ID: 1144785971

View in Genome Browser
Species Human (GRCh38)
Location 17:17831789-17831811
Sequence TGCCCTGGCTATAGTGTCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 122}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144785971_1144785973 1 Left 1144785971 17:17831789-17831811 CCAGGGACACTATAGCCAGGGCA 0: 1
1: 0
2: 0
3: 10
4: 122
Right 1144785973 17:17831813-17831835 TGCCTTCACCCACAGATGCAAGG 0: 1
1: 0
2: 1
3: 24
4: 242
1144785971_1144785976 9 Left 1144785971 17:17831789-17831811 CCAGGGACACTATAGCCAGGGCA 0: 1
1: 0
2: 0
3: 10
4: 122
Right 1144785976 17:17831821-17831843 CCCACAGATGCAAGGACTCATGG 0: 1
1: 0
2: 0
3: 29
4: 194
1144785971_1144785978 12 Left 1144785971 17:17831789-17831811 CCAGGGACACTATAGCCAGGGCA 0: 1
1: 0
2: 0
3: 10
4: 122
Right 1144785978 17:17831824-17831846 ACAGATGCAAGGACTCATGGAGG 0: 1
1: 0
2: 1
3: 22
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144785971 Original CRISPR TGCCCTGGCTATAGTGTCCC TGG (reversed) Intronic
901932408 1:12603886-12603908 TGCCCTGGCTTCAGTGTCACAGG + Intronic
903575167 1:24335277-24335299 TCCCCTGGCATTAGTGCCCCAGG + Intronic
904417397 1:30371742-30371764 TGGCCTGGCCATCGTGTGCCAGG - Intergenic
908796282 1:67833534-67833556 CGCCCTGGCTGTGCTGTCCCGGG + Intergenic
911965482 1:104363905-104363927 TGCTCTGGCTAGAGTTTCACTGG - Intergenic
917471634 1:175330755-175330777 TGACCTGGCTATGGAGCCCCAGG - Intronic
920540412 1:206773859-206773881 TGCCCTGACTATAGAGTGGCAGG - Intergenic
920543112 1:206794085-206794107 TGGCCTGGCCATGGTGTCCAAGG - Intergenic
922796611 1:228342675-228342697 TTCCCTGGCCATGGTGTCCAGGG + Intronic
1067437396 10:46287678-46287700 TGCCCTGGCTTTCTTTTCCCTGG + Intronic
1070546692 10:77458181-77458203 TGCCCTGGCTGCATTATCCCTGG - Intronic
1074455887 10:113594841-113594863 TGGCCTGGCCATTGTGTCCTGGG - Intronic
1074711951 10:116184813-116184835 AGCCCTGGGTAGAGTCTCCCTGG + Intronic
1075659068 10:124180850-124180872 TGCCTTGGCCATAGTGTCAATGG + Intergenic
1077103931 11:833742-833764 TGGCCTGGCTGTAAGGTCCCAGG - Intronic
1081175984 11:39927043-39927065 TGCCCTGTCTATGATGTCCCAGG + Intergenic
1081486872 11:43537674-43537696 TGCCCAGGCTACAGTGTTCAGGG + Intergenic
1083714066 11:64565632-64565654 TCCCCTGGCTCTAGGGACCCTGG - Intronic
1084286338 11:68133589-68133611 TGCCCAGGCTGGAGTGACCCTGG - Intergenic
1085728918 11:78979595-78979617 TGGGCTGGTTAGAGTGTCCCAGG + Intronic
1086609150 11:88732860-88732882 TGTCTTGGCTATAGTTTTCCAGG + Intronic
1089140556 11:116280600-116280622 TGCCCAAGCTATGGTGTCTCGGG - Intergenic
1091178498 11:133582153-133582175 TGCCCTGCCAAAAGTGTCCTAGG - Intergenic
1093976451 12:25427056-25427078 TGCCCAGGCTAGAGTGCCCCAGG - Intronic
1095962456 12:47844216-47844238 TGCCCTGGTTATATTCTCACGGG - Exonic
1101350991 12:103930004-103930026 TGCCATGGCTACCGTTTCCCCGG + Intergenic
1104610856 12:130226525-130226547 TGCCCTGGCTAAAGTCTGCAGGG + Intergenic
1105403959 13:20118791-20118813 TGCCCTGGCTGGAGCATCCCGGG - Intergenic
1105899512 13:24743241-24743263 TGCTCTAGCTATAGCCTCCCAGG - Intergenic
1107988490 13:45796698-45796720 TGGCCTGGTTGTAGTGTCACAGG + Intronic
1111976884 13:94975576-94975598 TGCCCTGGCTATTTTATCTCTGG - Intergenic
1112815091 13:103263837-103263859 TGCCGGGGCTATTGGGTCCCAGG + Intergenic
1114268842 14:21089284-21089306 TGTCCTGGATACAGTGGCCCAGG - Exonic
1114969836 14:28012635-28012657 TGCCCTGGATTTAGTGTTTCCGG - Intergenic
1115944675 14:38646222-38646244 TGACATGGCTATTGTGACCCTGG - Intergenic
1116948574 14:50858257-50858279 TGAAATGGCTATAGTGTCCTTGG - Intronic
1118785099 14:69038990-69039012 TGCCCTGGCTGTGGTGGTCCAGG + Intergenic
1123117277 14:105900414-105900436 TGCCGTGGCTCCAGTGCCCCTGG - Intergenic
1123119362 14:105909683-105909705 TGCCGTGGCTCCAGTGCCCCTGG - Intergenic
1124621872 15:31278615-31278637 TCCCCTGGCTAGAGTCCCCCTGG + Intergenic
1129209468 15:74059248-74059270 TGCTCAGGCTGCAGTGTCCCCGG + Intergenic
1130217337 15:81984697-81984719 TCCCCTGTCTATAGTGCCTCAGG + Intergenic
1130511528 15:84593844-84593866 TGCTCAGGCTGCAGTGTCCCTGG + Intergenic
1132670127 16:1099087-1099109 CTCCCTGGCCATGGTGTCCCAGG + Intergenic
1134147016 16:11773367-11773389 TGCCCTTGCTATGGTTACCCAGG + Intronic
1136411671 16:30081219-30081241 TGGCCTGGCTGTGGTGACCCTGG + Intronic
1136686535 16:31998018-31998040 TGCCCTGGCTATGGAGCCTCTGG - Intergenic
1136787149 16:32941553-32941575 TGCCCTGGCTATGGAGTCTCTGG - Intergenic
1136882626 16:33912231-33912253 TGCCCTGGCTATGGAGCCTCTGG + Intergenic
1137667688 16:50261336-50261358 TGCTCAGGCCTTAGTGTCCCTGG - Intronic
1138063565 16:53916820-53916842 CTCCCTAGCTATAGTGTCCCAGG - Intronic
1138363469 16:56452291-56452313 TGCCCTGGCTAGACTCTCCTGGG - Intronic
1138551697 16:57752239-57752261 TTCCCTGGCCCCAGTGTCCCAGG + Intronic
1139507953 16:67408934-67408956 TGCCCTGGTGATGGTGTCACTGG - Intronic
1140345243 16:74207017-74207039 TTCCCGGGCAATAGGGTCCCTGG + Intergenic
1203089385 16_KI270728v1_random:1203230-1203252 TGCCCTGGCTATGGAGCCTCTGG - Intergenic
1142856780 17:2735127-2735149 TGCCATGGATACCGTGTCCCTGG - Intergenic
1144785971 17:17831789-17831811 TGCCCTGGCTATAGTGTCCCTGG - Intronic
1146289505 17:31597684-31597706 TGCCCTGGACAAGGTGTCCCTGG + Intergenic
1146655012 17:34629939-34629961 GGCCTTGGCTAGTGTGTCCCAGG + Intronic
1147537288 17:41328898-41328920 TGGCCTGGGTATTGTGCCCCAGG - Intergenic
1152425535 17:80216643-80216665 CGCCATGGCCACAGTGTCCCAGG - Intronic
1155491705 18:26406714-26406736 AGCCCTGGCTATAGGGCCACAGG - Intergenic
1156796308 18:41050589-41050611 TGCCCTGACACTAGTGTCCCTGG - Intergenic
1157616236 18:48989263-48989285 TGCCCTGGCTCCAGGGTACCTGG - Intergenic
1162437099 19:10667764-10667786 TCCCTTGGCTATGGTTTCCCTGG - Intronic
1163152366 19:15422918-15422940 CGCCCTGGCTGTAGTGTGCCCGG + Exonic
1166377398 19:42335251-42335273 TGCCCTGGCCATAGGCTGCCGGG - Intronic
1168385048 19:55956144-55956166 GGCCTTGACTATGGTGTCCCGGG + Intronic
928902417 2:36334013-36334035 TGCCCTGCCTATTGTGTGTCAGG - Intergenic
933990682 2:87632144-87632166 TGGCCTGGGTATAGTGTCATGGG - Intergenic
936007929 2:108906779-108906801 GGCCCTGGCTGAAGAGTCCCGGG + Intronic
936303162 2:111318679-111318701 TGGCCTGGGTATAGTGTCATGGG + Intergenic
937258576 2:120571388-120571410 TGCCCTGCCTTTTGGGTCCCGGG - Intergenic
937352938 2:121178509-121178531 TGAAGTGGCTATAGTGTCCGGGG + Intergenic
942354594 2:175095770-175095792 TGCACTAACTATAGTTTCCCTGG - Intronic
942815586 2:180050145-180050167 GGCCCAGGCTATTGTCTCCCCGG + Intergenic
944683299 2:202096360-202096382 TGCTCTGGTTTTAGTGGCCCAGG - Intronic
946752839 2:222909935-222909957 TTCCCTAGCTGTAGTGTCCCTGG - Intronic
948421501 2:237863206-237863228 AGCCCGGGCTACAGTGGCCCTGG + Intronic
1171286156 20:23939391-23939413 AGGCTTGGCTATAGTGTCACAGG - Intergenic
1171846664 20:30281558-30281580 GGCCCCGGGTATATTGTCCCAGG - Intergenic
1175988356 20:62775582-62775604 TGCCATGGCTGTGGGGTCCCTGG - Intergenic
1179166396 21:38938525-38938547 TACCATGGCAACAGTGTCCCTGG - Intergenic
1181536451 22:23548780-23548802 TGCCCTGGCTATAGCATCAAAGG + Intergenic
1181648664 22:24247191-24247213 GGCCCTGGCCAGAGTGCCCCTGG + Intergenic
1181760568 22:25055897-25055919 TGCCCAGGCTATAGTGCCGGTGG + Intronic
1182601113 22:31464633-31464655 TGCCCAGGCTACAGTGTAGCGGG - Intronic
1183248442 22:36711460-36711482 TGGCCTGGCTGGAGTATCCCAGG + Intergenic
1183382785 22:37498733-37498755 TGGCCTGGCTATGCTGGCCCTGG + Intronic
1184592187 22:45492416-45492438 TGCCCTGGATATAAGCTCCCGGG + Intergenic
1185280942 22:49969601-49969623 TGCCAAGGCTACAGTGTGCCAGG + Intergenic
949516908 3:4815591-4815613 TCCCGTGCCTATAGTGTGCCAGG - Intronic
953102352 3:39842310-39842332 TGACCAGGCTCCAGTGTCCCTGG + Intronic
956673684 3:71715217-71715239 TGCCCTGGCCAGAATGTCCATGG + Intronic
959134523 3:102400444-102400466 TTCCCTGGCTGGAGGGTCCCAGG + Intronic
962904846 3:139792336-139792358 TGACCTGTCTATTGTGTCCAAGG + Intergenic
963421349 3:145064616-145064638 TGCCCTGGCCAGAATTTCCCTGG - Intergenic
964271915 3:154965821-154965843 TGCCCTGGGTTTTGTGTCCTAGG + Intergenic
968439103 4:612613-612635 TGCCCTGGGTTTCGTGTACCTGG - Intergenic
968581832 4:1398879-1398901 TGCCATGGCAATGGTGTGCCTGG - Intergenic
969638175 4:8381423-8381445 TTCCCTGGCCGTTGTGTCCCTGG - Intronic
978221220 4:106276836-106276858 TGCCCAGGCTGGAGTGTGCCTGG - Intronic
998414577 5:141936962-141936984 TGCCCTGGCTGGAATCTCCCTGG + Intronic
1001889529 5:175327582-175327604 TGCCTGGGCTCTGGTGTCCCAGG - Intergenic
1004131315 6:12922419-12922441 TGCCCTTGCTTTACTTTCCCTGG - Intronic
1013189338 6:107789041-107789063 TGACCTGCCCACAGTGTCCCTGG - Intronic
1013972906 6:116042037-116042059 TGACCAAGCTCTAGTGTCCCAGG - Intronic
1015006066 6:128283173-128283195 TGCCCTGCCTACAGAGTCCTTGG + Intronic
1015663487 6:135602236-135602258 TGCCCCAGCTAAATTGTCCCAGG - Intergenic
1016796293 6:148121465-148121487 TGACATGGCAACAGTGTCCCAGG - Intergenic
1017079565 6:150654693-150654715 TGACCTTGCTACTGTGTCCCAGG + Intronic
1017980617 6:159398207-159398229 AGCCCTGGCTAGAGTGACCCAGG + Intergenic
1019600745 7:1882515-1882537 TGCTCTGGCTGGAGTCTCCCAGG + Intronic
1024177544 7:46856514-46856536 AGCCATGGCTCTAGTGTCTCTGG + Intergenic
1030128994 7:106180632-106180654 TGCCCAGGCTATAGTGTAGTGGG - Intergenic
1032390398 7:131552123-131552145 AGCCCTGGCTTTAGGCTCCCTGG - Intronic
1036783597 8:11670157-11670179 AGCCCTGGCTAAAAAGTCCCAGG + Intergenic
1037256763 8:16964260-16964282 TGACCTTGCTCTAGTATCCCAGG - Intergenic
1040292414 8:46132233-46132255 TGGCCTGGCTGTAATGCCCCAGG - Intergenic
1044769139 8:95610852-95610874 TGCCTTTGCTATCTTGTCCCTGG + Intergenic
1051777111 9:20646957-20646979 TGCCGTGGCTATTGTCTGCCCGG - Intergenic
1056649828 9:88449166-88449188 TGGCCTGGCTGCAGTGTGCCAGG + Intronic
1056757515 9:89391207-89391229 TGCCATGGCAATAGTGTGCCTGG - Intronic
1057096913 9:92319225-92319247 TGCCCTGGCACTTCTGTCCCTGG + Exonic
1058077111 9:100662357-100662379 TGCTCTGGCAATACTGTGCCTGG + Intergenic
1058153509 9:101486873-101486895 TCCCCTCGCTCTAGTGTCCAGGG + Intronic
1058368809 9:104240528-104240550 TGCCCTGTTTATAGTGTATCTGG - Intergenic
1058554611 9:106153673-106153695 TGCCCTGTCTGTAGTAACCCTGG + Intergenic
1061245395 9:129398939-129398961 TGCCCTGGCTATAGCATCAAAGG - Intergenic
1186888715 X:13939038-13939060 TGCCCTTGGTCCAGTGTCCCGGG - Intergenic
1199148170 X:144396636-144396658 TGCCCCTGCTATAGGGTCCTGGG - Intergenic
1200455555 Y:3386729-3386751 TGCCCCAGCTATCCTGTCCCAGG - Intergenic