ID: 1144786249

View in Genome Browser
Species Human (GRCh38)
Location 17:17833490-17833512
Sequence GATCCACAGCTGCCCGGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 0, 2: 4, 3: 27, 4: 268}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144786249 Original CRISPR GATCCACAGCTGCCCGGGGC TGG Intronic
900122667 1:1055515-1055537 GCTCCTCAGCAGCCTGGGGCTGG - Exonic
900885217 1:5410317-5410339 GATCTACACCTGCCTGGGTCTGG + Intergenic
900958989 1:5907359-5907381 GTTCCAGAGCTGCCCTGGCCAGG - Intronic
902122269 1:14176436-14176458 CTGCCACAGCTGCCCAGGGCAGG + Intergenic
904495462 1:30884097-30884119 CAGCCACAGCTGCCCTGGCCAGG + Intronic
905660975 1:39724714-39724736 GATCAATAGTTGCCTGGGGCTGG - Intronic
905744847 1:40406394-40406416 GATTCATAGTTGCCAGGGGCTGG + Intronic
906125825 1:43426429-43426451 GCTGCACAGCTGCCTGGGGCAGG + Intronic
906380435 1:45328949-45328971 CAACCCCATCTGCCCGGGGCTGG + Intergenic
907912079 1:58835632-58835654 GATCCACAGGTGCCTGGCCCAGG - Intergenic
914919573 1:151838321-151838343 GAGCCGCAGCTGCCCGCCGCGGG + Exonic
916649385 1:166820623-166820645 GTTCCACAGATCCCCAGGGCAGG + Intergenic
921955634 1:220980693-220980715 GATCCACAGCTTCCAGAGGGAGG + Intergenic
923015128 1:230120645-230120667 GACGCACAGCTCCCCAGGGCTGG + Intronic
923286069 1:232497138-232497160 GAGCCATGGCTGCCAGGGGCTGG + Intronic
923369344 1:233295288-233295310 TACCCACAGCTCCCCGGGACCGG + Intronic
1067100101 10:43328887-43328909 GAACCACGGGAGCCCGGGGCAGG - Intergenic
1068300917 10:55137877-55137899 GATCCAAAGCTACTGGGGGCAGG + Intronic
1069270628 10:66522612-66522634 GACCCACAGCTCCACAGGGCTGG - Intronic
1069712628 10:70499718-70499740 GAGCCACAGCTGGCAGGTGCAGG + Intronic
1069751218 10:70746398-70746420 GATCCGTGGCTGCCAGGGGCTGG + Intronic
1069840762 10:71338011-71338033 GAGCCACTGCTGGCCTGGGCAGG - Intronic
1069918047 10:71799193-71799215 GGATCTCAGCTGCCCGGGGCGGG - Exonic
1071566523 10:86674075-86674097 GATCCACAGCTGGCAGAGGGTGG - Intronic
1074405813 10:113179491-113179513 GATTAGCAGCTGCCTGGGGCTGG - Intergenic
1074406746 10:113186346-113186368 GATCAATGGCTGCCAGGGGCTGG - Intergenic
1074506293 10:114073686-114073708 GATCCATCGCTGCCCGAGCCTGG - Intergenic
1075611102 10:123855441-123855463 GACCCACACCTGCCTGTGGCTGG - Intronic
1075621257 10:123929805-123929827 GATCCAGAGCTGGCAGGGGCGGG - Intronic
1075643984 10:124085772-124085794 GATCCACACCTGGCTGGGGAAGG + Intronic
1076608069 10:131702165-131702187 AAAACACAGCTGCACGGGGCAGG - Intergenic
1076707579 10:132310042-132310064 CATCCCCAACTGCCCGGGCCGGG - Intronic
1077010461 11:377029-377051 GGGCCGCAGCTGCCCGGGGAGGG + Exonic
1077321436 11:1944290-1944312 GAGCCAGGGCTGCCAGGGGCCGG + Intergenic
1077386872 11:2273579-2273601 GATTCACGGTTGCCAGGGGCTGG + Intergenic
1078091828 11:8268698-8268720 GAGCAGCAGCTGCCCGGGCCGGG + Intronic
1078349399 11:10580345-10580367 GATTCACTGCTGCCCTGGACTGG + Intronic
1078620892 11:12906700-12906722 GATCCACAGTTGCCTGGGGCTGG - Intronic
1079729420 11:23921400-23921422 CAGCCACAGCTGCCAGGGGTGGG + Intergenic
1080104361 11:28496373-28496395 AATCCCCAGGTGCCCAGGGCGGG - Intergenic
1081862621 11:46342175-46342197 GGTCCCCAGCTTCCCAGGGCTGG + Intronic
1082203225 11:49398974-49398996 GACTCACAGCTGCACGTGGCTGG - Intergenic
1083662214 11:64256673-64256695 GATCCAGGGCTTCCAGGGGCAGG - Exonic
1083925486 11:65803650-65803672 AGACCACAGGTGCCCGGGGCTGG + Intergenic
1084148351 11:67276714-67276736 GATCCGTGGCTGCCGGGGGCTGG - Intronic
1084435113 11:69134988-69135010 AAGCAGCAGCTGCCCGGGGCTGG - Intergenic
1084437806 11:69154580-69154602 CATCCTCAGAGGCCCGGGGCTGG + Intergenic
1084437820 11:69154618-69154640 CATCCTCAGAGGCCCGGGGCTGG + Intergenic
1084437834 11:69154656-69154678 CATCCTCAGAGGCCCGGGGCTGG + Intergenic
1084446042 11:69204307-69204329 GACTCATGGCTGCCCGGGGCTGG + Intergenic
1084536126 11:69758310-69758332 GACCCTCAGCTGCCTGGGGAAGG - Intergenic
1084647230 11:70465555-70465577 GCTTCACAGCTGCATGGGGCTGG + Intergenic
1086651813 11:89301105-89301127 GACTCACAGCTGCACGTGGCTGG + Intergenic
1087775552 11:102253561-102253583 GATCCAGAGCTGCCTGCAGCTGG - Intergenic
1089318392 11:117607601-117607623 GATCCACAGCTCCCCAGTGAAGG + Intronic
1089360783 11:117885082-117885104 GAGCCACAGCAGCCTGGGCCAGG + Intergenic
1096782198 12:53997905-53997927 GGTCCTCAGCCGCCCTGGGCTGG + Intronic
1096905079 12:54927647-54927669 GACCCACAGTTGCACGTGGCTGG - Intergenic
1097626662 12:62010256-62010278 GAACCACGGGAGCCCGGGGCAGG - Intronic
1099199317 12:79657243-79657265 GATCAACAGTTGCCTTGGGCTGG + Intronic
1101592787 12:106138868-106138890 GCTCCACAGCTCGCCGCGGCCGG - Exonic
1101664389 12:106797468-106797490 GATTCATAGTTGCCAGGGGCTGG + Intronic
1102656753 12:114488452-114488474 GGTACACAGCTGCCCAGGGGAGG - Intergenic
1103776729 12:123371772-123371794 GAACCACGGGAGCCCGGGGCAGG - Intergenic
1104945908 12:132414826-132414848 GCTCCACAGCTCCCTGGGGTGGG - Intergenic
1105417154 13:20223406-20223428 GATCCACACCTTCCCGATGCTGG + Exonic
1107016740 13:35713682-35713704 GATCGACGGTTGCCAGGGGCTGG + Intergenic
1107995262 13:45852955-45852977 GATCCAGTGCTGCCTGGAGCAGG + Intergenic
1109296750 13:60542063-60542085 GAGCCACAACTGAACGGGGCTGG + Intronic
1112144157 13:96679429-96679451 GATGTACAGCTGCTGGGGGCTGG - Intronic
1112434663 13:99383483-99383505 CATGCTCAGCTGCCCAGGGCTGG - Intronic
1112509674 13:99997998-99998020 GACCCACAGGGGCCCTGGGCTGG - Intergenic
1113733115 13:112656901-112656923 GATTCAGAGCTGCCGGTGGCTGG + Intronic
1113891103 13:113736005-113736027 GGTCCACATCTGCCAGGCGCAGG + Exonic
1113903970 13:113811037-113811059 CCTCCACAGCTGCATGGGGCAGG - Intronic
1114473959 14:22981548-22981570 GCTCCAGGGCTGCCCAGGGCCGG + Exonic
1116501982 14:45634604-45634626 GAACCACAGGAGCCCAGGGCAGG - Intergenic
1117313687 14:54553782-54553804 GAATCACAGTTGCTCGGGGCTGG + Intergenic
1117388578 14:55241135-55241157 GCTCCGCAGCTGGCGGGGGCCGG + Intergenic
1118492248 14:66272581-66272603 GATCAGCAGCTCCCCAGGGCAGG + Intergenic
1118976066 14:70677564-70677586 TCTCCACAGCAGCCCAGGGCGGG + Intergenic
1122694013 14:103544194-103544216 GGTCCACAGCTGCCCAGGGCGGG + Intergenic
1122952657 14:105054199-105054221 GGGCCACAGCAGCCCCGGGCGGG + Intronic
1123505761 15:20940777-20940799 TATCCAGGGCTGCCCGCGGCGGG + Intergenic
1123562995 15:21514483-21514505 TATCCAGGGCTGCCCGCGGCGGG + Intergenic
1123599242 15:21951766-21951788 TATCCAGGGCTGCCCGCGGCGGG + Intergenic
1124411117 15:29438097-29438119 TCTACACAGCTGCCCAGGGCCGG - Intronic
1125836847 15:42759418-42759440 GAGGCACACCTGCCAGGGGCAGG - Intronic
1127857267 15:62962801-62962823 GTTCCAGAGCTGGCCGGGGCCGG + Intergenic
1129440657 15:75578860-75578882 GCGCCTCAGCAGCCCGGGGCCGG + Exonic
1130460653 15:84156602-84156624 GATCCAGAGATGCCCTGAGCTGG - Intergenic
1130995534 15:88901769-88901791 GATCCACAGCTCCCAGGGGCAGG + Intronic
1131016251 15:89059880-89059902 GTTCCACAGCTGGCCTGGGCAGG - Intergenic
1202971347 15_KI270727v1_random:241618-241640 TATCCAGGGCTGCCCGCGGCGGG + Intergenic
1132515486 16:363961-363983 GAGGCAGAGCTGCCCTGGGCCGG - Intergenic
1132536654 16:484900-484922 GAGCCACAGATGCCGGAGGCTGG - Intronic
1133333990 16:4994907-4994929 CCTTCACATCTGCCCGGGGCCGG + Intronic
1134644695 16:15857059-15857081 GACCCGGAGCTGCCCGCGGCTGG + Intergenic
1134685440 16:16155023-16155045 GATGCCCACCTGCCCGGGGTTGG + Exonic
1137609473 16:49809289-49809311 GGTCCACGGCTGGCAGGGGCCGG + Intronic
1138519704 16:57563921-57563943 GAGCCGCAGCTCCCTGGGGCGGG - Exonic
1138680659 16:58681570-58681592 GATCAAGAGCAGCCCTGGGCAGG + Intronic
1139958134 16:70702966-70702988 GACCCACAGCTGACCGGAGGAGG + Intronic
1139958345 16:70703987-70704009 GCACCACACCTGCCAGGGGCTGG + Intronic
1140912697 16:79468288-79468310 GATTTACTGCTGCCCTGGGCCGG + Intergenic
1141158050 16:81610553-81610575 GAACCACAGCCGCCAGGGGCAGG - Intronic
1142778321 17:2159984-2160006 GATCAGTAGCTGCCTGGGGCAGG + Intronic
1143558124 17:7675171-7675193 AACCCACAGCTGCACAGGGCAGG + Exonic
1144641871 17:16941779-16941801 GATGAACAGTTGCCAGGGGCTGG - Intronic
1144680189 17:17188115-17188137 TCTCCACACCTGCCTGGGGCTGG - Exonic
1144703785 17:17354395-17354417 GATCCAGATGTGCCCGTGGCAGG + Intergenic
1144704039 17:17355746-17355768 TATCCAGAGCTGCCCAGGCCTGG + Intergenic
1144786249 17:17833490-17833512 GATCCACAGCTGCCCGGGGCTGG + Intronic
1144794684 17:17882982-17883004 GCTCCACTGCTGCCCGGGTGAGG + Intronic
1146183320 17:30710259-30710281 GATCCTCTGGGGCCCGGGGCCGG - Intergenic
1146756146 17:35433458-35433480 CATCCACAGCTGCCCTGGCCTGG - Intergenic
1147662302 17:42123209-42123231 GACCCACAGCTGCCCGGAGGGGG - Exonic
1148822291 17:50366671-50366693 GAGCCACAGCTGGCCGGTGGTGG - Intergenic
1151819708 17:76490927-76490949 GATCCTGGGCTGCCCGGGGTTGG - Intronic
1152632911 17:81418544-81418566 GATGAACAGCTGCCCTGGGTCGG - Intronic
1153477235 18:5510340-5510362 GATCTACAGCTGCCTGGGGATGG - Intronic
1153756997 18:8294315-8294337 GATGCACAGCTCCACAGGGCTGG + Intronic
1155201793 18:23524246-23524268 TATTCACAGCTGCCCGGAGGAGG - Intronic
1155392091 18:25349584-25349606 AATGCACAGCGGCCGGGGGCCGG + Intronic
1157734226 18:50032382-50032404 GATTTACAGCTGCCTAGGGCTGG - Intronic
1159922994 18:74243097-74243119 GCTTCAGAGCTGCCTGGGGCTGG + Intergenic
1160758981 19:773071-773093 GCTCCACACCTGCCCCGTGCGGG - Intergenic
1161001273 19:1912422-1912444 GGTCCACAGCCGGCCGTGGCAGG - Exonic
1161479544 19:4503662-4503684 GAGCCCCAGGTGCCTGGGGCAGG + Exonic
1161517786 19:4706100-4706122 GATCCATAGCTTTCCGGGGAGGG - Intronic
1161748721 19:6078155-6078177 GATTCACAGTTGCCCGGGGCTGG + Intronic
1162087630 19:8258063-8258085 GATCCCCAGCTCCTTGGGGCAGG - Intronic
1162474604 19:10892443-10892465 GGTCCTCAGATACCCGGGGCTGG + Intronic
1162577054 19:11505380-11505402 GGTCCGCAGGTGCCGGGGGCTGG + Intronic
1163648189 19:18502130-18502152 GCCCCACAGCTCCACGGGGCAGG + Intronic
1163727651 19:18931921-18931943 TCTCCACAGTTGCCCGGGCCAGG + Intronic
1164260885 19:23567961-23567983 GAACCACGGGAGCCCGGGGCAGG - Intronic
1164315877 19:24087557-24087579 GGTCCACAGCTGCCCAGAGAGGG - Intronic
1165214455 19:34260004-34260026 GATTCACAGTTCCCCAGGGCTGG - Intronic
1166108916 19:40611138-40611160 CATCCACATCTGCACAGGGCAGG - Exonic
1166253055 19:41584698-41584720 AAGCCACAGCTGCCTGGAGCAGG + Intronic
1167345653 19:48944208-48944230 GGTCCAAAGCTCCCCGGGGATGG + Intronic
1168122018 19:54256885-54256907 CACCCCCAGCTGCCCGGGGTTGG + Intronic
1168169016 19:54574165-54574187 CATCCCCAGCTGCACGGGGGTGG - Intronic
1168171791 19:54594530-54594552 CATCCCCAGCTGCACGGGGGTGG - Intronic
1168173704 19:54607959-54607981 CAGCCCCAGCTGCCCGGGGGTGG - Intronic
925033525 2:670270-670292 GCTCCACAGCTGCACTGGGAAGG + Intronic
927145908 2:20166470-20166492 GAGACACAGCGGCCTGGGGCGGG - Intergenic
928195770 2:29215586-29215608 GAGCCAAAGCTGCCCGGAGATGG + Intronic
929127717 2:38536221-38536243 GATCCACAGCAGCGCGCGCCCGG - Intergenic
929452807 2:42048132-42048154 GAGCCTGAGCCGCCCGGGGCCGG + Exonic
929966209 2:46539040-46539062 GATCAACAGGTACCAGGGGCAGG + Intronic
932269134 2:70393788-70393810 CATCCACAGGTGCCTTGGGCAGG - Intergenic
932479315 2:72029107-72029129 GCTCCACAGCAGCCCAGGCCTGG + Intergenic
933869316 2:86550286-86550308 GAACCACGGGAGCCCGGGGCAGG + Intronic
934602350 2:95667298-95667320 GACACACAGCTGGCCAGGGCAGG - Intergenic
935622820 2:105144079-105144101 GAGCCGCAGCTGCCGGGGGCCGG - Intergenic
936062523 2:109304789-109304811 AATTCACAGCTGTCCCGGGCAGG - Intronic
936535717 2:113309452-113309474 GACACACAGCTGGCCAGGGCAGG - Intergenic
940850770 2:158686232-158686254 GATACACAGCTGCCCTTTGCTGG + Intergenic
940883300 2:158968480-158968502 GATCCGCCGCAGCCCGGGGCGGG + Intergenic
942140019 2:172968269-172968291 CATCCACAGCTGGCCGACGCTGG - Intronic
943117395 2:183691109-183691131 TATCCTGAGCTGCCTGGGGCTGG + Intergenic
943418678 2:187638051-187638073 GAACCACGGGAGCCCGGGGCAGG + Intergenic
943712438 2:191111948-191111970 GATCAACGGCTGCCTGGGGCTGG + Intronic
947745850 2:232506901-232506923 GATGCAGGGCTGCCTGGGGCAGG + Intergenic
947825875 2:233105705-233105727 GATCACCTGCTGCCCTGGGCAGG - Intronic
948035859 2:234857832-234857854 GAAACACAGCTGCACGAGGCGGG + Intergenic
948192657 2:236071856-236071878 GCACCACAGCTGCCTGCGGCTGG + Intronic
948600164 2:239103338-239103360 GGGCCACAGCTGCCAGGGTCTGG + Intronic
948676695 2:239601134-239601156 GCTCCAGAGCTGCGTGGGGCTGG - Intergenic
948860699 2:240751324-240751346 GAGCCACACCTGCCTGGAGCAGG - Intronic
948992305 2:241561328-241561350 CATCCTCGGCTGCCAGGGGCAGG + Intronic
1170122020 20:12922252-12922274 GTTCCACAGATCCCCAGGGCAGG - Intergenic
1172091129 20:32433725-32433747 GATCCACAGTTTCCTGAGGCAGG - Exonic
1172125434 20:32622722-32622744 GGGCCTCAGCTGCCCGGGTCGGG - Intergenic
1173182261 20:40814346-40814368 ATTACACAGCTGCACGGGGCGGG + Intergenic
1174949514 20:55028938-55028960 GATACACAGCTTCCCAGGTCTGG + Intergenic
1175259458 20:57665392-57665414 CATCCTCAGATTCCCGGGGCAGG - Intronic
1175311743 20:58017278-58017300 TAACCTCGGCTGCCCGGGGCCGG - Intergenic
1175873643 20:62219690-62219712 GGTCCCCAGCGGCCAGGGGCTGG + Intronic
1175901349 20:62361088-62361110 AATTCTCAGCTGCTCGGGGCGGG - Intronic
1176030418 20:63008740-63008762 GCTCCACAGGTCCCCGGAGCTGG + Intergenic
1176064630 20:63188167-63188189 GATCCACCGGTGAGCGGGGCTGG + Intergenic
1176116428 20:63433486-63433508 GGTCCAGAGCAGCCCGGGGCGGG + Intronic
1176423818 21:6535535-6535557 GCACCACAGCTGCCAGAGGCAGG - Intergenic
1177623411 21:23626453-23626475 GATCAATAGCTGCCTGGGGATGG - Intergenic
1177637071 21:23801395-23801417 GATTCACAGTTCCCCAGGGCTGG + Intergenic
1178082214 21:29077366-29077388 GCCCCTCAACTGCCCGGGGCCGG + Intergenic
1179183176 21:39062275-39062297 TACCCACAGCTGCCCACGGCAGG + Intergenic
1179699311 21:43143850-43143872 GCACCACAGCTGCCAGAGGCAGG - Intergenic
1179783689 21:43718425-43718447 CATCCACAGGTGCCTGGGTCTGG - Intergenic
1180666285 22:17515339-17515361 GAGCCACAGCTGGGCGTGGCCGG + Intronic
1180899177 22:19358508-19358530 GATACACAGGTGCCTGGGACTGG + Intronic
1181938436 22:26456002-26456024 AATTCACAGCTGCCCCAGGCTGG - Intronic
1183958673 22:41397764-41397786 GAGGGAGAGCTGCCCGGGGCAGG - Exonic
1184695051 22:46134294-46134316 GATGCAGAGCTGTCCGGGGCTGG - Intergenic
1185374082 22:50474384-50474406 GAGCCACAGCCGCCCGCAGCTGG + Intronic
1185384150 22:50524111-50524133 GGCCCACAGCTGCCTGGCGCAGG + Exonic
949881169 3:8662030-8662052 GATCCACAGTTCCACGTGGCTGG - Intronic
950716301 3:14850074-14850096 CCTCCCCAGCTGCCTGGGGCAGG + Intronic
953032337 3:39186922-39186944 GGTCCACATCTGGCCGGCGCAGG + Exonic
960054875 3:113270033-113270055 GGTCCACAGGTGCCCTGGGATGG - Intronic
961202920 3:125058580-125058602 GATCAACAGATTCCCAGGGCTGG - Intergenic
963921857 3:150913340-150913362 GAGCCACAGCTGCCAGGAGATGG - Intronic
965074864 3:163963492-163963514 GTTCCACAGATCCCTGGGGCAGG - Intergenic
966660556 3:182410061-182410083 GATCAATGGTTGCCCGGGGCTGG + Intergenic
966722357 3:183076905-183076927 GATTCACAGTTGCCTAGGGCTGG - Intronic
967735801 3:192951100-192951122 GAGCCAAAGCAGCCCAGGGCCGG + Intergenic
968160532 3:196423202-196423224 GAGGCACAGCTGCCCTGGGGAGG + Intronic
968453643 4:686682-686704 GAGCCACAGCTGCAGGGGTCAGG + Exonic
968546851 4:1203273-1203295 GACTCCCAGCTGCCCGGGGCTGG - Intronic
968581966 4:1399409-1399431 GAAGCCCAGCTGCCTGGGGCTGG + Intergenic
968711010 4:2117659-2117681 GATTCAGAGCTGCCATGGGCCGG - Intronic
969085367 4:4652390-4652412 GATCCCCAGCTGGCTGGGACTGG - Intergenic
972864334 4:43211908-43211930 GATCCACTGCTTCCTTGGGCTGG + Intergenic
975903929 4:79187334-79187356 GGCCCACTGCTGCCCAGGGCTGG + Intergenic
976600557 4:86934748-86934770 CCCCCACAGCAGCCCGGGGCAGG + Intronic
985959130 5:3286565-3286587 GAACCACAGCTGCCAGGGAGGGG + Intergenic
987153724 5:15066915-15066937 GATTCACAGCTCCGCAGGGCTGG + Intergenic
988491839 5:31711751-31711773 GATCCACGATTGCCCGTGGCTGG + Intronic
988962353 5:36382945-36382967 GATACACAGCTGCACAGGGCTGG - Intergenic
991261641 5:64674935-64674957 AATCCAGAGCTGCCAGGGTCTGG - Intergenic
991568351 5:68028882-68028904 GAGCTGCAGCTGCCTGGGGCTGG - Intergenic
992826414 5:80554083-80554105 GATTCACAGCTCCACGTGGCTGG - Intergenic
996084231 5:119287613-119287635 GAACAGCAGCTGCCAGGGGCTGG - Intronic
997344686 5:133179535-133179557 GATTCATGGCTGCCAGGGGCTGG - Intergenic
998142876 5:139709821-139709843 CAGCCAGAGCTGCCCGGAGCCGG - Intergenic
999141748 5:149367056-149367078 GATCTGTAGCTGCCCAGGGCTGG - Intronic
1002197639 5:177509874-177509896 GGTGCGCAGCTGCCCGGGGCGGG - Intronic
1002283848 5:178149316-178149338 GATGCTCAGCTGCCCAGGGCCGG - Exonic
1004565246 6:16789873-16789895 GATCCACAGATCCCTAGGGCAGG + Intergenic
1005960764 6:30691122-30691144 GATCCACAGCTGGATGGGGAAGG - Exonic
1007181814 6:39934254-39934276 CGTCCACAGCTTCCCGGGGCAGG - Intronic
1007578015 6:42938601-42938623 GAGACACAGCTGCCCTGGGAGGG + Exonic
1009844912 6:69122359-69122381 GAACCACGGGAGCCCGGGGCAGG + Intronic
1009929483 6:70160169-70160191 GACCCACAGCTCCACGTGGCTGG + Intronic
1011663020 6:89610283-89610305 GATCCGTGGTTGCCCGGGGCTGG - Intronic
1014098215 6:117482708-117482730 GAGCCGCAGCTGCCCGGGCCGGG - Exonic
1016849608 6:148603629-148603651 GATCTATAGCTGCCAGGAGCTGG - Intergenic
1018302368 6:162417356-162417378 GATGCCCGGCTGCCGGGGGCAGG - Intronic
1019440682 7:1044726-1044748 GAGCCACAGCAGCTTGGGGCTGG - Intronic
1019700021 7:2470298-2470320 GAAACACAGCTGCCCGGGTAAGG - Intergenic
1020137832 7:5596421-5596443 GGCCCAGAGCTGCCCTGGGCAGG + Intronic
1026164016 7:67894141-67894163 GATCAACTTCTGCCCAGGGCAGG - Intergenic
1026966950 7:74446164-74446186 GATCCAGAGCTCCCAGGGGCAGG + Intergenic
1029537395 7:101164456-101164478 GACCCACAGCCTCCCGGCGCCGG - Exonic
1030103805 7:105969714-105969736 GATCCACAGAGGCCAGGTGCAGG - Intronic
1034284775 7:149877657-149877679 GATCCTCATCTGCCCATGGCAGG + Intronic
1035051636 7:156002154-156002176 GGGCCACAGCAGCCCCGGGCTGG + Intergenic
1035382023 7:158446437-158446459 AAGCCACAGCTGCCCCCGGCAGG + Intronic
1035466976 7:159085827-159085849 GATCGGCAGTTGCCAGGGGCTGG + Intronic
1037817234 8:22118688-22118710 GAGCACCAGCTGCCCGAGGCTGG - Intronic
1039983395 8:42428094-42428116 GATCCACAGGTGGCCAGGGTGGG - Intronic
1041670582 8:60487828-60487850 GATCCATAGTTGCCAGGGGCTGG + Intergenic
1042253789 8:66782647-66782669 GATCAGCAGCTGCCAGGGGCTGG - Intronic
1045079113 8:98604930-98604952 GATCCACAGATCCCCAGGGCAGG + Intronic
1045857096 8:106776943-106776965 AATCCACAGCTGGCCGGGCGCGG - Intergenic
1048315145 8:133356229-133356251 GAGCCACAGCCTCCCGGGACAGG - Intergenic
1049223166 8:141437016-141437038 GACCCACAGCTCCCCATGGCGGG - Intergenic
1049223181 8:141437053-141437075 GACCCACAGCTCCCCACGGCGGG - Intergenic
1049223196 8:141437090-141437112 GACCCACAGCTCCCCATGGCGGG - Intergenic
1049223211 8:141437127-141437149 GACCCACAGCTCCCCACGGCGGG - Intergenic
1049223226 8:141437164-141437186 GACCCACAGCTCCCCACGGCGGG - Intergenic
1049223241 8:141437201-141437223 GACCCACAGCTCCCCACGGCGGG - Intergenic
1049223256 8:141437238-141437260 GACCCACAGCTCCCCACGGCGGG - Intergenic
1049223271 8:141437275-141437297 GACCCACAGCTCCCCACGGCGGG - Intergenic
1050358760 9:4807806-4807828 GACCCATAGCTGCCAGGCGCGGG - Intronic
1050893878 9:10860184-10860206 GAGCTTCAGCTGCCCTGGGCTGG - Intergenic
1052258939 9:26492043-26492065 GAACCACGGGAGCCCGGGGCAGG - Intergenic
1052702267 9:31951289-31951311 GTTCCACAGATCCCCAGGGCAGG + Intergenic
1053082069 9:35184618-35184640 GAACCACGGGAGCCCGGGGCAGG + Intronic
1053882732 9:42612011-42612033 GTTCCACAGCTCTCCGGGTCAGG + Intergenic
1053889937 9:42682291-42682313 GTTCCACAGCTCTCCGGGTCAGG - Intergenic
1054221759 9:62419479-62419501 GTTCCACAGCTCTCCGGGTCAGG + Intergenic
1054228955 9:62489694-62489716 GTTCCACAGCTCTCCGGGTCAGG - Intergenic
1054891839 9:70259568-70259590 GATCCATAGCGGCCCTGGTCTGG + Intronic
1055335231 9:75226918-75226940 GTTCCACAGCTCCCCAGGGCAGG + Intergenic
1055554629 9:77462228-77462250 GAGTCACAGCTGCCCGAGTCTGG - Intronic
1056475030 9:86945656-86945678 AAGCCACAGGTGCCCGGCGCGGG + Exonic
1056765589 9:89442826-89442848 GACTCACATCTGCCCGGGTCTGG - Intronic
1058597401 9:106629834-106629856 TATTCACACCTGCCTGGGGCTGG + Intergenic
1059527666 9:115007294-115007316 GATCCACGGTTGCCCAGAGCAGG - Intergenic
1060147949 9:121268239-121268261 GACCCCCAGATGCCCGGGGCCGG - Intronic
1060266131 9:122112384-122112406 TACCCACAGCTGCCCTGGGAGGG + Intergenic
1060476115 9:123988073-123988095 ACACCACAGCTGCCCGGGGCTGG - Intergenic
1061015931 9:127980795-127980817 GCGCCTCCGCTGCCCGGGGCCGG - Intergenic
1061389564 9:130309945-130309967 GATCCGCAGCTTCCCAGAGCTGG - Intronic
1061520537 9:131114878-131114900 GTGCCACACCTGCCCAGGGCTGG + Intronic
1061596254 9:131631344-131631366 GATTGGCAGCTGCCAGGGGCTGG - Intronic
1062095681 9:134702008-134702030 GATCCCCAGCTGCCCCGGGTGGG + Intronic
1062345190 9:136111186-136111208 GAATCAGAGCTGCCCGGCGCTGG - Intergenic
1062535450 9:137019213-137019235 GATCCGCAGCTTCCTGGAGCAGG - Exonic
1062716594 9:138013523-138013545 GATTCACAGTTGCCTGGGGAGGG - Intronic
1186530571 X:10291011-10291033 GATCCGTGGCTGCCAGGGGCTGG - Intergenic
1186861016 X:13672599-13672621 GATTCACAGTTACCTGGGGCTGG + Intronic
1193593913 X:83422632-83422654 GTTCCACAGCTCCCTAGGGCTGG - Intergenic
1193815619 X:86101791-86101813 AAGCCACAGCTGCCTGGGGTGGG - Intergenic
1194613661 X:96074876-96074898 GTTCCACAGGTCCCCTGGGCAGG + Intergenic
1194744515 X:97613753-97613775 GCTCCATAGCTGCACGTGGCTGG + Intergenic