ID: 1144787471

View in Genome Browser
Species Human (GRCh38)
Location 17:17840098-17840120
Sequence GCGGAGCCGCCCCGGCTCTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144787471_1144787483 15 Left 1144787471 17:17840098-17840120 CCGGAGAGCCGGGGCGGCTCCGC No data
Right 1144787483 17:17840136-17840158 GGCAGCGGCTGGAGACCCAGGGG No data
1144787471_1144787478 0 Left 1144787471 17:17840098-17840120 CCGGAGAGCCGGGGCGGCTCCGC No data
Right 1144787478 17:17840121-17840143 ACGCGCGCGGGCCAGGGCAGCGG No data
1144787471_1144787475 -7 Left 1144787471 17:17840098-17840120 CCGGAGAGCCGGGGCGGCTCCGC No data
Right 1144787475 17:17840114-17840136 GCTCCGCACGCGCGCGGGCCAGG No data
1144787471_1144787484 21 Left 1144787471 17:17840098-17840120 CCGGAGAGCCGGGGCGGCTCCGC No data
Right 1144787484 17:17840142-17840164 GGCTGGAGACCCAGGGGAGCCGG No data
1144787471_1144787481 13 Left 1144787471 17:17840098-17840120 CCGGAGAGCCGGGGCGGCTCCGC No data
Right 1144787481 17:17840134-17840156 AGGGCAGCGGCTGGAGACCCAGG No data
1144787471_1144787476 -6 Left 1144787471 17:17840098-17840120 CCGGAGAGCCGGGGCGGCTCCGC No data
Right 1144787476 17:17840115-17840137 CTCCGCACGCGCGCGGGCCAGGG No data
1144787471_1144787482 14 Left 1144787471 17:17840098-17840120 CCGGAGAGCCGGGGCGGCTCCGC No data
Right 1144787482 17:17840135-17840157 GGGCAGCGGCTGGAGACCCAGGG No data
1144787471_1144787479 4 Left 1144787471 17:17840098-17840120 CCGGAGAGCCGGGGCGGCTCCGC No data
Right 1144787479 17:17840125-17840147 GCGCGGGCCAGGGCAGCGGCTGG No data
1144787471_1144787485 22 Left 1144787471 17:17840098-17840120 CCGGAGAGCCGGGGCGGCTCCGC No data
Right 1144787485 17:17840143-17840165 GCTGGAGACCCAGGGGAGCCGGG No data
1144787471_1144787486 23 Left 1144787471 17:17840098-17840120 CCGGAGAGCCGGGGCGGCTCCGC No data
Right 1144787486 17:17840144-17840166 CTGGAGACCCAGGGGAGCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144787471 Original CRISPR GCGGAGCCGCCCCGGCTCTC CGG (reversed) Intergenic
No off target data available for this crispr