ID: 1144787484

View in Genome Browser
Species Human (GRCh38)
Location 17:17840142-17840164
Sequence GGCTGGAGACCCAGGGGAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144787471_1144787484 21 Left 1144787471 17:17840098-17840120 CCGGAGAGCCGGGGCGGCTCCGC No data
Right 1144787484 17:17840142-17840164 GGCTGGAGACCCAGGGGAGCCGG No data
1144787477_1144787484 2 Left 1144787477 17:17840117-17840139 CCGCACGCGCGCGGGCCAGGGCA No data
Right 1144787484 17:17840142-17840164 GGCTGGAGACCCAGGGGAGCCGG No data
1144787472_1144787484 13 Left 1144787472 17:17840106-17840128 CCGGGGCGGCTCCGCACGCGCGC No data
Right 1144787484 17:17840142-17840164 GGCTGGAGACCCAGGGGAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144787484 Original CRISPR GGCTGGAGACCCAGGGGAGC CGG Intergenic
No off target data available for this crispr