ID: 1144789572

View in Genome Browser
Species Human (GRCh38)
Location 17:17849934-17849956
Sequence AAGCTGACCTTCTGGGGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 298}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144789559_1144789572 27 Left 1144789559 17:17849884-17849906 CCTCCCTGACACCCAGGCAGCTG 0: 1
1: 1
2: 4
3: 56
4: 549
Right 1144789572 17:17849934-17849956 AAGCTGACCTTCTGGGGAGGAGG 0: 1
1: 0
2: 3
3: 26
4: 298
1144789561_1144789572 23 Left 1144789561 17:17849888-17849910 CCTGACACCCAGGCAGCTGCCTT 0: 1
1: 0
2: 1
3: 37
4: 347
Right 1144789572 17:17849934-17849956 AAGCTGACCTTCTGGGGAGGAGG 0: 1
1: 0
2: 3
3: 26
4: 298
1144789560_1144789572 24 Left 1144789560 17:17849887-17849909 CCCTGACACCCAGGCAGCTGCCT 0: 1
1: 0
2: 0
3: 47
4: 406
Right 1144789572 17:17849934-17849956 AAGCTGACCTTCTGGGGAGGAGG 0: 1
1: 0
2: 3
3: 26
4: 298
1144789564_1144789572 15 Left 1144789564 17:17849896-17849918 CCAGGCAGCTGCCTTCTTTGGCA 0: 1
1: 0
2: 0
3: 16
4: 277
Right 1144789572 17:17849934-17849956 AAGCTGACCTTCTGGGGAGGAGG 0: 1
1: 0
2: 3
3: 26
4: 298
1144789566_1144789572 4 Left 1144789566 17:17849907-17849929 CCTTCTTTGGCAAGGCATGTGTT 0: 1
1: 0
2: 3
3: 27
4: 172
Right 1144789572 17:17849934-17849956 AAGCTGACCTTCTGGGGAGGAGG 0: 1
1: 0
2: 3
3: 26
4: 298
1144789563_1144789572 16 Left 1144789563 17:17849895-17849917 CCCAGGCAGCTGCCTTCTTTGGC 0: 1
1: 0
2: 0
3: 22
4: 302
Right 1144789572 17:17849934-17849956 AAGCTGACCTTCTGGGGAGGAGG 0: 1
1: 0
2: 3
3: 26
4: 298

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144789572 Original CRISPR AAGCTGACCTTCTGGGGAGG AGG Intronic
900096232 1:941216-941238 ACGCTGACCTGCCGTGGAGGAGG - Exonic
901181000 1:7341844-7341866 GAGCTGGCCTCCTGGGGAGGAGG + Intronic
902438094 1:16410912-16410934 ATGCTTACCTTCTGGTCAGGAGG - Intronic
902459209 1:16559840-16559862 AATCTGAGCTACTTGGGAGGCGG - Intergenic
902512597 1:16974574-16974596 AAGCAGACCAGCTGGGGTGGGGG + Exonic
902836805 1:19052817-19052839 AAGGTGACCCGGTGGGGAGGAGG - Intergenic
904028708 1:27520777-27520799 ATGCGGGCCTGCTGGGGAGGCGG + Intergenic
904119842 1:28190789-28190811 AAGCTGAGGTTGTGGTGAGGAGG - Intronic
904423271 1:30407688-30407710 AGGCAGACCTCCTGGGGATGAGG - Intergenic
905199186 1:36305098-36305120 GTGCTTGCCTTCTGGGGAGGCGG + Exonic
905210918 1:36373598-36373620 ATGCTGACAGGCTGGGGAGGCGG + Intronic
905708047 1:40077122-40077144 AAGCAGAAATTCTGGGGAAGTGG - Intronic
905933878 1:41808303-41808325 AACTGGACCTTCTGGGGAGCAGG - Intronic
910751268 1:90633867-90633889 CAGATGATCTGCTGGGGAGGTGG + Intergenic
913138398 1:115915172-115915194 CTGCAGACATTCTGGGGAGGGGG + Intergenic
915932604 1:160069641-160069663 AACCTGTCCATATGGGGAGGAGG + Intronic
916363391 1:163996619-163996641 AAGCTAGCCTGCTGGGGAGAAGG - Intergenic
917264201 1:173202733-173202755 AAGCTGAAAAGCTGGGGAGGTGG - Intronic
917645761 1:177027121-177027143 AAAATGGCCTTCTGTGGAGGAGG - Intronic
920689425 1:208134636-208134658 TGGCTGAGCCTCTGGGGAGGAGG - Intronic
922905521 1:229170758-229170780 AAAGTGACTTTCTGGGGAGAGGG - Intergenic
923584993 1:235261115-235261137 AAGCTCAAATTCTGGGGTGGGGG + Intronic
924541588 1:244985743-244985765 AATCTGAGCTACTTGGGAGGCGG + Intronic
924744383 1:246818504-246818526 AAGCAGACCAGCTGGGGTGGGGG - Intergenic
924845440 1:247764633-247764655 AAGATAACTTTCTGGGGTGGTGG - Intergenic
1063426692 10:5955964-5955986 AAGGCGTCCTTCTTGGGAGGGGG + Intronic
1065787381 10:29229393-29229415 CAGCTGACTGTCTGGGGAGCAGG + Intergenic
1065787438 10:29229629-29229651 CGGCTGACCATGTGGGGAGGAGG + Intergenic
1067282604 10:44883738-44883760 CTGCTGACCTTCCGGGAAGGAGG - Intergenic
1070599487 10:77855885-77855907 AAGAGGACTTTCTGGGAAGGAGG - Intronic
1070764420 10:79048300-79048322 AAAGTTTCCTTCTGGGGAGGAGG - Intergenic
1071145105 10:82559582-82559604 AAGCTGTCCTTCTGGGTTGCAGG - Intronic
1071973338 10:90930455-90930477 AAGCAGATCTTTTAGGGAGGAGG + Intergenic
1072174892 10:92910487-92910509 AAGGGGACTTTCTGGGGAGATGG + Intronic
1072609981 10:97011475-97011497 CAGCTGAGCTGCTGGGGAGGTGG - Intronic
1072781177 10:98252805-98252827 GAGCTGACCTGCTGGGAAGAGGG + Intronic
1073317560 10:102593570-102593592 TAGCTGACCTTCTTGGGGTGGGG + Intronic
1073480327 10:103782645-103782667 AAGCTCACATTCTGGGGAGAAGG + Intronic
1075124806 10:119691165-119691187 AAGAGGATCTTCTGGGGAGCAGG + Intergenic
1075295665 10:121272770-121272792 AAGCTGTCCATCTGGGGCTGGGG + Intergenic
1076224020 10:128758922-128758944 CAGCTGAGCTTCTGGGCAGTGGG - Intergenic
1077236153 11:1482900-1482922 AGCCTGCCCTTCTGGGAAGGAGG - Intronic
1077295540 11:1824776-1824798 AAGGTGACCCTCTGGGTTGGGGG + Intergenic
1077420537 11:2447917-2447939 GAGCTGCTCTCCTGGGGAGGGGG - Intronic
1077573175 11:3356326-3356348 AAGCAGACCTTCCTGGGAGGTGG + Intronic
1077877548 11:6320584-6320606 GAGTTGGCCTTCTGGGGCGGCGG + Exonic
1080001858 11:27359388-27359410 AATCTGACTTTATGCGGAGGTGG - Intronic
1081797270 11:45829466-45829488 AAGCTTCTCTTCTGTGGAGGTGG - Intergenic
1083243216 11:61405110-61405132 TAGCTTACCTTAAGGGGAGGGGG + Intronic
1083327033 11:61878123-61878145 CATCTGTCCTTCTGGGGTGGGGG - Intronic
1083972013 11:66084042-66084064 GAGCTTACCTTCTGGGGACAGGG + Intronic
1084333943 11:68446242-68446264 GAGATGACCTTCGGGGCAGGTGG + Intronic
1084398143 11:68928177-68928199 AAGCTGACCTTGTGGGGCTCAGG - Intronic
1089402083 11:118170169-118170191 AAGCTTATATTCTGGGGAGAAGG + Intronic
1089635145 11:119807296-119807318 CAGCTCTCCTCCTGGGGAGGGGG + Intergenic
1091016051 11:132051666-132051688 AAGGGGTCCTCCTGGGGAGGAGG - Intronic
1091288961 11:134426377-134426399 AAGCTGAGCTCCCAGGGAGGAGG - Intergenic
1091822306 12:3484884-3484906 AACAAGACCTTCTGGGGAGTGGG + Intronic
1091884126 12:4003520-4003542 AAGATGCCCTTCTGGGGAACAGG + Intergenic
1092531092 12:9346193-9346215 AAGCTGAAGTGCTTGGGAGGGGG - Intergenic
1092566212 12:9668329-9668351 ATGCTGAGATTCTGGGGAGAGGG + Intronic
1093762210 12:22923194-22923216 AGGTTGGCATTCTGGGGAGGAGG + Intergenic
1094056939 12:26277683-26277705 AAGCTGACCTGCTGGGCTAGTGG + Intronic
1094196111 12:27751656-27751678 AAGCTGTCCGTCTGGACAGGAGG - Intronic
1095295578 12:40523664-40523686 AAGGTGACCTACTGGGAAGGAGG - Intronic
1095960098 12:47828944-47828966 AGGTTGACCTTTTGGGGCGGGGG + Intronic
1095982262 12:47980320-47980342 CTGCTGATCTCCTGGGGAGGAGG - Intronic
1096157560 12:49348975-49348997 ATGCTGACCCTGGGGGGAGGTGG + Exonic
1097221731 12:57455156-57455178 AACCTGAGCTGATGGGGAGGAGG + Intronic
1098450008 12:70609585-70609607 AAGCTGTCATTCTGGGTTGGGGG + Intronic
1100971729 12:100078325-100078347 CTGCTCAGCTTCTGGGGAGGAGG - Intronic
1101703888 12:107201926-107201948 ATGCTGACTTTCTTTGGAGGTGG - Intergenic
1101942741 12:109111911-109111933 AAGCTGGCTTTCACGGGAGGAGG + Intergenic
1102452391 12:113051703-113051725 AAGCTGACCTTCTAGGTGGCAGG - Intergenic
1102791665 12:115651456-115651478 AAGGAAACTTTCTGGGGAGGTGG + Intergenic
1106022755 13:25930622-25930644 ATGCTTACATTCTGGGGAAGGGG - Intronic
1106298581 13:28440926-28440948 CACCTGACATTCTTGGGAGGAGG - Intronic
1106562507 13:30858942-30858964 AGCCTGACGTTCTGGGGAGGTGG + Intergenic
1112455010 13:99552195-99552217 AATCTGATCCTCTGGGGAGAAGG + Exonic
1113778125 13:112960535-112960557 AGGCTGTCATTCTGGGGAAGGGG + Intronic
1114307535 14:21437383-21437405 AACCTAACCTGCGGGGGAGGGGG - Intronic
1114649892 14:24277817-24277839 ATGCTGGCCTTGTGGGGAAGCGG + Intergenic
1115452866 14:33568590-33568612 AACTTGACCTTCTGGGAAGGAGG + Intronic
1116992921 14:51294355-51294377 AAGCTAACCTTCTGGATGGGAGG - Intergenic
1118384928 14:65248178-65248200 TAGCTCCTCTTCTGGGGAGGGGG - Intergenic
1118751221 14:68808962-68808984 CTGGTGTCCTTCTGGGGAGGGGG - Intergenic
1119665042 14:76479499-76479521 AACCTGACCTTCTAGGCAGAAGG + Intronic
1121587914 14:95076423-95076445 AAGCTTACATCCTGGGGATGGGG - Intergenic
1121706768 14:96002201-96002223 ACACTGAACTCCTGGGGAGGGGG + Intergenic
1123165793 14:106324056-106324078 CAGCTGAGGTGCTGGGGAGGAGG + Intergenic
1123176182 14:106421504-106421526 AAGCTGAGGTGCTGGCGAGGAGG + Intergenic
1202947502 14_KI270726v1_random:42061-42083 AAGCTGAGGTGCTGGCGAGGAGG - Intergenic
1124148966 15:27159801-27159823 CTGCTTACCTTATGGGGAGGAGG + Intronic
1124252353 15:28115163-28115185 AAGCTGAGCTTTTGGGCAGCTGG - Intronic
1124417200 15:29481941-29481963 AAGCTGTGCTTCTGGGGAGAGGG - Intronic
1124691058 15:31823282-31823304 AAGCTGGGCTTCGAGGGAGGAGG + Intronic
1126065897 15:44826175-44826197 ATGCTAATCTTCTGGGGTGGGGG + Intergenic
1126093937 15:45074391-45074413 ATGCTAATCTTCTGGGGTGGGGG - Exonic
1127317198 15:57808297-57808319 TACCTGATCATCTGGGGAGGGGG + Intergenic
1128518287 15:68357872-68357894 AAGATGATCTTCTGGTGATGGGG + Intronic
1128787278 15:70407095-70407117 AAGCTCTCCTTGTAGGGAGGAGG - Intergenic
1129030133 15:72611911-72611933 ATGGTGACCTCCTGGGGAGCAGG + Intergenic
1129250474 15:74306119-74306141 GAGGTGAACTTCTGGAGAGGGGG - Intronic
1131468284 15:92673286-92673308 AAGCTGACCTTAGGTGGGGGTGG - Intronic
1131894609 15:97012761-97012783 AACCTGACCTTTTGGGAAAGTGG - Intergenic
1131992622 15:98105612-98105634 AAGTTGACCTTCTGGGGCTCAGG - Intergenic
1132098308 15:99004862-99004884 AAGTTGACCTTCTGGGGCTCAGG + Intronic
1132155727 15:99494272-99494294 TAGCTAATCTACTGGGGAGGTGG - Intergenic
1132746834 16:1439689-1439711 AAGGTGACCTCCTGGGGGGCAGG - Intronic
1132900522 16:2251602-2251624 GAGCTCGCCTCCTGGGGAGGGGG + Exonic
1133978451 16:10617007-10617029 GAGCTGCCCCTCTGGGGAGGGGG + Intergenic
1136516617 16:30772424-30772446 AAACTGACAGTCAGGGGAGGAGG + Intronic
1137620548 16:49873824-49873846 TCCCTGACCTTCTGGGGAGAGGG - Intergenic
1137737758 16:50737566-50737588 AAGCTGACATTCTAGGGGAGGGG - Intergenic
1138513323 16:57521388-57521410 CAGCTCACATTGTGGGGAGGTGG + Intronic
1138513753 16:57524352-57524374 CAGCTCACATTGTGGGGAGGTGG - Intronic
1138588682 16:57987513-57987535 AGGCTGAACTCCTGGGGAGATGG - Exonic
1139242320 16:65405860-65405882 AAGATGAGCTTCTGGGTATGAGG - Intergenic
1141158339 16:81612304-81612326 AAGCAGACACTCTTGGGAGGAGG - Intronic
1142286504 16:89173609-89173631 AAGCTGAGCTGCTGGGGGAGGGG - Intronic
1142533332 17:597328-597350 AAGCAGACCTCTTGGGGTGGGGG - Intronic
1143987229 17:10925431-10925453 AGGCTTACATTCTGGTGAGGAGG + Intergenic
1144202367 17:12953099-12953121 AAGCTGACCTACATGGGAGCTGG + Intronic
1144789572 17:17849934-17849956 AAGCTGACCTTCTGGGGAGGAGG + Intronic
1144958296 17:19030691-19030713 AAGCTGGGCTTCTGGGGATCAGG + Intronic
1144976862 17:19143833-19143855 AAGCTGGGCTTCTGGGGATCAGG - Intronic
1145056385 17:19706530-19706552 GAGCTGCCATCCTGGGGAGGGGG + Intronic
1146298963 17:31673344-31673366 AAGCTGAGGTTCAGAGGAGGAGG + Intergenic
1147260765 17:39208773-39208795 AAGCTCAGCTTCTGTGTAGGGGG + Intergenic
1147264164 17:39225177-39225199 ATCGCGACCTTCTGGGGAGGCGG - Intronic
1147776045 17:42902151-42902173 AAACTGACTCTCTGGGGAGCAGG + Intronic
1148131922 17:45267283-45267305 AAGCTGAGCTGCTGGGGAAGGGG + Intronic
1150299100 17:64033722-64033744 AAGAGGACCTTCTGGGGAGGTGG + Intergenic
1152026368 17:77812012-77812034 AGGCTGAGCATTTGGGGAGGAGG - Intergenic
1152601187 17:81263076-81263098 AAGCTGATCGGCAGGGGAGGGGG + Intronic
1153170435 18:2310307-2310329 AAGCGGAGGTTCTAGGGAGGAGG + Intergenic
1153799857 18:8659487-8659509 AAGATGAGATTGTGGGGAGGAGG + Intergenic
1156368591 18:36452042-36452064 AAGCTGGGCTCCTGGGGATGAGG + Intronic
1157868889 18:51211328-51211350 AAGCAGACATTTAGGGGAGGTGG + Intronic
1159141610 18:64402420-64402442 GAGCTTACCTTCTAGTGAGGGGG - Intergenic
1159633723 18:70779933-70779955 AAGCTGACATTTTAGGGGGGAGG + Intergenic
1161757566 19:6145517-6145539 AACCTGGTCTACTGGGGAGGTGG - Intronic
1162824431 19:13243036-13243058 CACCTGCCCTTCTGGGGAGCTGG + Intronic
1162827789 19:13264291-13264313 AAGGTGACCCACTGGGGATGGGG - Intronic
1162996589 19:14339725-14339747 GTGTTGACATTCTGGGGAGGGGG - Intergenic
1163400252 19:17087809-17087831 AATCTGAGCTACTTGGGAGGCGG + Intronic
1163931661 19:20399536-20399558 AATCTCAGCTACTGGGGAGGCGG + Intergenic
1164411392 19:28008788-28008810 CAGCTGATCTTCTGGGTGGGTGG - Intergenic
1164792765 19:31002186-31002208 GAGCTGCCCATATGGGGAGGCGG + Intergenic
1164885038 19:31771277-31771299 AATCTGAGCCTCTGTGGAGGGGG - Intergenic
1165278035 19:34771828-34771850 AAGCTGACATTCTGGGGTTGGGG + Intronic
1165710231 19:38005611-38005633 GAGCTGACATTAAGGGGAGGGGG - Intronic
1166389361 19:42400466-42400488 CACCTGACCTTCTGGTCAGGTGG + Intergenic
1167135001 19:47610457-47610479 CAGCTGAACTTCCCGGGAGGTGG + Intronic
1202675453 1_KI270711v1_random:2024-2046 AATCTGAGCTACTTGGGAGGCGG - Intergenic
1202708268 1_KI270714v1_random:44-66 AATCTGAGCTACTTGGGAGGCGG + Intergenic
925212499 2:2061923-2061945 AAGCTTTCCCTCTGGGGAGCTGG - Intronic
925621176 2:5794284-5794306 AATCTAAGCTGCTGGGGAGGTGG - Intergenic
929164002 2:38862311-38862333 AAGAGGCCTTTCTGGGGAGGAGG - Exonic
929596599 2:43180060-43180082 AGCCTGGCCTGCTGGGGAGGGGG - Intergenic
930040966 2:47123435-47123457 AAGCTTACGTTCTAGTGAGGGGG + Intronic
932469515 2:71944712-71944734 AAGCTGACCCTTAGGGGATGAGG - Intergenic
936472653 2:112812626-112812648 AAGCTCATTTTCTGTGGAGGGGG + Intergenic
937340213 2:121086441-121086463 TAGCTGACATGCTGGGGAGCAGG - Intergenic
941729551 2:168901198-168901220 ATGCTGACCATCTGTGGAGAGGG - Intronic
942458730 2:176155285-176155307 AACCTGAACTTCTGAGGTGGGGG - Intronic
944843023 2:203642436-203642458 TAGCTAACCTAGTGGGGAGGTGG - Intergenic
945217192 2:207446406-207446428 ATACTGATTTTCTGGGGAGGGGG - Intergenic
948059915 2:235035118-235035140 AAGGTGAGCTTCTGGGGAACAGG + Exonic
1168836078 20:878255-878277 AGGCTGCCCTTCTGGTGAGCTGG + Exonic
1168954816 20:1827519-1827541 AATCTGAATTTCTGGGGATGTGG - Intergenic
1169142725 20:3235385-3235407 CACCTGCCCTCCTGGGGAGGCGG - Intronic
1170324359 20:15139879-15139901 CAGCTGACCTTCTGGTGACCAGG + Intronic
1170420063 20:16184002-16184024 AAGCCGACATGCTGGAGAGGGGG - Intergenic
1172294391 20:33798347-33798369 AAGGTGAGATTCTGGGGATGAGG + Intergenic
1175295859 20:57908293-57908315 GAGCTCACCTTCTGGTGTGGAGG + Intergenic
1178146330 21:29744481-29744503 AAGCAGACATTCTGAGGAGAGGG + Intronic
1178586327 21:33874272-33874294 AAGCAGACCATTTGGGGTGGTGG - Intronic
1179562397 21:42223946-42223968 CAGCTGGCCTCCTGGGGTGGAGG + Intronic
1179790788 21:43754836-43754858 AAACTGACTTGTTGGGGAGGAGG - Intronic
1179891822 21:44339109-44339131 AAGCTCAACTGCTGGTGAGGCGG - Exonic
1181864430 22:25844099-25844121 AAGCTGGCCTCCTGGGGAGGTGG + Intronic
1182294812 22:29306705-29306727 GAGCCCACCGTCTGGGGAGGGGG + Intronic
1182352609 22:29707219-29707241 GAGCCGAGCTCCTGGGGAGGGGG - Intergenic
1182765034 22:32752640-32752662 AGGATGCCCTTCTGGGGTGGTGG - Intronic
1182899380 22:33885302-33885324 TAGCTGACCCTCTGCGGAGGGGG + Intronic
1183770737 22:39923523-39923545 AAGCTTACCTTCTAGTGGGGAGG - Intronic
1184042624 22:41953001-41953023 CAGCTGCCTTTCTGGGGAGCTGG - Intergenic
1184642216 22:45878697-45878719 AATCTGCCCTGCTGGGCAGGCGG - Intergenic
1184788781 22:46686296-46686318 AAGCTGGCCATCCGTGGAGGAGG - Exonic
952697490 3:36285453-36285475 AAGCAGCCAATCTGGGGAGGGGG - Intergenic
953333929 3:42078115-42078137 AATCTGACCTTCTGGGGCAAAGG + Intronic
953433180 3:42856233-42856255 AGGCTGAGCTCCTGGGGTGGGGG + Intronic
953535794 3:43775727-43775749 CAGCTGGCCTGGTGGGGAGGTGG + Intergenic
953569252 3:44058223-44058245 TGGCTGTCCTTCTGAGGAGGAGG + Intergenic
953673969 3:44985888-44985910 TAGCTAATCTACTGGGGAGGTGG - Intronic
953899451 3:46831431-46831453 AAGCTGCCTTCCTGAGGAGGAGG - Intronic
954846939 3:53567547-53567569 AGGCTCACCCTCTGGTGAGGTGG - Intronic
955092433 3:55766200-55766222 AAGCTGCCCATTTGGAGAGGGGG + Intronic
957259434 3:77880790-77880812 AAGCTCCCATTCTGGGGAGCAGG - Intergenic
957432562 3:80130685-80130707 AAGGTGAGGTTTTGGGGAGGTGG - Intergenic
957996175 3:87692561-87692583 TAGATGAGCTACTGGGGAGGCGG - Intergenic
958511121 3:95050328-95050350 GTGCTGACCTTCCGGGAAGGTGG - Intergenic
960279617 3:115766643-115766665 AAGCTGTCCTGCAGGGAAGGAGG + Intergenic
960617975 3:119613550-119613572 AAGCTTGTCATCTGGGGAGGAGG - Intronic
960714157 3:120559436-120559458 AAACTGCCCTTCTGGGGCCGGGG + Intergenic
963803710 3:149701804-149701826 GTGCTTGCCTTCTGGGGAGGCGG + Intronic
964490363 3:157229392-157229414 AAGCTTACCTTTTGAGGAAGAGG - Intergenic
964720339 3:159763738-159763760 AGGCACACCTTTTGGGGAGGCGG + Intronic
966643568 3:182217337-182217359 ATCTTGACCCTCTGGGGAGGAGG + Intergenic
968508227 4:982244-982266 AAGCTGAGCTTGTGGGGTGCTGG - Intronic
969362987 4:6676996-6677018 GAGCTGACCATCTGAGGTGGTGG + Intergenic
969509556 4:7610050-7610072 AAGGTGACGGTCTGGGGAGAGGG - Intronic
970365535 4:15354411-15354433 AAGCTGACCATGTGTGGGGGAGG + Intronic
970595951 4:17600392-17600414 AAGCAGAGCTTCTAGGGTGGGGG + Intronic
971533839 4:27722801-27722823 TTGCTGACCTTCTGTGTAGGTGG + Intergenic
973926660 4:55746055-55746077 AGACTCTCCTTCTGGGGAGGGGG + Intergenic
977128532 4:93201957-93201979 AAGCTCAGCTTCTTGGGAGGTGG + Intronic
977332798 4:95658923-95658945 AGTCACACCTTCTGGGGAGGGGG - Intergenic
977693965 4:99946881-99946903 AAGCGGACCTGCCCGGGAGGCGG + Intergenic
978251321 4:106634488-106634510 AATCTCAGCTACTGGGGAGGCGG - Intergenic
978942664 4:114456100-114456122 AAGCTGACCTATTGGGGGGTGGG - Intergenic
979049186 4:115909015-115909037 CTGCTGAGCTTCTGGGGATGAGG + Intergenic
980349184 4:131665426-131665448 AAGATGTCCTGCTGGTGAGGGGG - Intergenic
980938012 4:139244557-139244579 AAGCTTACCTTCTGGGCAGAGGG - Intergenic
982725824 4:158904791-158904813 AAACTGACCTTTTTGGTAGGAGG + Exonic
985264436 4:188144912-188144934 AATCTGACCTTCAGAGGAAGAGG + Intronic
985939079 5:3120014-3120036 AAGAAGACCACCTGGGGAGGGGG + Intergenic
987084797 5:14458408-14458430 AAGCTGGCCTTTGAGGGAGGTGG - Intronic
988818157 5:34854587-34854609 AAGCTGGCCTCCTGTGTAGGCGG + Intronic
991124383 5:63053059-63053081 TAGCTTACCTTCTGGGGAGCTGG - Intergenic
991443668 5:66677931-66677953 AAACTGATCTTAAGGGGAGGGGG - Intronic
993209037 5:84923327-84923349 AAGCTCACTTCCTGGGGGGGTGG + Intergenic
993348831 5:86820992-86821014 AAGATGACCTTCCTGGGGGGGGG - Intergenic
995165293 5:109032593-109032615 TAACTGCCCTTCTGGGGAGTTGG - Intronic
995251712 5:110000900-110000922 AAGCTGGCCTCCTGGGGAGGAGG + Intergenic
995834154 5:116383781-116383803 AAGGTGATACTCTGGGGAGGGGG - Intronic
996899938 5:128533225-128533247 ATATTGGCCTTCTGGGGAGGAGG - Intronic
997362858 5:133306169-133306191 AAGCTGACCTCCAGGTGAGGTGG + Intronic
998638704 5:143985688-143985710 GAGCTGCCCCTCTGGGGAGATGG - Intergenic
1001192391 5:169643217-169643239 AAGCTGACCTGGTGGGGTGCAGG - Intronic
1001558941 5:172656725-172656747 AAACTTAACTTCTGGGGAAGCGG - Intronic
1003264307 6:4552055-4552077 AAGCTGACCTTTTGGGGACTGGG - Intergenic
1005847975 6:29797181-29797203 AAGCTGCACTTCTGGAAAGGAGG - Intergenic
1005988875 6:30891219-30891241 AAGCTGTCACTCTGAGGAGGGGG + Intronic
1009317865 6:62244977-62244999 AAGGTGACTTTCTGCTGAGGAGG + Intronic
1010211449 6:73365510-73365532 AACCTGACATTCTGGTAAGGTGG - Intergenic
1011326773 6:86157041-86157063 AAGCTTACATTCTAGGGGGGCGG - Intergenic
1011976391 6:93305049-93305071 AAGCTTACATTCTAGTGAGGTGG - Intronic
1012914763 6:105157467-105157489 AAGCTTACATTCTGGGGATGCGG - Intergenic
1017024857 6:150172805-150172827 CATCTGGCCTCCTGGGGAGGAGG - Intronic
1017924176 6:158896512-158896534 ATCCTGAGCTTCTGGGGAGGAGG + Intronic
1018715640 6:166530498-166530520 AAACTGACCCCCTGGGGAGGAGG - Intronic
1018933906 6:168260848-168260870 AGGCTGACCTTGTAGGGCGGTGG + Intergenic
1019369832 7:656026-656048 AAAATGACTTTCTGGGGAGGTGG - Intronic
1020120905 7:5502710-5502732 AAGCCAAGCTACTGGGGAGGAGG + Intronic
1023866490 7:44240828-44240850 AGGCTGAGCATCTGGGCAGGAGG - Intronic
1023868526 7:44250464-44250486 ATGCTGACTGTCTGCGGAGGGGG - Intronic
1027164950 7:75827745-75827767 AGGGTGACCTGCTGGGGAGGTGG + Intergenic
1027979653 7:85201253-85201275 AAGCACAGCTTCTAGGGAGGAGG - Intergenic
1028953666 7:96665139-96665161 AAGCTGCCTTTCTGGGGTAGAGG - Intronic
1029438576 7:100575416-100575438 ATGCTGACGTGCTGGGCAGGGGG + Intronic
1029787454 7:102806873-102806895 GAGCTGAGCTTCTGGGGAGACGG + Intronic
1030404508 7:109094104-109094126 GAGCTTACATTCTAGGGAGGAGG + Intergenic
1032266628 7:130374261-130374283 AAAATGTCCTTCTGTGGAGGGGG + Intergenic
1032396934 7:131597213-131597235 AAGCTCACACTCTGGGGATGTGG - Intergenic
1032868295 7:135952183-135952205 AAGCTTACCGTCTGGGGTTGGGG + Intronic
1033537786 7:142328196-142328218 AATTTGACCATCTGGGGAAGGGG + Intergenic
1033540138 7:142349074-142349096 AATTTGACCATCTGGGGAAGGGG + Intergenic
1034993407 7:155562297-155562319 GAGCTGGACTTCAGGGGAGGAGG + Intergenic
1035260776 7:157660216-157660238 AATGTGACCCTCTGGGGAAGAGG + Intronic
1036661390 8:10711265-10711287 AACCTGTCTTCCTGGGGAGGAGG - Intronic
1036941386 8:13056044-13056066 GAGCTGACGTCCTGGAGAGGAGG - Intergenic
1037804070 8:22049580-22049602 GAGCTGACCTGGTGGGGTGGCGG - Intronic
1038039587 8:23713136-23713158 CAGCTCATGTTCTGGGGAGGAGG - Intergenic
1038643726 8:29347552-29347574 AAGCTGAACTTCTGGCTAGGAGG + Intronic
1039549095 8:38430302-38430324 GAACTGAGCATCTGGGGAGGGGG - Intronic
1039945852 8:42128492-42128514 AAGATCACCTTCTGGGGAGATGG - Intergenic
1040696641 8:50007373-50007395 TAGTTGAGCTTGTGGGGAGGAGG + Intronic
1043476699 8:80612029-80612051 AATCTGGCCTTCTAGGGTGGAGG + Intergenic
1044884535 8:96762624-96762646 AAGCAGAGCTTCTTGGGAAGTGG - Intronic
1046638787 8:116702695-116702717 AAGCTGATTCACTGGGGAGGGGG + Intronic
1047208048 8:122819231-122819253 AAGGTGACCTCGTGGGTAGGTGG - Intronic
1047725253 8:127678822-127678844 AATCAGAACTTCTGGGGATGGGG + Intergenic
1048867386 8:138770829-138770851 AAGCTGACCTTCAGAGGTGCGGG + Intronic
1048955916 8:139535912-139535934 AAGATGACCTTTGAGGGAGGGGG - Intergenic
1049038537 8:140095521-140095543 ACGCTGGGCTTCTGGGGAGCGGG - Intronic
1049271765 8:141699888-141699910 AAGCTGCCTTGCTGGGGTGGGGG + Intergenic
1049814744 8:144592929-144592951 ATGCTGACCCTCTGTGGTGGAGG - Intronic
1050764924 9:9120623-9120645 AAGCAGATCATCTGGAGAGGAGG + Intronic
1051734645 9:20186082-20186104 TAGCTCACTTTCTGAGGAGGGGG + Intergenic
1052195022 9:25701643-25701665 AAGCTGGACTTCTTGGGAGCTGG + Intergenic
1055219178 9:73907712-73907734 GAGCTTACCTTCTAGTGAGGAGG + Intergenic
1055304078 9:74910561-74910583 AACCTGAGCTGCTGGGGAAGGGG + Intergenic
1057200903 9:93139579-93139601 ATGCTGGCCTTTTGGGGAGAAGG - Intergenic
1057263228 9:93597898-93597920 AAGATGCTCTCCTGGGGAGGAGG - Intronic
1058483093 9:105416735-105416757 AATCTAACCTTCTTGGCAGGTGG - Intronic
1060417293 9:123440447-123440469 CAGCTGCTCTTCTGGGGTGGGGG + Exonic
1060745403 9:126127701-126127723 AAGCTCCCCTGGTGGGGAGGAGG + Intergenic
1060937562 9:127524497-127524519 AGGCTGAGATTCAGGGGAGGGGG + Intronic
1061620715 9:131809735-131809757 ATGCTGAAATCCTGGGGAGGTGG + Intergenic
1061621454 9:131813827-131813849 CAGCTGTGCTGCTGGGGAGGAGG - Intergenic
1061721767 9:132556417-132556439 AAGCTGAGCCGCCGGGGAGGGGG - Intronic
1062469409 9:136695971-136695993 AGGCTCACCTTCTGTCGAGGAGG + Intergenic
1186166771 X:6834912-6834934 AATGTGACCTTGTTGGGAGGTGG - Intergenic
1187193701 X:17060630-17060652 AAGCTTAGGTTCTGGGAAGGGGG + Intronic
1187232021 X:17432592-17432614 GGGCTGACCTTCTGGAGAAGGGG - Intronic
1189059220 X:37735201-37735223 AATCTATCCTTCTTGGGAGGAGG - Intronic
1189260956 X:39678548-39678570 AGGCTGCCTTTCTGGGCAGGAGG - Intergenic
1191648155 X:63506366-63506388 AAGATGTTCTTCTGGGGGGGAGG - Intergenic
1192150642 X:68710266-68710288 AAGCCAGCCTTCTGGGGAAGGGG + Intronic
1193216981 X:78875357-78875379 ACTCTGATCTTCTTGGGAGGAGG + Intergenic
1194145710 X:90259771-90259793 AAGGTGTCATTCTGGGGAAGCGG - Intergenic
1194571565 X:95559742-95559764 AGGCAGGCCTTCTGGGGCGGGGG + Intergenic
1195646660 X:107238382-107238404 ATGTTGTCCTTTTGGGGAGGTGG + Intronic
1195934317 X:110110661-110110683 AATCAGACCCTCTGGGGATGGGG - Intronic
1196608474 X:117683838-117683860 AACCTCACATTTTGGGGAGGAGG + Intergenic
1197457456 X:126695440-126695462 ATGCTGAAATACTGGGGAGGAGG + Intergenic
1197462418 X:126758616-126758638 AATCTGAGCTACTAGGGAGGCGG + Intergenic
1197667054 X:129235425-129235447 AATATGACCTTCTGGGATGGCGG - Intergenic
1199297880 X:146179871-146179893 GATCTGACCTTCTGGGCATGGGG + Intergenic
1200213499 X:154357196-154357218 AAGCTGCCCCTCTGGGCAGGAGG + Intronic
1200491462 Y:3829066-3829088 AAGTTGTCATTCTGGGGAAGCGG - Intergenic
1201508204 Y:14728003-14728025 GAGCTGACCTTCTGGTGTGTGGG - Intronic
1201789531 Y:17824338-17824360 AATCCGAGCTTCTCGGGAGGTGG - Intergenic
1201812022 Y:18081650-18081672 AATCCGAGCTTCTCGGGAGGTGG + Intergenic
1202351183 Y:23994097-23994119 AATCCGAGCTTCTCGGGAGGTGG - Intergenic
1202519596 Y:25676022-25676044 AATCCGAGCTTCTCGGGAGGTGG + Intergenic