ID: 1144787472

View in Genome Browser
Species Human (GRCh38)
Location 17:17840106-17840128
Sequence GCGCGCGTGCGGAGCCGCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144787472_1144787481 5 Left 1144787472 17:17840106-17840128 CCGGGGCGGCTCCGCACGCGCGC No data
Right 1144787481 17:17840134-17840156 AGGGCAGCGGCTGGAGACCCAGG No data
1144787472_1144787478 -8 Left 1144787472 17:17840106-17840128 CCGGGGCGGCTCCGCACGCGCGC No data
Right 1144787478 17:17840121-17840143 ACGCGCGCGGGCCAGGGCAGCGG No data
1144787472_1144787482 6 Left 1144787472 17:17840106-17840128 CCGGGGCGGCTCCGCACGCGCGC No data
Right 1144787482 17:17840135-17840157 GGGCAGCGGCTGGAGACCCAGGG No data
1144787472_1144787486 15 Left 1144787472 17:17840106-17840128 CCGGGGCGGCTCCGCACGCGCGC No data
Right 1144787486 17:17840144-17840166 CTGGAGACCCAGGGGAGCCGGGG No data
1144787472_1144787485 14 Left 1144787472 17:17840106-17840128 CCGGGGCGGCTCCGCACGCGCGC No data
Right 1144787485 17:17840143-17840165 GCTGGAGACCCAGGGGAGCCGGG No data
1144787472_1144787484 13 Left 1144787472 17:17840106-17840128 CCGGGGCGGCTCCGCACGCGCGC No data
Right 1144787484 17:17840142-17840164 GGCTGGAGACCCAGGGGAGCCGG No data
1144787472_1144787483 7 Left 1144787472 17:17840106-17840128 CCGGGGCGGCTCCGCACGCGCGC No data
Right 1144787483 17:17840136-17840158 GGCAGCGGCTGGAGACCCAGGGG No data
1144787472_1144787479 -4 Left 1144787472 17:17840106-17840128 CCGGGGCGGCTCCGCACGCGCGC No data
Right 1144787479 17:17840125-17840147 GCGCGGGCCAGGGCAGCGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144787472 Original CRISPR GCGCGCGTGCGGAGCCGCCC CGG (reversed) Intergenic
No off target data available for this crispr