronic
1124925561 15:34067008-34067030 CAGGGACCTGATGGGTGGGTGGG + Exonic
1125466730 15:39960607-39960629 GAGGAACAGGATGGGGCGGGTGG + Intronic
1125482160 15:40088500-40088522 GAGGGACTTGATGGGGAGGTGGG - Exonic
1126496168 15:49293040-49293062 CAGGCACAGGATGGAGTCTTGGG + Intronic
1127709143 15:61578460-61578482 CACGGACAGCATGTGGTAGTGGG - Intergenic
1128238114 15:66081170-66081192 CCTGGAGAGGATGGGGAGGTAGG - Intronic
1128253077 15:66177250-66177272 CAGGGATGGGGTGGGGTAGTGGG + Intronic
1128310919 15:66631356-66631378 CAGGGTCAGTCTGGGGTGGGTGG + Intronic
1128339103 15:66808201-66808223 CAGGGACAGGGAGGGGAGGCGGG - Intergenic
1128390850 15:67181473-67181495 CAGGGGCAGGGTGGGGGGGCGGG - Intronic
1128605160 15:69031542-69031564 CAGGTACAGAGTGGGGTGCTGGG + Exonic
1128740703 15:70082038-70082060 CAGGGAAAGGCTGGGGTGGGAGG + Intronic
1128945040 15:71814093-71814115 CACGGGCTGGCTGGGGTGGTGGG - Exonic
1129161623 15:73751239-73751261 CAGGGCCAGGGTGGGCTGGGGGG - Exonic
1129296907 15:74604662-74604684 CAGGGCCAGGGTGGGGAGCTTGG + Intronic
1129426512 15:75467441-75467463 CAGGGACAGGTTGGGTGGGTAGG + Exonic
1129607698 15:77032805-77032827 CAGGGCCAGAATGGGGTGTTGGG + Intronic
1129669081 15:77597176-77597198 CAGGGACAGGGTGGGGGGTGGGG + Intergenic
1129719911 15:77872287-77872309 GAGGGACGGGGTGGGGTGGGGGG + Intergenic
1129871951 15:78946182-78946204 CAGGGACATGAGGGGGTGTGAGG - Intronic
1130013870 15:80172940-80172962 CAAGGGCAGGAGGGGGTCGTTGG + Intronic
1130711251 15:86283469-86283491 CAGGGGTGGGATGGGGAGGTGGG + Intronic
1130794639 15:87195509-87195531 AAGGGCCAGGTGGGGGTGGTTGG + Intergenic
1130890005 15:88125684-88125706 CTGTGGCAGGGTGGGGTGGTGGG - Intronic
1131453758 15:92567133-92567155 GAGGGACAGCATCAGGTGGTTGG - Intergenic
1131553105 15:93374753-93374775 CAGAGGCAGGATGGGGTTGGGGG + Intergenic
1132931108 16:2459715-2459737 CAGGGACAGGACGGGGTTGCTGG - Intergenic
1132977978 16:2720003-2720025 CTGGGACAGGCTGGGGCTGTGGG - Intronic
1133007297 16:2891196-2891218 CAGGGACAGAGTGGAGTGATGGG + Intronic
1133344283 16:5059832-5059854 CAGAGATAGGATGGGGTTGGAGG + Intronic
1133358230 16:5152850-5152872 CTGGGTCAGGATGGTATGGTTGG - Intergenic
1133887411 16:9843613-9843635 CACTGACAGGATGTGGGGGTGGG - Intronic
1134041679 16:11073517-11073539 CAGGGACATGATGGCGGGTTAGG - Intronic
1134041944 16:11075754-11075776 CAGGGGGAGGATGAGGTGCTTGG + Intronic
1134447615 16:14342866-14342888 CTGGGAGAGGAGGGGGTGTTGGG - Intergenic
1134862778 16:17575504-17575526 CAGGTACAGGGTGGGGTAGGGGG - Intergenic
1135725708 16:24852569-24852591 GAGGGTCTGGTTGGGGTGGTTGG - Intronic
1135752377 16:25067302-25067324 CAGGGACAGGCAGTGGTGATTGG + Intergenic
1136020769 16:27438380-27438402 CAGGGGCAGGAGGGCCTGGTTGG + Intronic
1137401001 16:48154508-48154530 CAGAGACAGTAAGGAGTGGTGGG - Intronic
1137709422 16:50555950-50555972 CAGGGAGAGGGTGGGGGGGAAGG - Intronic
1137787849 16:51152221-51152243 CGGGGAGGGGATGGGGTGGCGGG - Intergenic
1137830513 16:51539213-51539235 CAGGCACAGGATGGGGGAGAGGG + Intergenic
1139041498 16:63004455-63004477 CAGGGAGAGGAAGGGGGGTTTGG - Intergenic
1139187125 16:64820144-64820166 CAGGCACAGGGTGGGAGGGTGGG - Intergenic
1139429510 16:66903721-66903743 CAGGGATAGGATGAGGGGGCTGG - Intergenic
1139530502 16:67540263-67540285 CAGGGACAGGAGGGGGTCAAGGG - Intronic
1139635866 16:68258037-68258059 CAGATACAGGGTGGGGTGATGGG + Intronic
1139997798 16:70996844-70996866 CATGGACTGGGTGGGGTGGTGGG + Intronic
1140544662 16:75795613-75795635 GGGGGACAGGGTGGGGTAGTGGG - Intergenic
1141258957 16:82433216-82433238 CAGGAACAGGAGTGGGTGATAGG - Intergenic
1141458162 16:84158658-84158680 CCTGCACAGGGTGGGGTGGTGGG - Intronic
1141712764 16:85709667-85709689 CAGGGAGAGGGTGAGGAGGTGGG - Intronic
1141859942 16:86709689-86709711 CAGGGACTGGATGCGGAGGACGG + Intergenic
1141876956 16:86831758-86831780 CATGGACGGGAGTGGGTGGTGGG - Intergenic
1141978452 16:87534251-87534273 CATGGACAGGGTGGGATGGACGG + Intergenic
1142039328 16:87882524-87882546 AAGTGACAGGATGGTGTCGTTGG - Exonic
1142123965 16:88401038-88401060 CAGGGAGGGGCTGGGGTGGAGGG - Intergenic
1142292736 16:89200385-89200407 CAGGAACCGGAAGGGGTGGGGGG - Intronic
1142334540 16:89479142-89479164 CAGGGACTGGGTTGGGTTGTGGG - Intronic
1142860085 17:2755918-2755940 TGGGGACCGGAGGGGGTGGTGGG - Intergenic
1143120272 17:4602282-4602304 CAGGGACAATCTGGGGTGGAAGG + Intronic
1143498291 17:7324758-7324780 CAGGGACAGGATAGGGTTTTGGG - Intronic
1143610654 17:8015852-8015874 CGGGGACAAGACGGGGAGGTGGG + Intronic
1143633889 17:8153454-8153476 CAAGGATAGGTTGGGGAGGTGGG + Intronic
1143854789 17:9840657-9840679 AAGGGAAGGGATGGGATGGTTGG + Intronic
1144779446 17:17800501-17800523 CAGGGACAGGATGGGGTGGTCGG - Intronic
1145064032 17:19749927-19749949 CAGGGGCTGGACTGGGTGGTAGG + Intergenic
1145759210 17:27416375-27416397 CTGGGGCGGGATGGGGTGGAGGG + Intergenic
1145959540 17:28879455-28879477 CAGGGCCAGGGTGGGGAGCTGGG + Exonic
1146237560 17:31182023-31182045 CTGTGATAGGATGGGGTGTTTGG + Intronic
1146520514 17:33522129-33522151 CAGTGACAGGAAGGAGTGGGGGG - Intronic
1146790294 17:35747076-35747098 CTGGGGGAGGATGGGGTGGGGGG + Exonic
1147387578 17:40091191-40091213 GAGGGTCAGGGTGGGGTGGCAGG - Intronic
1147421457 17:40323998-40324020 CAGGGCCAGGGTGGGGAGATAGG - Intronic
1147888261 17:43698978-43699000 CAGGGATAGGGTGGAGTGATAGG - Intergenic
1148094296 17:45041727-45041749 CAGGCACGAGAAGGGGTGGTGGG + Intronic
1148355393 17:46972259-46972281 CAGGGAGAAGATGGGATGGAAGG - Intronic
1148458577 17:47824385-47824407 CAGGGGCAGGCTGGGGAGCTTGG + Exonic
1148580180 17:48738285-48738307 CAGAGACAGGTTGGGGAGCTGGG + Intergenic
1148683170 17:49486214-49486236 CAGGTACAGGAAGTGGTGGGAGG + Intergenic
1148856752 17:50583157-50583179 AAGGGACTGGCTGGGGTGGGAGG - Intronic
1148995006 17:51701920-51701942 CCAGGGCAGGATGGGGTGGCCGG - Intronic
1150101107 17:62424216-62424238 CAGGGACAATGTGGAGTGGTCGG + Exonic
1150227940 17:63533875-63533897 CAGGGACAGGACCTGGGGGTGGG - Exonic
1150266298 17:63834390-63834412 CAGGGACAGGAAGGGTTTCTAGG + Intronic
1150442719 17:65204150-65204172 CAGGAACAGCCTGGGGTGGGAGG - Exonic
1150755076 17:67904730-67904752 GAGTGACAGGATATGGTGGTTGG + Exonic
1150915119 17:69429059-69429081 CAGGGACAGGACTTGGTGGTTGG + Intronic
1151595265 17:75074509-75074531 CAGGGACAGGATGCCTAGGTGGG + Intergenic
1151748536 17:76024199-76024221 TGGGGGCAGGATGGGGTGGAGGG - Intronic
1151994804 17:77601779-77601801 CAGGGGCAGGATGGGGGCGGAGG + Intergenic
1152100850 17:78301082-78301104 CAGGAACAGGATGAGGTGAAGGG - Intergenic
1152159606 17:78659296-78659318 GAGGGATAGGGTGGGGTGGGGGG - Intergenic
1152338168 17:79709704-79709726 CAGGGAGGGGAGGGGCTGGTGGG - Intergenic
1152338195 17:79709791-79709813 CAGGGAGGGGAGGGGCTGGTGGG - Intergenic
1152338236 17:79709922-79709944 CAGGGAGGGGAGGGGCTGGTGGG - Intergenic
1152338251 17:79709966-79709988 CAGGGAGGGGAGGGGCTGGTGGG - Intergenic
1152338266 17:79710010-79710032 CAGGGAGGGGAGGGGCTGGTGGG - Intergenic
1152338280 17:79710054-79710076 CAGGGAGGGGAGGGGCTGGTGGG - Intergenic
1152338295 17:79710098-79710120 CAGGGAGGGGAGGGGCTGGTGGG - Intergenic
1152338323 17:79710185-79710207 CAGGGAGGGGAGGGGCTGGTGGG - Intergenic
1152338350 17:79710272-79710294 CAGGGAGGGGAGGGGCTGGTGGG - Intergenic
1152408754 17:80111653-80111675 CAGTGAGAGGATGGGGTTTTGGG + Intergenic
1152521234 17:80858141-80858163 CAGGGACAGGACGGTGTGGGGGG - Intronic
1152589990 17:81206911-81206933 CAGGGAAGGGATGGGGTGTCTGG - Intronic
1152595291 17:81234813-81234835 CAGGGGCAGCGTGGGGTGGCAGG - Intronic
1152700953 17:81819564-81819586 GAAGGACAGGCTGGGGTGGGAGG + Intergenic
1152734095 17:81988504-81988526 CAGGGACAGCAGGAGGTGGTGGG + Intronic
1152921762 17:83069393-83069415 CTCCGACAGCATGGGGTGGTGGG - Intergenic
1153026489 18:677484-677506 CAGGGAGAGGAAGGGGTGAAAGG + Intronic
1153357133 18:4149792-4149814 CACGGACAGGGTGGGGAGGTGGG - Intronic
1153779076 18:8478498-8478520 AAGGACCAGGATGGGGTGGGTGG + Intergenic
1153981313 18:10313049-10313071 CTGGGGCTGGACGGGGTGGTGGG - Intergenic
1154217170 18:12423680-12423702 CAGGGGCAGGCAGGGCTGGTGGG + Intronic
1154390621 18:13933398-13933420 CAGGGAGAGGAAGGAGTAGTTGG - Intergenic
1155043920 18:22087522-22087544 CAGGGACAATTTGGGGTGGGGGG - Intergenic
1155096437 18:22560105-22560127 CAGGGAGTGGAAGGGGAGGTTGG + Intergenic
1155144077 18:23069100-23069122 GAGGGAAAGGAGGGGGTGGGGGG + Intergenic
1155848315 18:30736936-30736958 CAGGGCCTGTTTGGGGTGGTGGG + Intergenic
1156514887 18:37671171-37671193 CAGCCACAGGATGGGGTGCATGG - Intergenic
1157612903 18:48969527-48969549 CACGTACAGGCTGAGGTGGTTGG - Intergenic
1157728455 18:49983551-49983573 AGGGGCCGGGATGGGGTGGTGGG - Intronic
1158290228 18:55932448-55932470 TAGGCACAGGATGGGGTAGGCGG - Intergenic
1158685805 18:59613174-59613196 CAGGGCATGGATGGGGTGGGGGG + Intronic
1158783874 18:60685362-60685384 CAGGGGCAGGAAGGGGTTGCGGG + Intergenic
1159011899 18:63065867-63065889 CAGGCACAGGATGGGGAGAAAGG - Intergenic
1159796431 18:72849931-72849953 TAGGGTCAGGATCGGGTGATGGG - Intronic
1159923356 18:74246627-74246649 CAGGGAGAGTATGGGGAGGTGGG - Intergenic
1160365235 18:78318999-78319021 GAGGGACTGGATGGGGTAATGGG + Intergenic
1160387101 18:78503382-78503404 CAGGGCTCGGATGGGGTGCTGGG + Intergenic
1160826338 19:1082193-1082215 CAGGGACAGGAGGGGCGGGGTGG + Intronic
1160908024 19:1460855-1460877 CAGGTACAGGGCGGGGTGCTGGG + Exonic
1160961478 19:1723590-1723612 CAGAGACAGGAGGGGATGGAGGG + Intergenic
1161086121 19:2335587-2335609 CAGGGACAGAGGGGTGTGGTGGG - Intronic
1161091337 19:2361302-2361324 CAGGGCTGGGATGGGTTGGTGGG + Intergenic
1161217375 19:3101148-3101170 CAGGGACGGAGTGGGGTGGGGGG + Intronic
1161408839 19:4105070-4105092 CAGAGACAGGATGTGGTGCAGGG + Intronic
1161486127 19:4536836-4536858 CAGGGGCAGGATGGGGCTGAAGG - Exonic
1161852562 19:6745181-6745203 CGGGGGCAGGGTGGGGAGGTGGG + Intronic
1162179853 19:8860980-8861002 CAGGTACAAGGTGGGGTGGCTGG - Exonic
1162433401 19:10642852-10642874 CAGGGGGAAAATGGGGTGGTCGG - Intronic
1162524187 19:11197801-11197823 CAGGGACAGCAGGCGGTGGGGGG - Intergenic
1162567602 19:11453017-11453039 CAGGCCCAGGGTGGGGTGGATGG - Exonic
1163587756 19:18173268-18173290 GAGGGGCAGGATGTGGGGGTTGG + Intronic
1163635501 19:18435361-18435383 CAGGGACAGCACGGGGTGGAAGG + Exonic
1163678357 19:18666673-18666695 CAGAGACAGGCTCAGGTGGTCGG - Intronic
1163718098 19:18884063-18884085 TAAGGACAGGATCGGGTGGCAGG - Intronic
1163752037 19:19083882-19083904 CAGGGGCATGCTGGGGTGGTGGG - Intronic
1163752057 19:19083942-19083964 CAGGGGCACGCTGGGGTGGTGGG - Intronic
1163752074 19:19084002-19084024 CAGGGGCATGCTGGGGTGGTGGG - Intronic
1163752092 19:19084062-19084084 CAGGGGCACACTGGGGTGGTGGG - Intronic
1164402645 19:27912225-27912247 CAGGTACAGGATGAGTTGCTAGG - Intergenic
1164566157 19:29327484-29327506 CAGGGAGAGGCTGGGGAGGCGGG - Intergenic
1164690157 19:30204916-30204938 GAGTGCCAGGTTGGGGTGGTGGG + Intergenic
1165181695 19:33977152-33977174 AAGGCACAGGATGAGGTGGAAGG + Intergenic
1165682875 19:37792402-37792424 CTGGAAGAGGAGGGGGTGGTGGG + Intronic
1165689954 19:37855534-37855556 GAGGGACAGGATGGGGAGAGCGG + Intergenic
1165742301 19:38211396-38211418 CGGGCACAGGCTGGGGCGGTCGG + Intronic
1165893860 19:39130145-39130167 AGGGGTCAGGGTGGGGTGGTGGG + Intronic
1166250921 19:41570363-41570385 CAGTGAGAGGATGGGCAGGTGGG - Intronic
1166333495 19:42091770-42091792 CAGGGGCAGGATGGCATGGCTGG + Intronic
1166387241 19:42389205-42389227 CAGGGACAGACTGGGGTTGCCGG - Intronic
1166563309 19:43747732-43747754 CAGGGGCTGCAGGGGGTGGTGGG + Exonic
1166851941 19:45765433-45765455 CAGGGACAGGAATGGGAGGGGGG - Exonic
1167045803 19:47048166-47048188 TAGGGATTGGAGGGGGTGGTAGG - Intronic
1167247856 19:48384495-48384517 CGGGGACATGATGAGGTGGGAGG + Intronic
1167508586 19:49883920-49883942 CAGGGACAGGATGGGAAAGAAGG + Intronic
1167608009 19:50492145-50492167 CAGGGAGAGGAAGGGGAGGCAGG + Intergenic
1167645498 19:50703174-50703196 CAGGAAGAGGATGGGGGGGGTGG - Intronic
1167688493 19:50970781-50970803 CAGGCAGTGGTTGGGGTGGTTGG + Intergenic
1167762199 19:51456999-51457021 CAGGGACAGGATGGGGACAGGGG + Intronic
1168069978 19:53943622-53943644 TGGGGACAGGGTGGGGTGGGGGG + Exonic
1168294203 19:55370663-55370685 AAGGGAAAGGGGGGGGTGGTCGG + Intergenic
925338091 2:3113331-3113353 AGGGGCCAGGATGGGGTGATGGG + Intergenic
925363351 2:3294891-3294913 CAGGGAGAGAATGGGCTGGATGG - Intronic
925363535 2:3295813-3295835 CAGGGAGAGGATGGGCTGGATGG - Intronic
925363544 2:3295850-3295872 CAGAGAGAGGATGGGCTGGATGG - Intronic
925363557 2:3295914-3295936 CAAGGAGAGGATGGGCTGGATGG - Intronic
925363565 2:3295951-3295973 CAGAGAGAGGATGGGCTGGATGG - Intronic
925363606 2:3296154-3296176 CAGGGAGAGGAGGGGCTGGATGG - Intronic
925363652 2:3296366-3296388 CAGAGAGAGGATGGGCTGGATGG - Intronic
926238842 2:11069602-11069624 CAGGGAAAGGATGGGGGGACTGG - Intergenic
926659610 2:15449679-15449701 CAGGGTTAGGATCTGGTGGTAGG - Intronic
927709168 2:25314492-25314514 CAGGGGCTGGTTGGGGTGGGAGG - Intronic
928712591 2:34024095-34024117 CAGGGAAAGGATGGGGTACAGGG - Intergenic
928769043 2:34683863-34683885 CAGAGACAGGATAGGGTGGAAGG + Intergenic
929083254 2:38142422-38142444 CAGGGGCAGGGTGTGGTGGGGGG - Intergenic
930561015 2:52959908-52959930 CAGGCTCAGGATGCGGTGGGTGG + Intergenic
930659569 2:54040275-54040297 AAGGAACAGGATTTGGTGGTAGG + Intronic
930713048 2:54567221-54567243 CAGAGTGAGGATGGGGTGGTAGG + Intronic
931225378 2:60324808-60324830 AAGGCACAGGGTGGGGTGGAAGG - Intergenic
931411030 2:62031802-62031824 CAGGGAAAGGCTTGTGTGGTGGG + Intronic
932445686 2:71779667-71779689 CAGGGACAGACTGAGGTGGGTGG - Intergenic
932478590 2:72024596-72024618 TGGGGACAAGATGGGGTGGGGGG - Intergenic
932599037 2:73111759-73111781 GAGGGACAGGATGGGGGTGGGGG + Intronic
932621188 2:73265690-73265712 TAGGGGCAGGATGGGGAGTTTGG - Intronic
933213027 2:79593582-79593604 CAAGGACAGGATGACATGGTGGG - Intronic
933223315 2:79716134-79716156 CAGGGCCAGGGTGGAGTTGTGGG + Intronic
933986732 2:87598004-87598026 AAGGGACATGATGGTGTGGAAGG + Intergenic
934300687 2:91774464-91774486 CTGGGACAGGGTGGAGTGGAGGG + Intergenic
934886624 2:98030885-98030907 CAGGGAGATGATAGGATGGTGGG - Intergenic
935756890 2:106283357-106283379 CAGAGACAGGAATTGGTGGTTGG + Intergenic
936307111 2:111352805-111352827 AAGGGACATGATGGTGTGGAAGG - Intergenic
936517671 2:113192667-113192689 CAGGGACGGGAAGGGGAGGGTGG - Intronic
937272330 2:120660949-120660971 CAGGGCCAGGCAGGGGTGGAGGG + Intergenic
937311740 2:120907010-120907032 CAGGGACAGGTTGGTGTGGAGGG - Intronic
937320577 2:120958425-120958447 GAGGGACAGGATGGGATGGATGG - Intronic
937523051 2:122734858-122734880 CAGGGATAGAAAGGGGTGGGGGG + Intergenic
937559130 2:123199382-123199404 AATGGACAGGGTGGGGTGGAGGG - Intergenic
937988073 2:127647570-127647592 GAGGGACAGCCTGGGGTGGAGGG + Intronic
937988924 2:127651544-127651566 CAGGGCCAGGATGCGCTGGGTGG - Exonic
938097685 2:128474216-128474238 CCAGGACAGGATGGGGCGCTGGG + Intergenic
938097836 2:128475096-128475118 CTGGGAGAAGATGGGGTGCTGGG - Intergenic
938333204 2:130463518-130463540 CAGGGACAGCATGGCCTGGATGG + Exonic
938356608 2:130657153-130657175 CAGGGACAGCATGGCCTGGATGG - Exonic
939659064 2:144865111-144865133 CTGGGATAGGATGAGGTGGGAGG + Intergenic
940033486 2:149289099-149289121 CAGGGGTGGGGTGGGGTGGTGGG + Intergenic
940845738 2:158640222-158640244 AAGGGAGAGGAAGGGCTGGTGGG - Intronic
942105466 2:172629324-172629346 TGGGTACAGGATGGGGTGGTGGG - Intergenic
942173670 2:173310656-173310678 CAGGGAGAGGTTGGGTTGGGTGG + Intergenic
942470115 2:176251223-176251245 CAGGGAAAGAATGGTTTGGTGGG - Intergenic
942784793 2:179688463-179688485 GGGGGACAGGGTGGGGTTGTGGG - Intronic
943342988 2:186703550-186703572 CAGAAACAGGATGGGTAGGTAGG + Intronic
943626937 2:190211644-190211666 CAGGGACAGGAGGGAGTTGGGGG - Intronic
943838957 2:192552773-192552795 TAGGCACAGGATGGGGTGCATGG + Intergenic
944822007 2:203440879-203440901 CAGGGATAGGAGGAGGTGGGGGG + Exonic
947611291 2:231526500-231526522 CAGGGAGGGGACGGGGTAGTAGG + Intronic
947633264 2:231666898-231666920 CCGGGACAGGAAGGGGTGAAGGG + Intergenic
947904377 2:233749677-233749699 CAAGGACAGGATCTGGTGGGAGG + Intronic
948060347 2:235038876-235038898 CAGGTACATGATGTAGTGGTTGG + Intronic
948533282 2:238627439-238627461 CAGGGACCAGATGTGATGGTTGG + Intergenic
948877503 2:240837507-240837529 CAGGGACAGGCTGAGGAGGTAGG - Intergenic
949047330 2:241877922-241877944 GAGGGACAGGTTGGGGGGGCCGG - Intergenic
1170451017 20:16483816-16483838 CTTGGAGAGGAGGGGGTGGTTGG - Intronic
1170480659 20:16761866-16761888 CAGGGGCACCATGGGGTGGCTGG + Intronic
1170606905 20:17881647-17881669 CAGGGAGAGGTTGGGGAGGTGGG + Intergenic
1170684894 20:18560509-18560531 GAGGCAGAGGATGGGGTGATGGG + Intronic
1171117690 20:22540315-22540337 CAGGGGCTGGCAGGGGTGGTGGG + Intergenic
1171185575 20:23121875-23121897 CAGGCACAGGATGGTGGGGGTGG + Intergenic
1171213835 20:23337342-23337364 CAGATAAAGGATGGGGTGCTGGG - Intergenic
1171797801 20:29579937-29579959 CAGGGCAAGAATGAGGTGGTTGG + Intergenic
1171850446 20:30304224-30304246 CAGGGCAAGAATGAGGTGGTTGG - Intergenic
1172010649 20:31844118-31844140 AAGGGAGAGGAAGGGGAGGTAGG - Intergenic
1172443873 20:34983166-34983188 CAGGGACTGGGTGGGGAGGGAGG - Intronic
1172578970 20:36031668-36031690 CAGGGACAGGGTGGGGGACTTGG - Intergenic
1172647327 20:36479048-36479070 TATGGACAGGATGGGGTGGTTGG + Intronic
1172965731 20:38833294-38833316 CAGGGACAGGAGTGGGTTGGAGG + Intronic
1173184413 20:40829720-40829742 CAGGGACAGGCTGGGATGGGGGG - Intergenic
1173459280 20:43229930-43229952 CATGGTAAGGCTGGGGTGGTTGG + Intergenic
1173586523 20:44187052-44187074 CAGTGAAAGGGTGGGGTGGAGGG + Exonic
1173871348 20:46344002-46344024 CAGGAACAGGATGGGAGGCTTGG + Intergenic
1174868934 20:54165492-54165514 CATGGACAGGGCAGGGTGGTGGG - Intronic
1175421328 20:58836002-58836024 CAGTGACAGGAAGGAGTGTTGGG - Intergenic
1175627576 20:60501469-60501491 CAGGGATAGGGTGAGGTTGTGGG + Intergenic
1175627611 20:60501592-60501614 CAGGGATAGGATGAGGTTATGGG + Intergenic
1175790601 20:61737876-61737898 CAGAGACAGGAGGCTGTGGTTGG + Intronic
1176043773 20:63082062-63082084 CAGGCAGAGGCTGGAGTGGTGGG - Intergenic
1176257166 20:64158586-64158608 CAGGGACAGGTGGGGCAGGTCGG - Intronic
1177855467 21:26395686-26395708 CAGGAACTGGATCAGGTGGTGGG + Intergenic
1178141581 21:29690000-29690022 CAAGGAGAGGATGGGGAGGGAGG + Intronic
1178897828 21:36574916-36574938 AGGGGACAGGGTGGGGTGGAGGG - Intronic
1179046631 21:37850556-37850578 CAGGGGCAGGAGGAGGGGGTGGG - Intronic
1179329912 21:40390025-40390047 AAGGGACAGGGTGGGGTGGTGGG - Intronic
1179365031 21:40751048-40751070 GAGGGACAGGAAGGGGAGATAGG - Intronic
1181495243 22:23283929-23283951 CAGGGCCAGCCTGGGGTGATGGG - Intronic
1181699042 22:24609600-24609622 CTGGGACAGGGTGGAGTGGAGGG + Intronic
1181743911 22:24942614-24942636 CAGGGATATGGTGGAGTGGTTGG - Intronic
1181804567 22:25367090-25367112 AAGGAACAGGGTGGGGAGGTGGG - Intronic
1182137626 22:27920088-27920110 CAGGGAGAATTTGGGGTGGTGGG + Intronic
1182336761 22:29588786-29588808 CAGGGAGAGGAGGGGTGGGTGGG - Intergenic
1182421126 22:30249060-30249082 CATGGACAGGAGGGGGAGGCTGG - Intergenic
1182742644 22:32579728-32579750 CAGGGGCCAGAAGGGGTGGTGGG + Intronic
1183073119 22:35410180-35410202 CAGAGACAGGGTGGTGTGGAGGG - Intronic
1183342094 22:37287069-37287091 CAGGAAGAGGATGGGGAGGAGGG + Intronic
1183564262 22:38601849-38601871 GAGGAACAGGCTGGGGCGGTGGG + Intronic
1183910395 22:41074815-41074837 CAGGGACAGCATGGCCTGGATGG + Intergenic
1183956073 22:41381567-41381589 GAGGGAGAGGCTGCGGTGGTTGG + Intronic
1184653249 22:45928822-45928844 CAGGGCCAGGATGGCCGGGTAGG - Intronic
1184774996 22:46618683-46618705 CTGGACCAGGCTGGGGTGGTGGG + Intronic
1185050909 22:48553509-48553531 CAGGGACAGGATGGTGGGAGAGG + Intronic
1185081681 22:48712863-48712885 GAGGGACAGGCAGGGCTGGTGGG + Intronic
1185246414 22:49775545-49775567 CGGGGACCGGCTGGGGTGGTTGG - Intronic
1185291762 22:50030934-50030956 AAGGAACAGGTTGGGGTGCTGGG + Intronic
1185337355 22:50276565-50276587 CAGGCTCAGCATGGGGTAGTGGG + Intronic
949635473 3:5977097-5977119 CAGGGACACTATGTGGTGTTTGG - Intergenic
950088531 3:10278496-10278518 GAGGGAGAGGGTGGGGAGGTGGG + Intronic
950186294 3:10947741-10947763 AAGGGTCAGAATGGGGAGGTTGG + Intergenic
950430639 3:12948994-12949016 CAGGTACAAGATGCCGTGGTGGG + Intronic
950447635 3:13047444-13047466 CTGGGGCAGGCTGGGGTGGACGG + Intronic
950464081 3:13143044-13143066 AAGAGACGGGATGGGGTGGAGGG - Intergenic
950609307 3:14115281-14115303 CAGGGACAGGAAAGAATGGTGGG + Intronic
950613053 3:14138429-14138451 CCTGGACTGGATGGGGTGGTAGG + Intronic
952255878 3:31695387-31695409 TAGGGACTGGATGGGGTGAATGG - Intronic
952892279 3:38051352-38051374 CAGGGACAGGTGGGGTTGGGTGG - Intronic
953686805 3:45084310-45084332 CAGTGGCAGGAAGGTGTGGTAGG + Exonic
954009461 3:47622647-47622669 GAGTGCCAGGATGGGGTGGTAGG - Intronic
954390812 3:50267206-50267228 CAGGGACCGGCTGGGGTGGCCGG - Intergenic
954553866 3:51503453-51503475 CAGGGTGAGGATGGGCTTGTGGG - Intergenic
954661777 3:52230330-52230352 CTGGGACAGGATGGTGTGGAGGG + Intronic
954711560 3:52507580-52507602 CAGGGGCAGGATGGGGAGAGGGG - Intronic
954798373 3:53172907-53172929 CAGGGAAGGGGTGGGGTGGAGGG + Intronic
955091569 3:55756791-55756813 GAGGAAGGGGATGGGGTGGTAGG - Intronic
955628779 3:60949577-60949599 CAGCGACAGGATAGGGAGGAGGG - Intronic
957062749 3:75495439-75495461 CTGGGTCAGGATGGTGTGGTTGG - Intergenic
957501675 3:81066330-81066352 GAGAGACAAGATGGGGTGGATGG - Intergenic
957792775 3:84960557-84960579 CAGAGAGAGGATGGAGAGGTAGG - Intronic
957891551 3:86365366-86365388 GAGAGACAGCATGAGGTGGTGGG - Intergenic
958083722 3:88779929-88779951 CAGGGACAGAATGATATGGTAGG - Intergenic
958973440 3:100638484-100638506 TAGGCACAGGATGGGGGAGTAGG + Intronic
961290648 3:125843977-125843999 CTGGGTCAGGATGGTATGGTTGG + Intergenic
961464206 3:127071647-127071669 CAGGGACAGGGTGGGGCAGGTGG + Intergenic
961766060 3:129211980-129212002 GAGGGTCAGGGTGGGGTAGTGGG - Intergenic
961807756 3:129501453-129501475 CAAGAAAAAGATGGGGTGGTAGG - Intronic
961914839 3:130363476-130363498 GAGGGACAGGATGGTGTAATGGG + Intronic
962095158 3:132285440-132285462 TAGGCACAGGATGGGGGGATGGG + Intergenic
962871127 3:139493992-139494014 CAGGGTCAGGATGCTGTGCTTGG - Intergenic
963251047 3:143103897-143103919 CAGAGAGAGGATGTGGGGGTGGG - Intergenic
963655869 3:148049514-148049536 CAGGTACAGGATTGGGGGATAGG - Intergenic
963770622 3:149382717-149382739 CAGGCTGAGGGTGGGGTGGTGGG - Intergenic
964341592 3:155714274-155714296 CAGGGCAGGGATGGGGTGGGAGG + Intronic
964703627 3:159595375-159595397 CAGGGAAGGGAAGGGGAGGTGGG + Intronic
965450526 3:168832875-168832897 CTGGGCCAGGGTGGGGTGGATGG - Intergenic
966280047 3:178215364-178215386 CTGGGAAGGGTTGGGGTGGTGGG + Intergenic
966876282 3:184323704-184323726 GAGGGACAGGAGAGGGTGGTGGG - Intronic
969006650 4:4025572-4025594 CTGGGTCAGGATGGTGTGGTTGG - Intergenic
969037971 4:4271161-4271183 CAGAGACTGGAAAGGGTGGTGGG - Intronic
969196809 4:5569640-5569662 CAGGGGCAGGCAGGGGTGGGAGG + Intronic
969243814 4:5919412-5919434 CAGGGGCAGGTGGGGGTGGGGGG + Intronic
969563252 4:7962747-7962769 CAGGGAGTTGATGGGGGGGTGGG - Intergenic
969806328 4:9611843-9611865 CTGGGTTAGGATGGTGTGGTTGG + Intergenic
970563691 4:17309766-17309788 CAAGGGCAGGATGTGGTGGTAGG + Intergenic
970756184 4:19429303-19429325 ATGGCACAGGATGGGGGGGTGGG + Intergenic
971230019 4:24794143-24794165 CAGGGTGGGGGTGGGGTGGTGGG + Intronic
971308789 4:25506351-25506373 CAGGGACGGCATGGGGTGGAAGG - Intergenic
973728741 4:53802858-53802880 CAGGGGCAGCATATGGTGGTTGG + Intronic
973745157 4:53956786-53956808 AGGGAACTGGATGGGGTGGTGGG + Intronic
974303247 4:60097908-60097930 TAGGCACAGGATGGGGGCGTGGG - Intergenic
975385274 4:73750805-73750827 CAGGGAGGGGGTGGGGTGGGGGG + Intergenic
975767515 4:77684479-77684501 CAGTAACAGGAGGGGGAGGTAGG - Intergenic
975896185 4:79093768-79093790 CAGGGGCAGGATGTGGGGGGAGG - Intergenic
978189464 4:105895591-105895613 GAGGAACAGGTTGGGGTGGTGGG - Exonic
979659541 4:123237884-123237906 CAGGAACTGGAAGGGGTTGTGGG + Intronic
980117467 4:128692947-128692969 GAGGGACAGCATCAGGTGGTTGG - Intergenic
980528569 4:134020646-134020668 CAGGAACAGGTTGGTGTTGTAGG - Intergenic
981283133 4:142984185-142984207 CAGGGATGGGATGGGGTGCTTGG - Intergenic
982376626 4:154697889-154697911 CATGGACTGGCTGGGCTGGTGGG - Intronic
984456232 4:179973140-179973162 CATTGACAGGCTGGGGTTGTTGG - Intergenic
985073264 4:186189822-186189844 CAGGTGCAGGATGAGGTGGGTGG - Intergenic
985963256 5:3319826-3319848 GAGGCACAGGCTGGGGTGGAAGG + Intergenic
986008829 5:3693386-3693408 CAAGGACAGACTGGTGTGGTCGG + Intergenic
986615996 5:9618196-9618218 CAGGGGTAGGGTGGGGTGGGGGG + Intergenic
987025648 5:13924152-13924174 TAGGGACAGCATGGGGAAGTGGG - Intronic
987251874 5:16108529-16108551 CAGGGAGAGGAAGGGATTGTGGG + Intronic
990276409 5:54201665-54201687 CAAGTACAGCATGGGGAGGTAGG - Intronic
990443749 5:55872758-55872780 CATTGGCAGGGTGGGGTGGTGGG - Intronic
990786526 5:59426593-59426615 TCGGGGCAGGGTGGGGTGGTAGG - Intronic
990929091 5:61066921-61066943 CTGGGACAGGAAGGGGTGGTTGG + Intronic
990974680 5:61548923-61548945 CTGGGGCAGAATGGGGTGGGAGG + Intergenic
991672282 5:69060378-69060400 CATGGACAGCAGGGGGTGATGGG + Intergenic
992570800 5:78054957-78054979 CAGGGAAAGGATGGGGAAATGGG + Intronic
992933819 5:81680084-81680106 CAAGAACAGGGTGGGGTGGCAGG - Intronic
993774981 5:91982424-91982446 CAGGGAAAGGATGAGAAGGTGGG - Intergenic
994878254 5:105451987-105452009 CAGGGACAGAATGATATGGTTGG + Intergenic
995582351 5:113615341-113615363 CAAGGACAAGGTGGGGTGGAAGG + Intergenic
995948552 5:117681235-117681257 CAGGGACAGGATGGAGGAATGGG - Intergenic
997235081 5:132268006-132268028 CAGTGCCAGGATGACGTGGTGGG + Intronic
997847197 5:137297649-137297671 GAGGAACAGGGTGGGGAGGTGGG + Intronic
998199890 5:140111370-140111392 CAGGGACTGGCAGGGGGGGTGGG + Intronic
998359619 5:141573764-141573786 CAGGCAAAGGAGGTGGTGGTGGG + Exonic
998359653 5:141573875-141573897 CAGGCAAAGGAGGGGGTGGAGGG + Exonic
998400093 5:141844219-141844241 GAGGCAGAGGTTGGGGTGGTAGG - Intergenic
998401234 5:141850125-141850147 CAGGTGCAGGATGGGGTGGGAGG - Intergenic
998849298 5:146338670-146338692 CTGGGACAGGACGGAGAGGTTGG + Intronic
999132242 5:149293072-149293094 CAGGGACAAGAGGGCATGGTGGG - Intronic
1000253254 5:159514815-159514837 CAGCAACAGGGTGGGGTGGGGGG - Intergenic
1000557094 5:162739486-162739508 CAGGGACAGGATGGAGCTGGAGG - Intergenic
1000806716 5:165804149-165804171 CAGGGACAGGGTGGGGGGTGGGG + Intergenic
1001452157 5:171835222-171835244 CAGGGAGAGGATGGGCGGGATGG + Intergenic
1001793282 5:174480075-174480097 CAGGGCCTGGATGTGGTGGAGGG - Intergenic
1001823315 5:174726199-174726221 CAGGTAGGGGATGGCGTGGTGGG - Intronic
1002047633 5:176550756-176550778 GAGGGTCAGGGTGGGGAGGTGGG - Intronic
1002101745 5:176861330-176861352 CAGGTTCAGGATGGGGTGGATGG + Intronic
1002159293 5:177305601-177305623 CAGGAGCAGGATGGGCTGGAAGG + Intronic
1002273228 5:178086524-178086546 CCGGGCCAGGATGGGGTGGACGG + Intergenic
1002556954 5:180049521-180049543 TAGGGACAGGATTCAGTGGTGGG - Intronic
1003113478 6:3267481-3267503 CAGAAAGAGGATGGGGTTGTAGG - Intronic
1003122381 6:3328916-3328938 CAGGGACAGGATGAGAGAGTGGG - Intronic
1003263485 6:4546463-4546485 CAGGCTCAGGATGGGGTTCTGGG - Intergenic
1003869592 6:10391155-10391177 CAGGGAGAGGAAGGACTGGTAGG - Intergenic
1004128637 6:12898390-12898412 CGGGGACATGTTGGGGTTGTGGG - Intronic
1004289164 6:14350805-14350827 CAGAGACAGCATGGGATGGTTGG - Intergenic
1004295515 6:14406503-14406525 GAGAGAGAGGTTGGGGTGGTGGG - Intergenic
1004907571 6:20250795-20250817 TAGGCACAGGATAGGGTGGCAGG + Intergenic
1005467152 6:26126327-26126349 TAGGGAAAGGAGGGGGTGGAGGG - Intronic
1006303605 6:33206870-33206892 AAGGGAAAGGAGGGGGAGGTGGG - Intergenic
1006393040 6:33770082-33770104 AAGGGACAGTATGGGGCGGTGGG - Intergenic
1006744803 6:36334154-36334176 CAGGGAAAGCATGTGCTGGTGGG - Intronic
1006803218 6:36772338-36772360 CAGTGAGAGGACGGGCTGGTTGG - Intronic
1006807421 6:36797695-36797717 CAGGGACAGGATGGGACGGGAGG + Intronic
1006931710 6:37692681-37692703 GAGGGACAGGCTGGGGGGGAAGG - Intronic
1006945343 6:37780664-37780686 CAGGTGCAGAGTGGGGTGGTGGG + Intergenic
1007163645 6:39812584-39812606 CAGGGGCAGGGTGGGGAGGCGGG - Intronic
1007309814 6:40936423-40936445 AAGGGACAGGAGGAGGTGGCTGG - Intergenic
1007581714 6:42963925-42963947 CTGGGAGAGGGTGGGGGGGTGGG - Exonic
1007619646 6:43204170-43204192 CAGGGTGGGGATGGGGTAGTGGG - Intronic
1007622257 6:43222424-43222446 CAGAAGCAGGTTGGGGTGGTGGG + Intronic
1007636795 6:43304602-43304624 ATGGGGCAGGCTGGGGTGGTAGG + Intronic
1007665171 6:43509516-43509538 GAGGGACTGGATGGAGCGGTTGG + Exonic
1007767486 6:44169622-44169644 CAGGGTCAGAATGGGGTAGTGGG - Intronic
1007789787 6:44302356-44302378 CTAGGAGAGGGTGGGGTGGTAGG + Intronic
1007847964 6:44776422-44776444 CAGGGATTGGTTGGGGGGGTGGG + Intergenic
1010012287 6:71062212-71062234 CAGAGACTGGGTAGGGTGGTGGG - Intergenic
1010556189 6:77282155-77282177 CAGGCACAGGATGGGGGAGCAGG + Intergenic
1011628463 6:89302318-89302340 GATGGACAGCATGGGGTTGTAGG - Intronic
1011768826 6:90653255-90653277 CAGGGAGTGGGTGGGGTGGGGGG + Intergenic
1012221244 6:96652001-96652023 CAGGGAGAGGATGTGGTGGGGGG - Intergenic
1012263278 6:97112020-97112042 TGGGTACAGGATGGGGGGGTGGG + Intronic
1014081885 6:117296665-117296687 AAGGGACAGGGTGGGGGAGTTGG + Intronic
1014740547 6:125143651-125143673 TAGGCACAGGATGGGGAGTTGGG + Intronic
1015059793 6:128949318-128949340 CTGGGGCAGGGTGGGGTGGGTGG - Intronic
1016121553 6:140348363-140348385 CAGGGACAGGATGTGGAAGAGGG + Intergenic
1016703379 6:147078796-147078818 CTGGCACAGGATGGGGTGAAAGG + Intergenic
1016869632 6:148803941-148803963 CAGGGAGATGATGGAGTGCTAGG - Intronic
1017538050 6:155369831-155369853 TAGGGACAGAAGGGGATGGTTGG - Intergenic
1018038198 6:159899366-159899388 CAGTGACAGCCTGGGGTGGAGGG - Intergenic
1018413242 6:163577581-163577603 TAGAGACAGGAAGGAGTGGTGGG - Exonic
1018742505 6:166741282-166741304 GTGGGAAAGGAAGGGGTGGTGGG + Intronic
1018752910 6:166822638-166822660 CATGAGCTGGATGGGGTGGTGGG - Intronic
1018917092 6:168140226-168140248 TAGTGAGAGGGTGGGGTGGTGGG - Intergenic
1019136518 6:169911934-169911956 CAGGCTCAGGATGGGGGTGTAGG - Intergenic
1019512684 7:1425949-1425971 GAGGGGCAGGATGGTGGGGTGGG - Intergenic
1019851056 7:3558000-3558022 CAGGAACAGGGTCGGGGGGTGGG - Intronic
1020122602 7:5513518-5513540 CAGGGTCAGGATGGGAAGGACGG + Intronic
1021604213 7:22394131-22394153 CAGGGAAAGGCTGGTTTGGTGGG - Intergenic
1021729241 7:23580423-23580445 CAGGGGCAGGTGGGGGTGGGTGG + Intergenic
1022471345 7:30683419-30683441 CTGGGCCAGGGTGGGGTGGGGGG - Intronic
1022875289 7:34521567-34521589 CTGGAACAGGAAGGGGTGGTGGG - Intergenic
1022908191 7:34876045-34876067 CAGGGACTGGTAGGGATGGTGGG + Intronic
1023539548 7:41250877-41250899 CAGGGACAGCACAGGGTGGGAGG + Intergenic
1024063822 7:45717100-45717122 CAGGCACAGCATGGCGTGGCTGG - Exonic
1024120505 7:46232913-46232935 AAGGGACAGGAAGGAGTGATTGG + Intergenic
1024246718 7:47476312-47476334 CAGGCACAGAATGTAGTGGTAGG - Intronic
1024575941 7:50764186-50764208 CAGGGACAGGACAGGGTGGATGG - Intronic
1024929389 7:54654040-54654062 GAGGGACACCATGAGGTGGTTGG - Intergenic
1024970861 7:55068878-55068900 CAGGGACAGGGGTGAGTGGTGGG + Intronic
1026323070 7:69284317-69284339 CAGGGCCAGGCTGAGGTGGCGGG - Intergenic
1026455962 7:70572686-70572708 CAGTGTCGGGATGTGGTGGTTGG + Intronic
1026477435 7:70749124-70749146 GTTGGACAGGATGCGGTGGTGGG - Intronic
1026578448 7:71594175-71594197 CAGGGACCAGCTGGGGTGGATGG + Intronic
1026840732 7:73668731-73668753 CAGGGGCAGGGAGGGGAGGTTGG + Intronic
1026878640 7:73894215-73894237 CAGGGTGAGGTTGGGGTGGAGGG + Intergenic
1026978716 7:74514345-74514367 CAGGGCCAGGATGGGGGACTGGG + Intronic
1027046424 7:74994227-74994249 CAAGGCCAGGGTTGGGTGGTGGG + Intronic
1027222068 7:76220537-76220559 CAGGGCCAAGATGGGGTGTCCGG - Intronic
1027748907 7:82116171-82116193 GAGGTGCAGGATGGGGTGGAGGG + Intronic
1029494715 7:100890595-100890617 AGGGGACAGGAGGGGGAGGTTGG + Exonic
1029704878 7:102270933-102270955 CAGGGAGATGATGGGGTGCGTGG - Intronic
1032030259 7:128477079-128477101 CAGGGACAATGTGGAGTGGTCGG + Exonic
1032196574 7:129792802-129792824 CAGGCACAGGCTGGGATGGCAGG - Intergenic
1032446789 7:131991065-131991087 CAGGACCAGGGAGGGGTGGTGGG + Intergenic
1032458544 7:132092593-132092615 CAGGGACAGAGTGGCGGGGTAGG - Intergenic
1033343914 7:140512656-140512678 CTGGGGCAGGAAGGGGTGATGGG + Intergenic
1033509314 7:142039068-142039090 CAGGAACAAGACGGGGTGGGGGG + Intronic
1033608940 7:142947167-142947189 CAGGGACAGGAGGAGGTAGCTGG + Intronic
1033924195 7:146437236-146437258 CACGGACAGGAGGGTGAGGTTGG - Intronic
1034184102 7:149161115-149161137 CAGGGTGAGGAGGTGGTGGTGGG - Intronic
1034228676 7:149501990-149502012 AAGGCACAGGATGGGGTGTGTGG + Intergenic
1034309148 7:150071677-150071699 CAGTGTGAGGATGGTGTGGTCGG + Intergenic
1034797707 7:154028959-154028981 CAGTGTGAGGATGGTGTGGTCGG - Intronic
1034898835 7:154894988-154895010 CATGGAAAGAATGGGGTGGGTGG + Intergenic
1034980526 7:155473125-155473147 CAGGGACAGTCAGGGGTGGGTGG - Intergenic
1035466504 7:159083090-159083112 CAGGGACAGGCAGGGATAGTTGG - Intronic
1035535015 8:384276-384298 AAGGGACACGTTGGGGAGGTGGG + Intergenic
1035546428 8:485277-485299 CAGTGAAAGGCTGGGGTGGGAGG - Intergenic
1036116646 8:5966921-5966943 CAGAGACTGGGTGGGGTGGGTGG - Intergenic
1036369466 8:8150339-8150361 CTGGGTCAGGATGTTGTGGTCGG + Intergenic
1036881422 8:12515306-12515328 CTGGGTCAGGATGTTGTGGTCGG - Intergenic
1037623470 8:20587595-20587617 CAGAGACAGGGTGGGGGGGGGGG + Intergenic
1037659749 8:20916510-20916532 CTGGCAGAGGCTGGGGTGGTGGG - Intergenic
1037773026 8:21814029-21814051 CAGGGGCGGCAGGGGGTGGTGGG - Intergenic
1038333631 8:26628996-26629018 CGGGTGCAGGAGGGGGTGGTTGG + Intronic
1038459431 8:27703425-27703447 AGGGGACAGGATGGGGTGGCTGG + Intergenic
1038778647 8:30552458-30552480 CAGCGACAGGATGGGAAAGTGGG + Intronic
1039298085 8:36180283-36180305 CAGGGGCAGAATGGTATGGTTGG - Intergenic
1039331891 8:36546804-36546826 GAGGGACAGCATCAGGTGGTTGG + Intergenic
1039391487 8:37184431-37184453 CAGTGAGAGGATGGGTGGGTAGG + Intergenic
1039648475 8:39314109-39314131 CAGGGACTGTATGGGCTGTTCGG + Intergenic
1039964549 8:42274464-42274486 CAGAGGCAGGAAAGGGTGGTGGG - Intronic
1040835854 8:51731001-51731023 CAGGGGCAGAATGATGTGGTTGG - Intronic
1041131986 8:54710815-54710837 TAGGCACAGGATGGGGAGGTGGG + Intergenic
1041171744 8:55149475-55149497 GTGGGCCTGGATGGGGTGGTGGG + Intronic
1041308759 8:56492223-56492245 CAGGGACTGGATGTGGGGGAAGG - Intergenic
1041526958 8:58817019-58817041 CGGGGACAGGCTGGGGTGGGTGG + Intronic
1041610932 8:59847940-59847962 GTGGGACAGGATGTGGAGGTGGG + Intergenic
1044545685 8:93456537-93456559 CGGGGAGAGTAGGGGGTGGTTGG + Intergenic
1045231486 8:100310427-100310449 CAAGGACAGGTCGGGGTGGCTGG + Intronic
1046214631 8:111127277-111127299 GAGGGAGAGGGTGGGGTGGTGGG + Intergenic
1046915992 8:119678972-119678994 CTGGGACAGGCTGGGGCGGTAGG - Intergenic
1048227771 8:132605932-132605954 CAGGGACATAATGGGGTCGGGGG + Intronic
1048299285 8:133239491-133239513 CATGGACAGCATGGGGTCATGGG - Intronic
1048375474 8:133818928-133818950 CAGGGTCAGCTTGGGGTGGGGGG + Intergenic
1048593729 8:135845111-135845133 CAGGGACAGGATAGGGAAGCTGG + Intergenic
1049301404 8:141872536-141872558 CAGGGTCAGGTGAGGGTGGTGGG + Intergenic
1049301508 8:141872931-141872953 CAGGGGCAGGGGAGGGTGGTGGG + Intergenic
1049423093 8:142525430-142525452 CAAGGACAGGAGGGGCTGCTGGG - Intronic
1049566050 8:143339727-143339749 CAGGGACAGGGAGGGGAAGTGGG + Intronic
1049751279 8:144285415-144285437 CAGCGACAGGAGGGAGTGGGGGG + Intronic
1049800199 8:144514136-144514158 CAGGGCCGGGATGGGCTGGGCGG - Intronic
1050203361 9:3172619-3172641 AAGGGCCAGGATGGGGTTATGGG + Intergenic
1050221252 9:3393035-3393057 AAGGGACAGGAAGGGTGGGTGGG + Intronic
1050561076 9:6834858-6834880 CAGGGACAGCACGGGCTGGATGG - Intronic
1051427682 9:16950289-16950311 CAGGGAGAGGATGGGGCTGAAGG + Intergenic
1051660742 9:19423998-19424020 CACGGACTTAATGGGGTGGTGGG + Intronic
1051887186 9:21905346-21905368 CAGGCACAGGATGGGGGGCGTGG + Intronic
1051943750 9:22540751-22540773 CTGGGACAAGATGTGGAGGTAGG - Intergenic
1052955439 9:34250192-34250214 CAGAGAAAGGAGGGGGTAGTTGG - Intronic
1052963371 9:34319549-34319571 CAGGAAGATGAAGGGGTGGTCGG - Intronic
1052994865 9:34546574-34546596 CAGGGAGAGGCTGGAGTGGTGGG + Intergenic
1053285942 9:36849687-36849709 AAGGGGCAGGATGGTGTGGTGGG - Intronic
1053441700 9:38121431-38121453 CAGGGACAGGAAGGGTGGGAGGG + Intergenic
1053788226 9:41667515-41667537 CAGGGCAAGAATGAGGTGGTTGG - Intergenic
1054156913 9:61647253-61647275 CAGGGCAAGAATGAGGTGGTTGG + Intergenic
1054176508 9:61878854-61878876 CAGGGCAAGAATGAGGTGGTTGG - Intergenic
1054476685 9:65578261-65578283 CAGGGCAAGAATGAGGTGGTTGG + Intergenic
1054661027 9:67701952-67701974 CAGGGCAAGAATGAGGTGGTTGG + Intergenic
1056930082 9:90867009-90867031 CAGGGACAGGAGGGGGTTAGTGG + Intronic
1057237385 9:93372820-93372842 CAGGGACAGAATGTGGGGGCGGG + Intergenic
1057805211 9:98215038-98215060 CAGGGACAGGATTGGATAGGGGG - Intronic
1057899976 9:98941121-98941143 TGGGGACAATATGGGGTGGTGGG + Intergenic
1058307613 9:103463308-103463330 CATGGAAAGGATGTGGTGGGAGG - Intergenic
1058417434 9:104803230-104803252 CAGGGGGAGGATGGTGTTGTAGG - Intronic
1058539395 9:105995752-105995774 CAGGGCCAGGATGGGGACGCTGG + Intergenic
1058720700 9:107760904-107760926 CAGGGAGAGGATGAAGGGGTAGG + Intergenic
1058747184 9:108003144-108003166 TATGGACAGTGTGGGGTGGTAGG - Intergenic
1059438202 9:114288911-114288933 CAGGGACAGGAGGGTGTGCAAGG + Exonic
1059874859 9:118623246-118623268 TAGGGTGAGAATGGGGTGGTGGG - Intergenic
1060135971 9:121153991-121154013 GAGGGAGATGATAGGGTGGTAGG + Intronic
1060190688 9:121590407-121590429 CACAGATAGGCTGGGGTGGTGGG - Intronic
1060485251 9:124042343-124042365 CAGGGCCAGGAGGGGGAGGCAGG - Intergenic
1060648792 9:125306415-125306437 AAGGGAAAGGAAGGGATGGTTGG - Intronic
1060940601 9:127541002-127541024 CAGGTCCAGCATGGGGAGGTGGG + Intronic
1061422436 9:130479635-130479657 GAGGGAGAGGGTGGGGTGGCGGG + Intronic
1061512161 9:131068048-131068070 CAGGAGCAGGAAGGGGTGTTGGG - Intronic
1061895502 9:133644762-133644784 CAGGGACGGGAAGGGGAGCTGGG + Intronic
1062048424 9:134435007-134435029 CGAGGACAGGAGGGGGTGGCAGG + Intronic
1062262212 9:135668452-135668474 CAGGGAAAGGAGGGCGTGCTTGG - Intergenic
1062317847 9:135977272-135977294 CTGGTGCAGGGTGGGGTGGTGGG + Intergenic
1062572486 9:137191981-137192003 CAGGGCCAGGAGGGGTGGGTGGG + Exonic
1062678886 9:137765674-137765696 CGGGGACAGGCTGGGGCGGCGGG - Intronic
1185491187 X:518202-518224 CAGGGACCAGTTGGGGTGGGAGG + Intergenic
1185847860 X:3456671-3456693 CAGGCACAGGCTGGGGGGGGGGG - Intergenic
1185910415 X:3975829-3975851 CAGGCCCAGGATGTGGTGCTGGG - Intergenic
1186320034 X:8414180-8414202 CAGGGCCAGGATGGAGTGCCCGG + Intergenic
1186635510 X:11400068-11400090 AAGGGAAAGGGAGGGGTGGTTGG + Intronic
1186660891 X:11666115-11666137 CCGGGACAGGGCGGGGTGGGGGG - Intergenic
1187478773 X:19635762-19635784 CAGGGACAGGAGGGGGTGGTTGG - Intronic
1188355184 X:29182108-29182130 CAGGGAAGGCATGGGGTGGGGGG - Intronic
1188648603 X:32601019-32601041 TTGGGAAATGATGGGGTGGTAGG + Intronic
1189613540 X:42762870-42762892 GAGAGACAAGATGGGGTGGATGG - Intergenic
1189812863 X:44797301-44797323 CAGCTACTGGATGAGGTGGTGGG - Intergenic
1190185309 X:48228567-48228589 CAGGGCCTGCATGAGGTGGTAGG + Intronic
1190190708 X:48274635-48274657 CAGGGCCTGCATGAGGTGGTGGG + Intronic
1190664845 X:52687240-52687262 CAGGGCCTGCATGAGGTGGTGGG + Intronic
1190674577 X:52771179-52771201 CAGGGCCTGCATGAGGTGGTGGG - Intronic
1190720441 X:53143379-53143401 CAGACGCAGGATGGCGTGGTGGG + Intergenic
1190760917 X:53437650-53437672 CAAGGAAAGGATGGTGTGGGTGG - Intergenic
1190773369 X:53533482-53533504 CAGGGAGGGGAGGGGCTGGTGGG - Intronic
1190878511 X:54476301-54476323 TAGGGACGGGATGGGGCAGTGGG - Intronic
1191206105 X:57835422-57835444 CAGGGACAGTTTGGGGTTATTGG - Intergenic
1191758788 X:64624595-64624617 CAGCCACAGGAAGGGGAGGTTGG - Intergenic
1192738951 X:73874950-73874972 CAGGGAGGGAATGGGGAGGTGGG + Intergenic
1194385727 X:93252567-93252589 CAGGGGCTGGGTGGGGTAGTGGG - Intergenic
1195168045 X:102239564-102239586 CAGGGGCAGGATGCAATGGTTGG - Intergenic
1195190812 X:102447523-102447545 CAGGGGCAGGATGCAATGGTTGG + Intronic
1195314267 X:103663248-103663270 CAGGGACAGATTCGGGTTGTGGG - Intergenic
1197645711 X:129014410-129014432 CAGGGACACAATGTGGTGGGAGG + Intergenic
1197846640 X:130810697-130810719 CAGGGACAGGCCTGGATGGTGGG - Intronic
1197977797 X:132183615-132183637 GAGAGACAGGTTGGGGTGGAAGG + Intergenic
1197995502 X:132368301-132368323 AAGGGGCAGGGTGGGGTGGGGGG - Intergenic
1198370724 X:135986079-135986101 CAGGGAAAGGGTGGGGGGCTGGG - Intronic
1198602363 X:138297165-138297187 CAGAGACAGCATGGTGTGTTAGG + Intergenic
1198686782 X:139235844-139235866 CAGGGATGGGATGAGGTGCTAGG - Intergenic
1199680037 X:150217881-150217903 AAGGGAAAGGAGGGGGTGGGGGG + Intergenic
1200075358 X:153548001-153548023 TAGGGACAGCAGGAGGTGGTGGG + Intronic
1201017584 Y:9622188-9622210 CAGGGACAGGGTGGGGCAGCAGG - Intergenic
1201472238 Y:14346310-14346332 CAAGGTCAGGGTGGGGTGGGAGG - Intergenic
1201609375 Y:15823676-15823698 CAGGCACAGAATGGGGAGGTGGG + Intergenic
1202332655 Y:23770888-23770910 GAGGGGCAGGATGGGGTGTGAGG + Intergenic
1202538114 Y:25899175-25899197 GAGGGGCAGGATGGGGTGTGAGG - Intergenic