ID: 1144786198

View in Genome Browser
Species Human (GRCh38)
Location 17:17833126-17833148
Sequence ATAAAAATACAGATCCAGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2156
Summary {0: 1, 1: 0, 2: 5, 3: 104, 4: 2046}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144786196_1144786198 -10 Left 1144786196 17:17833113-17833135 CCTATTTTAATTTATAAAAATAC 0: 1
1: 0
2: 7
3: 175
4: 1464
Right 1144786198 17:17833126-17833148 ATAAAAATACAGATCCAGCCGGG 0: 1
1: 0
2: 5
3: 104
4: 2046
1144786193_1144786198 14 Left 1144786193 17:17833089-17833111 CCAATCAGCTGTGAACCAATGGA 0: 1
1: 0
2: 1
3: 7
4: 90
Right 1144786198 17:17833126-17833148 ATAAAAATACAGATCCAGCCGGG 0: 1
1: 0
2: 5
3: 104
4: 2046
1144786195_1144786198 -9 Left 1144786195 17:17833112-17833134 CCCTATTTTAATTTATAAAAATA 0: 1
1: 3
2: 36
3: 312
4: 2475
Right 1144786198 17:17833126-17833148 ATAAAAATACAGATCCAGCCGGG 0: 1
1: 0
2: 5
3: 104
4: 2046
1144786191_1144786198 25 Left 1144786191 17:17833078-17833100 CCAAGCAGATTCCAATCAGCTGT 0: 1
1: 1
2: 1
3: 10
4: 152
Right 1144786198 17:17833126-17833148 ATAAAAATACAGATCCAGCCGGG 0: 1
1: 0
2: 5
3: 104
4: 2046
1144786194_1144786198 -1 Left 1144786194 17:17833104-17833126 CCAATGGACCCTATTTTAATTTA 0: 1
1: 0
2: 2
3: 32
4: 297
Right 1144786198 17:17833126-17833148 ATAAAAATACAGATCCAGCCGGG 0: 1
1: 0
2: 5
3: 104
4: 2046

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144786198 Original CRISPR ATAAAAATACAGATCCAGCC GGG Intronic
Too many off-targets to display for this crispr