ID: 1144781217

View in Genome Browser
Species Human (GRCh38)
Location 17:17809594-17809616
Sequence CCTGAGCTGGACGGCGGCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 223}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144781217_1144781235 27 Left 1144781217 17:17809594-17809616 CCCCCGCCGCCGTCCAGCTCAGG 0: 1
1: 0
2: 1
3: 24
4: 223
Right 1144781235 17:17809644-17809666 CCGAAAACCCGCAGGCGTCGGGG 0: 1
1: 0
2: 0
3: 1
4: 22
1144781217_1144781229 19 Left 1144781217 17:17809594-17809616 CCCCCGCCGCCGTCCAGCTCAGG 0: 1
1: 0
2: 1
3: 24
4: 223
Right 1144781229 17:17809636-17809658 CGCCGCCGCCGAAAACCCGCAGG 0: 1
1: 0
2: 1
3: 6
4: 55
1144781217_1144781232 25 Left 1144781217 17:17809594-17809616 CCCCCGCCGCCGTCCAGCTCAGG 0: 1
1: 0
2: 1
3: 24
4: 223
Right 1144781232 17:17809642-17809664 CGCCGAAAACCCGCAGGCGTCGG 0: 1
1: 0
2: 0
3: 2
4: 11
1144781217_1144781233 26 Left 1144781217 17:17809594-17809616 CCCCCGCCGCCGTCCAGCTCAGG 0: 1
1: 0
2: 1
3: 24
4: 223
Right 1144781233 17:17809643-17809665 GCCGAAAACCCGCAGGCGTCGGG 0: 1
1: 0
2: 0
3: 1
4: 20

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144781217 Original CRISPR CCTGAGCTGGACGGCGGCGG GGG (reversed) Intronic
900525005 1:3124226-3124248 CCTGAGCTGGAGGCCGGCAGTGG + Intronic
901020901 1:6254914-6254936 CCGGAGCTGGCAGGCGGCTGTGG + Exonic
901489265 1:9588596-9588618 CCGGAGGTGGAAGGCGGCGCGGG - Intergenic
902808042 1:18872901-18872923 CCTGCGCTGGACGTCGCCGCAGG - Exonic
905151456 1:35931098-35931120 CCCGGGCAGGTCGGCGGCGGCGG + Exonic
905569497 1:38991985-38992007 CCTGGCCTGGAGGGCGGGGGTGG + Intronic
911073179 1:93847887-93847909 CCTGAGAAGAGCGGCGGCGGCGG + Intergenic
912771265 1:112466014-112466036 GCTGAGATGGAGGGTGGCGGAGG - Intergenic
913162202 1:116154550-116154572 CCTGAGCTGGACAGAAGCTGTGG - Intergenic
913544392 1:119853256-119853278 CCTGGGCTGGCGGGCGGGGGAGG - Intergenic
915143693 1:153782029-153782051 CCTGAGCCGGCCGGGCGCGGTGG - Intergenic
919365741 1:196658710-196658732 CCTGAGCAGGCCGGGCGCGGTGG - Intronic
919640223 1:200039229-200039251 CCTGAGCCAGAGGGCGGTGGAGG + Intronic
919744475 1:201000019-201000041 CATGGGCAGGACGGCGGCAGCGG + Intronic
920704986 1:208244237-208244259 CTGGAGCGGGAGGGCGGCGGAGG - Exonic
923035418 1:230281680-230281702 CCTGAGCTGGGAGGCGGCTTTGG + Exonic
923783008 1:237042460-237042482 GCGGAGCTCGGCGGCGGCGGCGG - Exonic
1063144996 10:3288735-3288757 CCTGAGGTTGACGGTGGCCGTGG - Intergenic
1065140473 10:22714454-22714476 GCTGAGCGCGCCGGCGGCGGCGG - Exonic
1065188868 10:23192950-23192972 CCTGAGCGGAGCGGCGGCTGCGG + Exonic
1069386253 10:67885216-67885238 CCTGAGGTTGAGGGCGGCTGGGG + Intronic
1070800804 10:79243447-79243469 CGGTAGCCGGACGGCGGCGGCGG + Intronic
1070833593 10:79434818-79434840 CTGGAGCTGGACGGTGGCGATGG - Intronic
1072710791 10:97714469-97714491 CCCGCGCGGGGCGGCGGCGGGGG - Exonic
1074377270 10:112950760-112950782 CCGCAGCTGAACGGCGGTGGAGG + Exonic
1075748429 10:124743981-124744003 CCGGGGCCGGGCGGCGGCGGCGG - Intronic
1076317088 10:129550315-129550337 CCGGTGCTGGGCGGCGGTGGTGG - Intronic
1076750085 10:132538054-132538076 GCTGGGCTGGGCGGCGGCGGCGG - Exonic
1077351298 11:2094411-2094433 CCTGAGCTGGATGGCCCGGGAGG + Intergenic
1077416424 11:2426300-2426322 CCTGGGCTGGCCGGCGGGGGCGG - Intergenic
1078593062 11:12662445-12662467 CATGAACTGGAGGGTGGCGGGGG + Intergenic
1083343123 11:61971833-61971855 GCTGAGCTGGAGGGTGGGGGAGG - Intergenic
1083476839 11:62920729-62920751 GCTGAGGTGGACGGGGGTGGTGG + Intronic
1083618270 11:64036730-64036752 CCTGAGCCGGGCGGGGGCTGGGG + Intronic
1083710960 11:64548053-64548075 CCTGAGCATGACCGGGGCGGGGG + Intergenic
1083897680 11:65628384-65628406 CCTGAGCTCAAAGGGGGCGGTGG - Intronic
1083995274 11:66268705-66268727 GCTGCGCTGGACGGCGCGGGCGG - Intronic
1084003927 11:66313502-66313524 CCTGAGCTGGAAGGCTGAGCTGG - Intergenic
1084204655 11:67584504-67584526 CCAGAGCTGGAAGGAGGAGGTGG + Exonic
1084643950 11:70443460-70443482 CTGGAGCTGGACGGCGGCGACGG + Intergenic
1084888508 11:72225059-72225081 CCTGAGCCGGGCGGCCGCGGAGG + Exonic
1086107083 11:83157746-83157768 CCTGAGTTGGAGGGGGGTGGGGG - Intronic
1089296245 11:117470062-117470084 CCTGAGCTGGAGGGCTCCTGGGG + Intronic
1089622423 11:119729409-119729431 CCCCAGCTGGAAGGCGGCCGAGG - Intergenic
1089697188 11:120223126-120223148 CCTGAGCTGGCCAGCAGCAGAGG - Intronic
1096497141 12:52045227-52045249 CCTCAGCTGGACGGGGGAGCCGG - Intronic
1096623340 12:52878151-52878173 CCTAAGCTGAAAGGCGGAGGGGG - Intergenic
1097017431 12:55997383-55997405 GCTGAGCTGGGCAGCGGAGGGGG + Intronic
1099067893 12:78006733-78006755 CCTGAACTGGGAGGCTGCGGGGG - Exonic
1101371826 12:104137847-104137869 CCGGAGCTCAACGGCGGCGAGGG + Intronic
1101781172 12:107837967-107837989 CCTGAGCTGGACGAAGGCACAGG + Intergenic
1102371025 12:112382344-112382366 CCTGAGGGCGGCGGCGGCGGCGG - Intronic
1103321587 12:120095574-120095596 CCTCATCTGGTCGGGGGCGGGGG - Exonic
1103410991 12:120711031-120711053 CCTGAGCCGGCCGGGGGCCGAGG + Intronic
1104052806 12:125207661-125207683 CCAGAGATGGATGGCGGCGATGG - Intronic
1106304985 13:28501401-28501423 CCTGAGCTGGCCGGGCGCGGTGG - Intergenic
1107058544 13:36131365-36131387 CCAGAGGAGGGCGGCGGCGGCGG + Intergenic
1111951653 13:94713014-94713036 CCGGAGCTCGCCGGCCGCGGAGG + Intergenic
1113541773 13:111115150-111115172 CGTGCGCGGGGCGGCGGCGGCGG - Intronic
1119656325 14:76419852-76419874 CCTGAGCTGCCCGGCAGAGGGGG + Intronic
1121017624 14:90558111-90558133 CCTGGGCTGGACGGCAGGCGTGG - Intronic
1121319983 14:92986646-92986668 ACTGAGCTGGAGGGCGCTGGAGG + Intronic
1121368160 14:93333107-93333129 CCTGAGCGGGACGACGGCAGGGG - Intergenic
1122856238 14:104561448-104561470 CCTGAGCAGCACGGAGGCTGGGG + Intronic
1122916934 14:104863806-104863828 CCTGGGCTGGAGGGCGGGGGGGG - Intergenic
1123013009 14:105358234-105358256 CAGGAGCTGGACGCCGGCGTGGG + Intronic
1123671610 15:22664679-22664701 CCGGAGCTGGACGTGGGCGGCGG + Intergenic
1123710131 15:22980590-22980612 CCTGCGCGGGACGGCGGGGTCGG + Intronic
1123966894 15:25468274-25468296 CCTGACTTGGCCGGGGGCGGTGG + Intergenic
1124118212 15:26867190-26867212 GCGGAGCTGCAGGGCGGCGGCGG + Intronic
1124323649 15:28737904-28737926 CCGGAGCTGGACGTGGGCGGCGG + Intronic
1124527546 15:30471145-30471167 CCGCAGCTGGACGTGGGCGGCGG + Intergenic
1124771113 15:32536557-32536579 CCGCAGCTGGACGTGGGCGGCGG - Intergenic
1126406938 15:48331675-48331697 CCAGCGCTGGACAGCGGCCGGGG - Exonic
1127045133 15:55017510-55017532 CCTGAGCCGGCCGGGCGCGGTGG - Intergenic
1127328649 15:57918305-57918327 CCTGAGCTGGGAGGTGGCAGAGG - Intergenic
1128158397 15:65406857-65406879 CCTGAGCTAGACGTTGGGGGTGG + Intronic
1128877606 15:71215065-71215087 CCCGAGGACGACGGCGGCGGCGG + Exonic
1129295127 15:74596052-74596074 CCTGAGCTGGGAGGTGGCTGGGG - Exonic
1130317658 15:82810054-82810076 CCGGAGCTGGACGTGGGCGGCGG + Exonic
1132242005 15:100265423-100265445 CCAGAGCTGGACGCCGGAGACGG - Intronic
1132368659 15:101277426-101277448 GCAGGGCTGGGCGGCGGCGGCGG - Exonic
1132397024 15:101481586-101481608 CCTGTGCTGGGCGGTGGCAGGGG + Intronic
1132475968 16:138334-138356 CCTGAGGAGGACGGAGCCGGAGG + Exonic
1132503077 16:293289-293311 CCTGCGGTGGACGGAGGCTGGGG - Intronic
1132719709 16:1309707-1309729 ACCGAGCGGGGCGGCGGCGGCGG - Intronic
1132854277 16:2037873-2037895 CCTGAGCCCCACGGCGGCCGAGG + Exonic
1132915244 16:2340477-2340499 CCCGAGCTGGCCGGCGAGGGTGG + Intronic
1133156584 16:3880508-3880530 CCGGAGCCCGGCGGCGGCGGCGG - Exonic
1134607243 16:15580830-15580852 CTTGAGCTGGCCGGGTGCGGTGG - Intronic
1136523842 16:30815038-30815060 CCTGTCCTGGACGGGAGCGGTGG - Intergenic
1140219485 16:73033399-73033421 CCAGTGCTGGGGGGCGGCGGGGG - Intronic
1140223130 16:73058232-73058254 CCCGGGCTCGGCGGCGGCGGCGG + Intronic
1141598588 16:85112169-85112191 CCTGAGCTGGATGGAGGTGGAGG + Intronic
1141647099 16:85373456-85373478 GCTGAGCTGGAAAGCAGCGGAGG - Intergenic
1142336092 16:89490339-89490361 CCCGAGCGGCAAGGCGGCGGCGG + Exonic
1142995041 17:3755153-3755175 CCTGAACCAGACAGCGGCGGCGG - Exonic
1143862566 17:9901632-9901654 CCTGAGCTGGACGCCAGTGTAGG + Intronic
1144500955 17:15786471-15786493 CCTGCGGCTGACGGCGGCGGGGG + Intergenic
1144527062 17:15999537-15999559 CCTGAGCGAGATGGCGGCGGCGG - Exonic
1144781217 17:17809594-17809616 CCTGAGCTGGACGGCGGCGGGGG - Intronic
1146339610 17:32007679-32007701 CCGGACGTGGGCGGCGGCGGCGG - Intergenic
1146901415 17:36591910-36591932 CCCAAGCAGGTCGGCGGCGGCGG + Exonic
1148696805 17:49565265-49565287 CCTGGGCTGGAGTGCGGTGGCGG - Intergenic
1150407972 17:64919161-64919183 CCGGACGTGGGCGGCGGCGGCGG + Intronic
1150643453 17:66964576-66964598 CCGGAGCGCGGCGGCGGCGGGGG + Intergenic
1150747249 17:67825803-67825825 CCGGACGTGGGCGGCGGCGGCGG - Exonic
1150791896 17:68205765-68205787 CCGGACTTGGGCGGCGGCGGCGG - Intergenic
1152378490 17:79930423-79930445 CCTGGGACGGAGGGCGGCGGAGG - Intergenic
1153688091 18:7566840-7566862 CCTGCGCTGCTCGGCGGCTGCGG - Exonic
1155237215 18:23832517-23832539 CCTGAGCTTGCAGGCGGAGGTGG + Intronic
1156036624 18:32772137-32772159 TCCGAGCCGGGCGGCGGCGGCGG - Exonic
1157555006 18:48607679-48607701 GCTGAGCTGGAGGGTGGTGGGGG + Intronic
1157614008 18:48976175-48976197 CGGGAGCGGGGCGGCGGCGGCGG + Intergenic
1160204706 18:76822888-76822910 CCTGGGCCGGGCGGCGGCTGAGG + Intronic
1161050979 19:2164024-2164046 CCGGAGCGCGGCGGCGGCGGCGG + Intronic
1161240167 19:3218554-3218576 CCTGAGCTGGACGGGCCTGGGGG + Intergenic
1162030877 19:7916763-7916785 CCCGGGCTCGGCGGCGGCGGTGG - Exonic
1162301570 19:9847934-9847956 CCAGAGCTGGCCAGCGGGGGAGG - Intronic
1162312433 19:9914851-9914873 GCTGAGGGCGACGGCGGCGGCGG - Intronic
1163282375 19:16325516-16325538 CCTGAAGCGGACGGCGGCGGCGG + Exonic
1163755813 19:19105652-19105674 GCTGAACTGGATGGCGGCGTAGG - Exonic
1165685637 19:37817521-37817543 CCTGAGCAAGAGGGCGGCGTGGG + Intergenic
1167596810 19:50432359-50432381 CGTAGGCAGGACGGCGGCGGGGG - Intergenic
1167643821 19:50695380-50695402 CCTGCGCCGGGCGGCGGAGGGGG + Intronic
1167697002 19:51020660-51020682 CCTGAGCTGGCCGGGCGCGGTGG + Intergenic
1168554904 19:57329797-57329819 CCTGAGATGGCCGGGCGCGGTGG - Exonic
925365045 2:3305540-3305562 GCTGAACTGGACGGCAGTGGAGG - Intronic
927885864 2:26718114-26718136 CCTGAGCTAGAGGGAAGCGGAGG - Intronic
929253060 2:39780172-39780194 CATGAGCTGGGTGGGGGCGGGGG - Intergenic
929562473 2:42964465-42964487 CCTGGGCTGGAAGGCAGAGGAGG - Intergenic
931649387 2:64454461-64454483 CCTGCGCGGGGCGGGGGCGGGGG - Exonic
933908059 2:86914275-86914297 CCTCGGCCGGGCGGCGGCGGCGG + Intronic
934011585 2:87825479-87825501 CCTCGGCCGGGCGGCGGCGGCGG - Intronic
934568307 2:95352717-95352739 CCTGAACTGGAAGGCAGGGGAGG - Intronic
938073180 2:128318902-128318924 CCGGGGCGGGGCGGCGGCGGCGG - Intergenic
942491152 2:176490698-176490720 CCTGCGCTGGGCGGCTGCTGTGG - Intergenic
942890366 2:180980634-180980656 GCCGAGCCGGGCGGCGGCGGCGG + Exonic
945431683 2:209772100-209772122 CAGGAGCAGGACGGCGGCCGCGG + Exonic
948307658 2:236961165-236961187 CCTGACCCGGGCGGTGGCGGGGG + Intergenic
1168878204 20:1185404-1185426 GCGGAGCTGTACGGCGGCGGTGG + Intronic
1170713238 20:18810557-18810579 CCTGGACTGGGGGGCGGCGGGGG - Intronic
1172058242 20:32169110-32169132 CGTGAGCTGGCCGGGTGCGGTGG + Intergenic
1172092960 20:32446619-32446641 CCAGAGCTGGAGGGCTGCAGTGG + Exonic
1172143956 20:32743420-32743442 GCTGAGCAGGGCGGCGGCGGCGG - Exonic
1173576005 20:44113336-44113358 CCTGTGCTGGGTGGCGGTGGTGG - Exonic
1174208764 20:48860432-48860454 CTGGAGCTGGACGGTGGCGAAGG + Intergenic
1174280588 20:49435990-49436012 CCTGGCCTGGAGGGCGGTGGAGG + Intronic
1174360081 20:50023415-50023437 CCTAAGCTGTGCGGCGGAGGGGG + Intergenic
1175847055 20:62064893-62064915 CCCGTTCTGGGCGGCGGCGGGGG + Exonic
1176178876 20:63740463-63740485 CCGGACGTGGACGGGGGCGGCGG + Exonic
1178417087 21:32412722-32412744 CCTGGGCAGGGAGGCGGCGGGGG + Exonic
1178663302 21:34524429-34524451 CCTGAGCTGAACGGTGGGGTTGG - Intronic
1180037798 21:45258713-45258735 GGTGAGCTGGGCGGCCGCGGGGG + Intergenic
1180908337 22:19431484-19431506 CCTCAGCCCGGCGGCGGCGGCGG - Exonic
1180914836 22:19478988-19479010 GCGGGGCGGGACGGCGGCGGAGG - Intronic
1181603274 22:23964939-23964961 CCTGACCTGGACTGGGGCTGGGG - Intergenic
1181605240 22:23976368-23976390 CCTGACCTGGACTGGGGCTGGGG + Intronic
1183058040 22:35318960-35318982 TCTGAGCTGGAGGGAGGCTGTGG + Intronic
1183926869 22:41212548-41212570 CCTGAGATGGCCGGGCGCGGTGG - Intronic
1184022960 22:41833228-41833250 CCTGAGCGGGACGGCAGGGGGGG + Exonic
1184412235 22:44331891-44331913 CATGAGCGCGGCGGCGGCGGCGG - Intergenic
950661872 3:14471822-14471844 CCTTTGCTGGAAGGAGGCGGGGG - Intronic
952848008 3:37704604-37704626 CCTGAGTTGGATGGTGGTGGTGG - Intronic
954442102 3:50527517-50527539 GCTGAGCAGGACGGTGGCTGGGG - Intergenic
955228434 3:57079301-57079323 CCTGGGCTGGGCGGGGCCGGGGG + Exonic
960747728 3:120908381-120908403 CCACAGCTGGACGGCGGCAGCGG - Intronic
961655981 3:128442022-128442044 CCTGAGCAGGTCTGCGGAGGAGG - Intergenic
961845676 3:129761036-129761058 CCTGTGCTGGCCGGGCGCGGTGG + Intronic
962583542 3:136819227-136819249 CGGGAGCCGGTCGGCGGCGGCGG + Exonic
967930431 3:194686787-194686809 GCGCAGCTGGGCGGCGGCGGCGG - Exonic
968927713 4:3558638-3558660 CCTGAGCTGTGCGGCTGCTGAGG + Intergenic
968965148 4:3765923-3765945 CCAGCGCAGGGCGGCGGCGGCGG + Intergenic
970585668 4:17512042-17512064 CAGGAGCAGGATGGCGGCGGCGG - Exonic
970823861 4:20251738-20251760 CCAGCGCTGGGCGGAGGCGGCGG - Intergenic
970823930 4:20251939-20251961 GCGGAGCTTGGCGGCGGCGGTGG + Intergenic
972162602 4:36244558-36244580 CCGGAGCTCAACGGCGGGGGCGG + Intergenic
972522065 4:39868369-39868391 CCCAAGCTGGAGGGCGGTGGCGG + Intronic
973555382 4:52076850-52076872 CCTGACCTTGACAGCGGTGGAGG - Exonic
975801064 4:78059104-78059126 CCGCGGCTGGGCGGCGGCGGCGG + Intronic
976447678 4:85150536-85150558 GCTGAGCTGGCCGGGTGCGGTGG + Intergenic
986292393 5:6410645-6410667 CCGGAGCTGCACGGTGGAGGAGG - Intergenic
987286863 5:16465874-16465896 CCTGGGCCTCACGGCGGCGGAGG - Intergenic
988577838 5:32444248-32444270 CCACAGCGGGGCGGCGGCGGCGG - Exonic
990545249 5:56815637-56815659 CCTGAGGCAGGCGGCGGCGGAGG + Exonic
991564258 5:67988295-67988317 CCTGAGCTGGGAGGCAGAGGTGG + Intergenic
992487492 5:77210562-77210584 GTCGAGCTGGGCGGCGGCGGGGG + Intronic
997292426 5:132747517-132747539 TCTGAGCTCGACGGCTGCGGCGG - Exonic
997470576 5:134114910-134114932 CCGCAGCTGGACTCCGGCGGGGG + Exonic
997621150 5:135297009-135297031 CCTGAGATGGAGGGAGGTGGGGG - Intronic
999758554 5:154682952-154682974 GCGGAGCTGGAGGGAGGCGGAGG - Intergenic
1000802602 5:165747577-165747599 CCTGACCTGGCCGGGCGCGGTGG + Intergenic
1003066066 6:2904073-2904095 CCTGAGATGGAAGGGGGTGGGGG - Intergenic
1003086117 6:3063155-3063177 CCTGAGATGGAAGGGGGTGGGGG + Intergenic
1003645261 6:7909680-7909702 CCTGAGCTGCAGGGGGGCGGAGG + Intronic
1005737922 6:28766145-28766167 GCAGAGCTGGACAGCGGCTGCGG + Intergenic
1010198461 6:73263031-73263053 CCTGAGTAGGGCGGCGGCGGCGG + Exonic
1010753895 6:79644870-79644892 CCTGAGTTGGCCGGGCGCGGTGG + Intronic
1012625939 6:101402936-101402958 TCTAAGCTGAACTGCGGCGGCGG + Intronic
1013226037 6:108119832-108119854 ACTGAGCTGGACTGGCGCGGGGG + Intronic
1015773592 6:136792483-136792505 CTTGAGCTGCACCGCGGCGCAGG - Exonic
1019426866 7:982149-982171 CCAGGGCTGGGCGGCTGCGGCGG - Intergenic
1019562632 7:1666079-1666101 CCCGAGCGCGGCGGCGGCGGCGG - Intergenic
1019630472 7:2046252-2046274 CCTCAGCTGGACGGCAGCGCAGG + Intronic
1019700348 7:2471753-2471775 CCAGCGCTGGAGGGCAGCGGGGG + Intergenic
1022698067 7:32728898-32728920 CCTGAGGATGGCGGCGGCGGCGG + Intergenic
1023418197 7:39951017-39951039 CCGCAGCAGGACGGCGGTGGCGG + Exonic
1023983358 7:45082019-45082041 CCTGAGCTGGAGGGCCTCTGAGG - Intronic
1026021299 7:66708574-66708596 CCTGGGCTGGCCAGGGGCGGTGG - Intronic
1026360533 7:69598377-69598399 GCTGAGGCGGGCGGCGGCGGCGG + Intergenic
1028985575 7:97006196-97006218 CCTGCACTCGGCGGCGGCGGCGG + Exonic
1031513291 7:122673968-122673990 CCTGAGCGGGGAGGCGGCTGAGG + Intronic
1031982308 7:128135853-128135875 CGCGAGCTCGGCGGCGGCGGCGG + Intergenic
1033812393 7:145031031-145031053 CCTGAGCTGCAAGGTTGCGGAGG + Intergenic
1034306306 7:150047736-150047758 CCCGAGGAGGACGGCGGCGCAGG - Intergenic
1034800541 7:154052917-154052939 CCCGAGGAGGACGGCGGCGCAGG + Intronic
1035380769 7:158439266-158439288 CCTGAGGTGGTCGGGGGCTGAGG - Intronic
1039254535 8:35704752-35704774 CCTGAGATGGACGAGGGCAGGGG + Intronic
1039996753 8:42541319-42541341 CCAGGGCTGGTCGGCGCCGGCGG - Intronic
1042865890 8:73356607-73356629 CATGAGCTGGAGGGAGGAGGAGG - Intergenic
1043502809 8:80873845-80873867 CCGGCGCTGCGCGGCGGCGGCGG + Intronic
1045847822 8:106658155-106658177 TCCGGGCTGGACGGCGCCGGGGG - Intronic
1046871295 8:119208376-119208398 GCGGAGCTGAGCGGCGGCGGCGG + Exonic
1048244137 8:132775386-132775408 TCAGGGCTGGCCGGCGGCGGAGG + Exonic
1049378007 8:142298210-142298232 TCTGAGCTGGACGACTGCAGTGG + Intronic
1049405403 8:142449954-142449976 CCAGAGCGGGCCGGGGGCGGCGG + Exonic
1049694795 8:143977878-143977900 CCTGAGCCGGGCAGGGGCGGGGG - Intronic
1051006745 9:12354412-12354434 CCTGAGATGGAGGGCAGCTGGGG + Intergenic
1053802569 9:41773717-41773739 CCTGAGCTGTGCGGCTGCTGAGG + Intergenic
1054142669 9:61541353-61541375 CCTGAGCTGTGCGGCTGCTGAGG - Intergenic
1054190877 9:61985063-61985085 CCTGAGCTGTGCGGCTGCTGAGG + Intergenic
1054462420 9:65472503-65472525 CCTGAGCTGTGCGGCTGCTGAGG - Intergenic
1054647495 9:67602654-67602676 CCTGAGCTGTGCGGCTGCTGAGG - Intergenic
1056116610 9:83447308-83447330 CCTGATCTGGCCGGGCGCGGTGG - Intronic
1056386250 9:86099483-86099505 CCGGAGCTCGAGGCCGGCGGCGG - Exonic
1059769868 9:117414912-117414934 GCTGAGCCGGGCGCCGGCGGCGG + Exonic
1061272330 9:129550390-129550412 TCGGAGCTGGACGGCGGCCCGGG + Intergenic
1061365906 9:130172435-130172457 CCTGGGCTGGGCGCCGGCGCCGG - Intergenic
1062433755 9:136537032-136537054 CCTGAGCAGGACAGGGGCCGCGG + Intronic
1062435718 9:136545827-136545849 CCTGCGCTGGCCGGCGGGGCTGG + Exonic
1062542021 9:137045778-137045800 CCTGGGCAGGACGAGGGCGGCGG + Intronic
1186917888 X:14243884-14243906 GCCGAACCGGACGGCGGCGGCGG + Intergenic
1187363693 X:18649978-18650000 CCTGAGCGGGGCGGCGGCGGCGG - Intronic
1189004958 X:36985727-36985749 CCCGAGCAGGAAGGCGGCGCGGG + Intergenic
1189044068 X:37572217-37572239 CCCGAGCAGGAAGGCGGCGCGGG - Exonic
1190245707 X:48688926-48688948 CCGGAGCTGGGCGGCGGTGGCGG - Exonic
1192459552 X:71305144-71305166 TCTGAGCTGGACAGAGGAGGAGG + Exonic
1200135311 X:153871872-153871894 GCTGAGCAGGAAGGTGGCGGGGG - Intronic
1200160356 X:154004633-154004655 CCAGAGCAGGAGGGTGGCGGGGG + Intergenic