ID: 1144783952

View in Genome Browser
Species Human (GRCh38)
Location 17:17821684-17821706
Sequence CAGGCTGCACAGTTGGTCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 10, 3: 14, 4: 198}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144783952_1144783961 4 Left 1144783952 17:17821684-17821706 CCAAGGACCAACTGTGCAGCCTG 0: 1
1: 0
2: 10
3: 14
4: 198
Right 1144783961 17:17821711-17821733 CACTCTTCCTAGGGCAGCGCAGG 0: 1
1: 0
2: 0
3: 14
4: 121
1144783952_1144783957 -5 Left 1144783952 17:17821684-17821706 CCAAGGACCAACTGTGCAGCCTG 0: 1
1: 0
2: 10
3: 14
4: 198
Right 1144783957 17:17821702-17821724 GCCTGGGCCCACTCTTCCTAGGG 0: 1
1: 0
2: 0
3: 14
4: 143
1144783952_1144783967 30 Left 1144783952 17:17821684-17821706 CCAAGGACCAACTGTGCAGCCTG 0: 1
1: 0
2: 10
3: 14
4: 198
Right 1144783967 17:17821737-17821759 CCCAAAGAGAATGGCAGACAGGG 0: 1
1: 0
2: 1
3: 35
4: 350
1144783952_1144783956 -6 Left 1144783952 17:17821684-17821706 CCAAGGACCAACTGTGCAGCCTG 0: 1
1: 0
2: 10
3: 14
4: 198
Right 1144783956 17:17821701-17821723 AGCCTGGGCCCACTCTTCCTAGG 0: 1
1: 0
2: 4
3: 24
4: 235
1144783952_1144783965 29 Left 1144783952 17:17821684-17821706 CCAAGGACCAACTGTGCAGCCTG 0: 1
1: 0
2: 10
3: 14
4: 198
Right 1144783965 17:17821736-17821758 CCCCAAAGAGAATGGCAGACAGG 0: 1
1: 0
2: 0
3: 17
4: 231
1144783952_1144783963 21 Left 1144783952 17:17821684-17821706 CCAAGGACCAACTGTGCAGCCTG 0: 1
1: 0
2: 10
3: 14
4: 198
Right 1144783963 17:17821728-17821750 CGCAGGATCCCCAAAGAGAATGG 0: 1
1: 0
2: 0
3: 10
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144783952 Original CRISPR CAGGCTGCACAGTTGGTCCT TGG (reversed) Intronic
900003993 1:32119-32141 AAGGCTGCAGGGTTGGTCCCAGG + Intergenic
900023720 1:202639-202661 AAGGCTGCAGGGTTGGTCCCAGG + Intergenic
900625543 1:3606965-3606987 CAGGCTGCACAGCAGGCCCCAGG - Intronic
901596014 1:10385871-10385893 CAGGGTGCTCAGTTGGATCTAGG - Intergenic
902437692 1:16409063-16409085 CAGGCAGGACCCTTGGTCCTTGG - Intronic
902611416 1:17599715-17599737 AAGGCAGCACATTTGGTCCTGGG - Intronic
903182948 1:21614260-21614282 CAGGCTGCCCAGCTGGTCAGTGG - Intronic
903348146 1:22700983-22701005 CAGCCTTCACAGATGTTCCTTGG - Intergenic
905470628 1:38189005-38189027 CAGCCTGCTAAGATGGTCCTGGG + Intergenic
906197419 1:43937461-43937483 CAGGCTGCTCACTTGGGCCTGGG + Intergenic
907161856 1:52376639-52376661 CAGGCTGTACAGGTGGTAATGGG - Intronic
912281459 1:108319168-108319190 CTGCCTGCAAAGTTGGCCCTTGG - Intergenic
912533243 1:110341253-110341275 CAGGCGGGATGGTTGGTCCTTGG + Exonic
912804284 1:112743475-112743497 CAGGCTGGACAGTTACTCCCAGG + Intergenic
913970723 1:143413776-143413798 CTGTCTGCACAGTTGGTCCTAGG - Intergenic
914065100 1:144239387-144239409 CTGTCTGCACAGTTGGTCCTAGG - Intergenic
914114051 1:144726967-144726989 CTGTCTGCACAGTTGGTCCTAGG + Intergenic
914247271 1:145895657-145895679 CTGGATGCACAGGTGGGCCTGGG + Exonic
914417533 1:147497786-147497808 CAGGCTCCACAATTGGCCTTCGG + Intergenic
916785230 1:168082295-168082317 CAGGCTAGCCAGGTGGTCCTTGG + Exonic
918071946 1:181139686-181139708 CATGCTGCAGAGGTGGGCCTAGG + Intergenic
919746452 1:201011986-201012008 CAGGCTCCCCAGGTGGTCCGGGG - Intronic
920688157 1:208125759-208125781 CTGGCTGCACAAATGGCCCTGGG + Intronic
923301178 1:232642221-232642243 CAGGCTACAGAGCTGGTCCTTGG - Intergenic
1064216940 10:13408466-13408488 AAGGCTGCCCAGTGGTTCCTTGG + Intergenic
1065755927 10:28931073-28931095 GAGGCTGCCCAGTTGGTAATGGG + Intergenic
1066195209 10:33092461-33092483 CAGGGAGCACAGTTAGTCCCTGG + Intergenic
1067107845 10:43377460-43377482 GAGTCTGCACAGGTGGACCTAGG + Intergenic
1067583119 10:47457981-47458003 CAGGCTGGACAGTGGGTGATTGG - Intergenic
1069081903 10:64097407-64097429 CAGGCTGCAATCTGGGTCCTTGG + Intergenic
1070801215 10:79245412-79245434 CAGGCACCACAGTTGGCACTGGG - Intronic
1072506547 10:96073547-96073569 TAAGCTGCACAGTTGGTTCTGGG + Intergenic
1072518181 10:96207428-96207450 CAGGCTTCACAGTAGGGACTAGG + Intronic
1072994301 10:100229555-100229577 CAGGTTCCACAGTTGTTCCAAGG + Exonic
1074422526 10:113322072-113322094 CAAGCTCCACAGGTGGTTCTGGG + Intergenic
1076212587 10:128660321-128660343 CTGGCTGCACAGTTGACACTTGG + Intergenic
1077440393 11:2566153-2566175 CAGGCTGCAAAAGTGGCCCTGGG - Intronic
1077616255 11:3676201-3676223 AAGGCTGCGCAGTTCGTCCATGG + Exonic
1079124362 11:17708314-17708336 CAGGGTGCACAGTAGGAGCTTGG - Intergenic
1079128274 11:17733894-17733916 CCATCTTCACAGTTGGTCCTGGG - Intergenic
1081452238 11:43182449-43182471 CATGCTGCACAATTGGTCTGGGG + Intergenic
1082056278 11:47819941-47819963 CAGGCTGCAGAGTTGGAGCAGGG - Intronic
1083831631 11:65237191-65237213 CAGGCTTCAAATTTGGTTCTGGG + Intergenic
1084037283 11:66519804-66519826 CATGCTCCACAGTTAGTTCTGGG + Intronic
1084734525 11:71095771-71095793 CAAGCTGCAGAGTGGTTCCTAGG - Intronic
1085508039 11:77071256-77071278 CAGGCTGCACACTGGGGCCAGGG - Intronic
1088599579 11:111462693-111462715 CAGGAGGCACAGGTGGTGCTAGG + Intergenic
1091377417 12:34171-34193 AAGGCTGCAGGGTTGGTCCCAGG + Intergenic
1091450446 12:569411-569433 CAGGGGGCACAGTTGAACCTGGG - Intronic
1093739995 12:22674551-22674573 CATGCTCTACAGCTGGTCCTAGG + Intronic
1095789616 12:46150516-46150538 CAGGCTGTTCAGCTGTTCCTTGG + Intergenic
1096426709 12:51510069-51510091 CAGCCTGCACAGCTGGTACGAGG + Exonic
1096434415 12:51576605-51576627 CAGGGTGCGCAGTAGGCCCTAGG + Intergenic
1096591404 12:52662273-52662295 CAGGCTGCACCGCTGCTCGTTGG + Intergenic
1102868178 12:116391012-116391034 CAGGGTGCACACATGGTCCCAGG + Intergenic
1103095083 12:118126232-118126254 CAGGCAGCACCTTTGATCCTAGG - Intronic
1103175685 12:118861366-118861388 CAGCCTGCACAGATAGCCCTTGG + Intergenic
1105509350 13:21038199-21038221 CAGGCTCCACCTTTGCTCCTGGG - Intronic
1112225123 13:97532114-97532136 CAGCCTGCAAAGTTGGTGCCAGG - Intergenic
1113399704 13:109979555-109979577 CAGGATGCACTGTGGGTCCTGGG + Intergenic
1113849581 13:113410556-113410578 CAGGACGCACAGCTGCTCCTTGG - Intergenic
1114736679 14:25049866-25049888 CAGGCTGCACGGTAGGACCGGGG - Exonic
1117674054 14:58138256-58138278 GAGGCTGCACAGGTGGCTCTGGG - Exonic
1118689356 14:68323232-68323254 CAGGCTGGACAGTTAGTCGGTGG + Intronic
1121104079 14:91269560-91269582 GAGGCTGCAGAGATGGTCCTGGG + Intergenic
1122820097 14:104338532-104338554 CTGGCTGCACACTTCGTCCCGGG + Intergenic
1124214113 15:27792493-27792515 CAGTCTGCACAGTCCTTCCTGGG + Intronic
1124560500 15:30769661-30769683 CAGGCTGCACAGTTTTTGCAGGG - Intronic
1124850259 15:33330075-33330097 CAGACTGGACAGTTTTTCCTTGG + Intronic
1125336397 15:38630691-38630713 AAAGCTGCACTGTTGGCCCTTGG - Intergenic
1129251911 15:74313875-74313897 CAGGCTTGACAGCTGGGCCTTGG + Intronic
1129945605 15:79536955-79536977 CAGGCTGCTCAGATGGTCCTGGG + Intergenic
1131072007 15:89471836-89471858 CAGGCTCCACAGACTGTCCTGGG - Exonic
1132004818 15:98217616-98217638 CAGGGCACACAGTCGGTCCTGGG + Intergenic
1132400492 15:101502045-101502067 CAGGCTGCACTGTTGCCCCCTGG + Intronic
1132449510 15:101958822-101958844 AAGGCTGCAGGGTTGGTCCCAGG - Intergenic
1132939704 16:2500648-2500670 CAGCCTGGACAGCTGGTCCTGGG + Intronic
1136611833 16:31371234-31371256 GAGGCTCCCCAGGTGGTCCTAGG + Intronic
1138655467 16:58488678-58488700 CTGGCTGCTCAGTAGCTCCTGGG - Intronic
1139490213 16:67281958-67281980 CAGCATGCAGTGTTGGTCCTGGG - Intronic
1139612583 16:68069661-68069683 CAAGTTGCACAGCTGATCCTAGG - Intronic
1140205235 16:72928013-72928035 CAGGCTGCACAGTGCCCCCTGGG + Intronic
1142144325 16:88486519-88486541 CTGGGTGCACAGTGGGTGCTAGG + Intronic
1142144345 16:88486617-88486639 CTGGGTGCACAGTGGGTACTAGG + Intronic
1142144353 16:88486657-88486679 CTGGGTGCACAGTGGGTGCTAGG + Intronic
1142275069 16:89114153-89114175 CAGACTGCAGCGTTGGTCCCGGG + Intronic
1142492101 17:285986-286008 CGGGGTGCACAGTGGGGCCTGGG - Intronic
1142614729 17:1127617-1127639 CAGGCTGCCCTGTTGGTGCCTGG + Intronic
1143572758 17:7770684-7770706 CAGGCTGCAGAGTGGGACCAAGG + Intronic
1144769961 17:17754108-17754130 CAGGCTGCACAGCTGGCCAGTGG - Intronic
1144783952 17:17821684-17821706 CAGGCTGCACAGTTGGTCCTTGG - Intronic
1152379840 17:79936727-79936749 CAGGCTGCACGGCCGTTCCTGGG - Exonic
1152419490 17:80184418-80184440 CAGGCTACACAGAGGGGCCTGGG - Intronic
1152824522 17:82456205-82456227 CAAGCTGTCCAGTTGTTCCTGGG + Intergenic
1153405064 18:4728789-4728811 CAGGCAGCACATTTCATCCTTGG - Intergenic
1153814618 18:8781935-8781957 GTGGCTGCACACTTGGTCGTAGG + Intronic
1155839448 18:30628606-30628628 CAGGCTGCAGGGCTGGACCTCGG + Intergenic
1160282195 18:77501572-77501594 CAGGCTGCACAGTGGGGTTTTGG + Intergenic
1160635745 19:73728-73750 AAGGCTGCAGGGTTGGTCCCAGG + Intergenic
1161063588 19:2227110-2227132 CAGGCGGCACAGTTGGAGGTAGG + Exonic
1161176368 19:2844727-2844749 CTGCCTGCAAAGTTGGCCCTTGG - Intronic
1161525197 19:4750480-4750502 CAGGCTCCAAAGCTGGTGCTGGG + Intergenic
1163408962 19:17141492-17141514 GAGGCAGCAGAGCTGGTCCTGGG - Intronic
1165991678 19:39818767-39818789 CAGGCAGCTGGGTTGGTCCTGGG - Intergenic
1166098161 19:40554511-40554533 CAGGGTGCTCTGTTCGTCCTGGG - Exonic
1166309682 19:41955977-41955999 CTGGGTGCACAGTTGGTCCTTGG + Intergenic
1166427002 19:42687968-42687990 CTGGCTGTTGAGTTGGTCCTCGG + Intronic
1167492678 19:49801419-49801441 CACGCTGCACAGATGGAACTTGG - Exonic
1168388052 19:55982575-55982597 CTGACTCCACAGTTGGTGCTGGG + Intronic
1168469545 19:56629345-56629367 CAGGGTGTGGAGTTGGTCCTGGG - Intergenic
926592230 2:14751836-14751858 CAGGCTGCACCTGTGGTGCTTGG - Intergenic
927775330 2:25898482-25898504 TAGGCTGCAGAGTTGTTCCCAGG - Intergenic
929539355 2:42808489-42808511 CAAGCAGCAGAGTTGGCCCTCGG - Intergenic
930003075 2:46874336-46874358 CAGCCAGCGCAGTTGGTCCAAGG - Intergenic
930192124 2:48470746-48470768 GAGGCTGACCTGTTGGTCCTAGG + Intronic
932494891 2:72141356-72141378 CTGGCTGCCCTGGTGGTCCTGGG - Intronic
932839355 2:75067383-75067405 GAGGCTGCATAGTTGCTGCTAGG + Intronic
934175418 2:89574701-89574723 CTGTCTGCACAGTTGGTCCTAGG - Intergenic
934285734 2:91649064-91649086 CTGTCTGCACAGTTGGTCCTAGG - Intergenic
936288766 2:111201480-111201502 CAGGCTGCCAAGTTGGGGCTGGG + Intergenic
936463464 2:112727618-112727640 CAGGCTGCACACTTGGCTTTTGG - Intronic
936565730 2:113581322-113581344 AAGGCTGCAGGGTTGGTCCCAGG - Intergenic
936666633 2:114604291-114604313 CTGCTTGCAAAGTTGGTCCTTGG - Intronic
936959613 2:118059183-118059205 CATGAAGCACAGTTGGTCCATGG + Intergenic
937071098 2:119063897-119063919 CAGGCTCCACAGGTGATTCTAGG - Intergenic
944108156 2:196101804-196101826 CAGACTTCACAGGTGCTCCTCGG - Intergenic
946519189 2:220447097-220447119 CAGTCAGCAGTGTTGGTCCTGGG - Intergenic
948081216 2:235206934-235206956 CTGCCTGCACATGTGGTCCTGGG + Intergenic
1172322419 20:34006738-34006760 TAGGCTGTATAGTTGCTCCTAGG - Intronic
1172434513 20:34919520-34919542 CAGGATGAAGAGTGGGTCCTCGG - Exonic
1174315647 20:49698701-49698723 CAGGCTGCCAAGATGGTCCCTGG - Intronic
1174400814 20:50274941-50274963 CAGGCGGAACAGTTGGGCCAGGG + Intergenic
1176383775 21:6127036-6127058 CAGGGTGCACAGTGGGCCCTGGG + Intergenic
1176553692 21:8243329-8243351 CGGTCTGCACAGTGGGGCCTAGG + Intergenic
1176572614 21:8426353-8426375 CGGTCTGCACAGTGGGGCCTAGG + Intergenic
1176580523 21:8470914-8470936 CGGTCTGCACAGTGGGGCCTAGG + Intergenic
1177462329 21:21429286-21429308 CAGGGTGCACAGTTGGTGAATGG + Intronic
1179672861 21:42961964-42961986 GAGGCTGCAAAATTGCTCCTAGG - Intergenic
1179739695 21:43411202-43411224 CAGGGTGCACAGTGGGCCCTGGG - Intergenic
1180076575 21:45466270-45466292 CTGGCTGCACTGTCTGTCCTGGG + Intronic
1180939088 22:19645132-19645154 CAGGCTGCCCATGTGGCCCTTGG - Intergenic
1182028432 22:27138307-27138329 CAGGCTGCAGAGAGGGGCCTCGG - Intergenic
1182159170 22:28104627-28104649 AAGGCTGCACAGTTGGACCTTGG - Intronic
1183002197 22:34869994-34870016 CTGGCTGTATAGTAGGTCCTTGG - Intergenic
1183279149 22:36922904-36922926 CAGGCTGCACAGTCGGTCCAGGG + Intronic
1183327752 22:37203653-37203675 CAGGGTGCACAGTAGGTGGTCGG - Intergenic
1183700429 22:39448132-39448154 CAGGCTGTCCAGCTGGACCTGGG - Intergenic
1184474321 22:44712344-44712366 CAGGTTCCACAGCTGGTGCTTGG - Intronic
1184607557 22:45582732-45582754 CACTCTGCACAGTTGTTTCTGGG + Intronic
1184792394 22:46708075-46708097 CAGCCTGCACACCTGGCCCTTGG + Intronic
1203258696 22_KI270733v1_random:160361-160383 CGGTCTGCACAGTGGGGCCTAGG + Intergenic
949454420 3:4223857-4223879 CAGGTCGCACAGTTGGTATTTGG - Intronic
951363488 3:21751837-21751859 GAGGCAGCAAATTTGGTCCTGGG - Intronic
953215765 3:40916458-40916480 CAGAATACACAGTTGCTCCTGGG - Intergenic
954213687 3:49112359-49112381 CAGGCTGCACACTTGGAGATGGG + Exonic
958979837 3:100708578-100708600 GAAGATGCACAGATGGTCCTAGG - Intergenic
964826163 3:160830223-160830245 CAGGGTCCACAGTTGGTTCAGGG - Intronic
969241567 4:5902033-5902055 CAGGCACCACAGTAGGCCCTGGG - Intronic
972300600 4:37782098-37782120 CAGTCTGCAAAGTAGGTCGTGGG + Intergenic
973065030 4:45779349-45779371 CAGGCTGCAAAGTTGGTTTTGGG + Intergenic
979707853 4:123742257-123742279 CAGACTGCTCAGTTTGTGCTTGG + Intergenic
980135685 4:128856463-128856485 CAGGATGTACAGCTGATCCTTGG - Intronic
983907993 4:173205279-173205301 AAGTCTGCAGGGTTGGTCCTGGG + Intronic
985419026 4:189764927-189764949 CAGCCTGGTCAGTTGCTCCTGGG + Intergenic
988655831 5:33210457-33210479 AAGGATGCAAAGTTGCTCCTGGG - Intergenic
990295825 5:54400478-54400500 CAGGCTGTGGAGTTGGACCTGGG + Intergenic
991105205 5:62835352-62835374 CAGACTCCAAAGTTGGTCCAAGG + Intergenic
994384357 5:99112079-99112101 CAGACTCAACAGTTTGTCCTGGG + Intergenic
997264347 5:132486439-132486461 CAGGCTGCAGGGTTGGTCGGAGG - Intronic
999202227 5:149824649-149824671 CAAGCTGGACAGATGGTTCTGGG + Intronic
1000251381 5:159498855-159498877 CAGGCTGCAGAGCTGGACATTGG + Intergenic
1001518467 5:172373715-172373737 CCTGGTGCACAGTTGGTGCTCGG + Intronic
1001580058 5:172792094-172792116 AAGGCCCCACAGTTGGTCCCTGG - Intergenic
1002528000 5:179825747-179825769 CAGGTTGCACAGTGGGTCTGTGG + Intronic
1002880827 6:1250996-1251018 CAGGCTGCAGGGTGGGTGCTTGG - Intergenic
1004595232 6:17093445-17093467 CAGGGTACACAGTTGGCCCTTGG - Intergenic
1008078589 6:47171199-47171221 CACCCTGCACAGGAGGTCCTTGG - Intergenic
1018698463 6:166408602-166408624 CAGTCTGCACTGTTGGTCCTTGG - Intergenic
1019387114 7:763519-763541 CACACAGCACAGGTGGTCCTGGG - Intronic
1022533892 7:31084019-31084041 CATGCTTCCCAGTTGGTCATAGG + Intronic
1023522268 7:41060436-41060458 CAGGCTGCCCAGTCGGGGCTTGG - Intergenic
1023829534 7:44030748-44030770 CAGGCTGCACAGGCTCTCCTGGG + Intergenic
1026562857 7:71464693-71464715 CAGGCTCCCCACTTGGTCCGTGG + Intronic
1026582982 7:71633387-71633409 GAGGCTACGCAGTTTGTCCTGGG + Intronic
1029169822 7:98622601-98622623 CAGGTTGCACAGTTGAGGCTCGG - Intronic
1029515495 7:101020733-101020755 CAGGGTGCACAGCTGGTTCATGG - Intronic
1029739843 7:102485006-102485028 CAGGCTGCACAGGCTCTCCTGGG + Intronic
1029757842 7:102584185-102584207 CAGGCTGCACAGGCTCTCCTGGG + Intronic
1029775778 7:102683246-102683268 CAGGCTGCACAGGCTCTCCTGGG + Intergenic
1029943500 7:104506530-104506552 CAGGCACCACAGTAGGTGCTGGG - Intronic
1032240341 7:130154588-130154610 CAGGCTGCGCAGCTGGCACTTGG - Intergenic
1033231243 7:139599853-139599875 CAGAGTGCACAGTTAGACCTAGG - Intronic
1034574913 7:151988284-151988306 CAAGCTGCTCAGATGCTCCTGGG - Intronic
1034604577 7:152300257-152300279 CTGTTTGCACAGTTGGTCCTAGG + Intronic
1034818628 7:154196642-154196664 CAGGGAGCCCAGGTGGTCCTTGG - Intronic
1035617297 8:1011811-1011833 CAGTCTGCACAGTGGGCCCTGGG + Intergenic
1035754501 8:2021736-2021758 CCGGCTGCACAGCTGGAGCTGGG - Intergenic
1035754507 8:2021776-2021798 CCGGCTGCACAGCTGGAGCTGGG - Intergenic
1035754513 8:2021816-2021838 CCGGCTGCACAGCTGGAGCTGGG - Intergenic
1037494261 8:19423879-19423901 CAGGCTGCACAGAAAGCCCTGGG + Intronic
1039840767 8:41291466-41291488 CAGGCAGCAAAGGTGGGCCTAGG - Intronic
1049412298 8:142478680-142478702 CAGGGTGCACAGTGGGACTTGGG + Intronic
1049886687 9:31901-31923 AAGGCTGCAGGGTTGGTCCCAGG + Intergenic
1051694521 9:19753766-19753788 CAGGATGCCCATCTGGTCCTTGG - Intronic
1052885066 9:33638427-33638449 CAGGCTGCAGGGTGGGTTCTTGG - Intergenic
1054823287 9:69545363-69545385 CAGGCTGCACCTCTGGTTCTTGG + Intronic
1055470485 9:76605636-76605658 CAGGCTGCACCGTTGATTCAGGG + Intergenic
1056187832 9:84153907-84153929 CTGTTTGCAAAGTTGGTCCTTGG + Intergenic
1056225761 9:84493635-84493657 CAGTCTGCACAGTTGGTTTCTGG + Intergenic
1057054047 9:91948570-91948592 AAGGCTGCACAGTCTTTCCTGGG - Intronic
1057185017 9:93052692-93052714 CAGGCTCCACCCTTGGCCCTGGG + Intergenic
1057218192 9:93241108-93241130 CAGGCAGCAGTGTTGGCCCTGGG - Intronic
1059168668 9:112103784-112103806 CAGGTTGCATAGTAGGTCTTAGG - Intronic
1061068778 9:128295878-128295900 CAGCCTGCACTGTTGTCCCTGGG + Intergenic
1203474886 Un_GL000220v1:142372-142394 CGGTCTGCACAGTGGGGCCTAGG + Intergenic
1203361954 Un_KI270442v1:223738-223760 CAGTCTACACAGTGGGGCCTAGG - Intergenic
1186205785 X:7198443-7198465 CAACCTCCCCAGTTGGTCCTAGG - Intergenic
1186263504 X:7806652-7806674 TAGCCTGCTCAGTTGGTTCTTGG - Intergenic
1187649189 X:21381696-21381718 CAGCCTGCATACTTGGTGCTGGG - Intronic
1187697822 X:21939229-21939251 CTGGCAGCACAGGTGGCCCTCGG - Intergenic
1193587780 X:83347396-83347418 AAGGCTGGACAGTTTTTCCTAGG + Intergenic
1200089069 X:153625947-153625969 GTGGCTCCACAGTTGGCCCTGGG - Intergenic
1201510059 Y:14749294-14749316 CAGGCTGCACAGTGTGTCCAGGG - Intronic