ID: 1144791117

View in Genome Browser
Species Human (GRCh38)
Location 17:17859985-17860007
Sequence GGGAAGTCACTCACATCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 235}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144791113_1144791117 1 Left 1144791113 17:17859961-17859983 CCACACACACAAAGGGTGAAGGG 0: 1
1: 0
2: 0
3: 20
4: 193
Right 1144791117 17:17859985-17860007 GGGAAGTCACTCACATCTCCTGG 0: 1
1: 0
2: 3
3: 14
4: 235
1144791108_1144791117 28 Left 1144791108 17:17859934-17859956 CCTTTGAAAACAGGGAGCTAGTC 0: 1
1: 0
2: 0
3: 9
4: 124
Right 1144791117 17:17859985-17860007 GGGAAGTCACTCACATCTCCTGG 0: 1
1: 0
2: 3
3: 14
4: 235
1144791111_1144791117 6 Left 1144791111 17:17859956-17859978 CCAAGCCACACACACAAAGGGTG 0: 1
1: 0
2: 1
3: 36
4: 246
Right 1144791117 17:17859985-17860007 GGGAAGTCACTCACATCTCCTGG 0: 1
1: 0
2: 3
3: 14
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144791117 Original CRISPR GGGAAGTCACTCACATCTCC TGG Intronic
901019575 1:6249079-6249101 GGGATGTCACTCAGCTCCCCAGG + Exonic
903650249 1:24917558-24917580 GGCAAGTCACTGACCTCTCTGGG - Intronic
905199556 1:36306802-36306824 GGGAAGGCGCTCTCAGCTCCCGG - Intronic
905207103 1:36349236-36349258 GTGGAGTCACTCACCTCTGCTGG - Intronic
907217079 1:52873480-52873502 AGCAATTCAGTCACATCTCCAGG - Intronic
907300440 1:53483463-53483485 GGGAAGTCACTCACCTCCCCAGG - Intergenic
907571201 1:55485785-55485807 AGGAATTCAGTCACATCTTCAGG + Intergenic
907855433 1:58299063-58299085 GGGCAGTCATTCACAGATCCTGG + Intronic
908440298 1:64146800-64146822 GGGAGATCACTTACATCTACAGG + Intronic
908546787 1:65170012-65170034 GGAAAGTCCCTCCCACCTCCAGG + Intronic
908883519 1:68760075-68760097 GGAAAGACAATCACAACTCCTGG + Intergenic
908918282 1:69158197-69158219 GGGAAGTCACTCACAGTTCCTGG + Intergenic
909365713 1:74819341-74819363 AGTAATTCAGTCACATCTCCAGG + Intergenic
911124992 1:94333143-94333165 GGTGAGTCACGCACATCTCATGG - Intergenic
911198956 1:95024767-95024789 AGGAATTCAGTCACATCTTCAGG + Intronic
913576025 1:120176205-120176227 GGGAAGTCACAAAGGTCTCCCGG + Intronic
913683381 1:121208007-121208029 GGTAAGTCTCTAACCTCTCCTGG + Intronic
914035223 1:143995631-143995653 GGTAAGTCTCTAACCTCTCCTGG + Intergenic
914154229 1:145072339-145072361 GGTAAGTCTCTAACCTCTCCTGG - Intronic
914263461 1:146019000-146019022 GGGAAGTGATTTACAGCTCCAGG + Intronic
919093652 1:193003454-193003476 AGTAAGTCACTCACATCTTCAGG + Intergenic
919893399 1:201992583-201992605 GGCAAGCCACTCATTTCTCCTGG + Intronic
920094341 1:203476305-203476327 TGGAAGTCACACACATCACACGG + Intronic
920470690 1:206226517-206226539 GGTAAGTCTCTAACCTCTCCTGG + Intronic
922881554 1:228985002-228985024 GAGAAGTCCATCACATCTCTTGG - Intergenic
922979496 1:229813670-229813692 AAGAAGTCAGTCACATCTTCAGG - Intergenic
924517490 1:244778992-244779014 GGGAAGTCACTTACCTCTCTTGG - Intergenic
924586844 1:245367647-245367669 GGGAAGTCGCTGGCATCACCTGG - Intronic
1066978574 10:42390988-42391010 GGAAACTCCCTCACCTCTCCAGG - Intergenic
1067120470 10:43468107-43468129 AGCAATTCACTCACATCTGCAGG - Intronic
1067761712 10:49053463-49053485 GGCAAGTCACTTACTTCCCCGGG + Intronic
1068070060 10:52183942-52183964 GGGAAGTCCCTCCTGTCTCCAGG + Intronic
1068220365 10:54037047-54037069 AGCAATTCACTCACATCTTCAGG - Intronic
1068405901 10:56588374-56588396 TGGATGTCAATGACATCTCCAGG - Intergenic
1069816088 10:71195375-71195397 GGCAAGTCACTCCCCTCTCTGGG + Intergenic
1072325595 10:94295427-94295449 AGGAATTCAGTCACATCTGCAGG + Intronic
1073627519 10:105114616-105114638 AGGAAGCCACTCTCTTCTCCTGG - Intronic
1073772885 10:106754630-106754652 GGGAAGTCATTCACATTGACTGG + Intronic
1074382998 10:112995406-112995428 AGGTGGTCACTCCCATCTCCAGG - Intronic
1075560238 10:123462850-123462872 GGCCAGGCCCTCACATCTCCCGG - Intergenic
1075643288 10:124080712-124080734 GGCAAGTCACTGACTTCTGCAGG + Intronic
1076935450 10:133565648-133565670 GAGAATTACCTCACATCTCCAGG - Intronic
1079006340 11:16793883-16793905 GTGAATCCAATCACATCTCCTGG - Intronic
1079186612 11:18244061-18244083 GGGATGCCACTCAGATCTCTGGG - Intronic
1080640511 11:34155740-34155762 GGGAAGAGGCTGACATCTCCAGG - Intronic
1080762795 11:35268788-35268810 GGGAAGCCACTAATCTCTCCAGG - Intronic
1081270035 11:41071978-41072000 AGCAATTCAGTCACATCTCCGGG - Intronic
1081532562 11:43972578-43972600 GTGAAGACACTCATACCTCCCGG + Intergenic
1081692207 11:45086258-45086280 GGCAAGCCACTCCCCTCTCCAGG + Intergenic
1081850792 11:46273926-46273948 CGGAAGTCAGTCTAATCTCCAGG + Intergenic
1081897972 11:46603479-46603501 GGAAAGTCTGTCACAACTCCTGG + Exonic
1083039856 11:59675504-59675526 AGGAATTCAGTCACATCTTCAGG + Intergenic
1083329403 11:61890676-61890698 GGACAGTGACTCACCTCTCCGGG - Intronic
1085295257 11:75427910-75427932 GTGAAGTCTCTCTCCTCTCCAGG + Intronic
1086450372 11:86909508-86909530 GGCAAGTCACTTCCCTCTCCGGG - Intronic
1087044882 11:93836615-93836637 GGGAAGTCTATCCCAACTCCAGG + Intronic
1087315397 11:96596524-96596546 GGAAAGTCTCTCATATTTCCTGG - Intergenic
1089097527 11:115931522-115931544 GGGAAGTCATTTAGATTTCCAGG + Intergenic
1090218105 11:124988834-124988856 AGCAATTCACTCACATCTTCAGG + Intronic
1090902581 11:131045973-131045995 GGCAAGCCCCTGACATCTCCCGG + Intergenic
1093126176 12:15331023-15331045 GGGATCCCATTCACATCTCCAGG - Intronic
1093398612 12:18714902-18714924 GGGACGACACTCCCTTCTCCAGG - Intronic
1094321520 12:29189124-29189146 GGGAACTCAGCCGCATCTCCCGG + Intronic
1094330505 12:29286980-29287002 GGGAAGTTACTTACCTCTCTGGG - Intronic
1095040338 12:37433964-37433986 AGCAATTCACTCACATCTTCAGG - Intergenic
1096186424 12:49584663-49584685 GGGATGGCACTCACATGGCCTGG - Intronic
1100922007 12:99498860-99498882 GGGAAGTTACTGACCTCTCTTGG - Intronic
1101751928 12:107589031-107589053 GGCAAGTTACTCACCTCTCTGGG + Intronic
1103478050 12:121232869-121232891 GGAAAGGCACTCCCATCTCTTGG - Intronic
1108573103 13:51769334-51769356 GGGAAGTCAACCACATTTGCTGG - Intronic
1109199072 13:59410893-59410915 GGGAAGTCCCTCAGGTGTCCAGG + Intergenic
1109953378 13:69532343-69532365 AGGAATTCAGTCACATCTTCAGG - Intergenic
1110411538 13:75209068-75209090 TGAGATTCACTCACATCTCCAGG + Intergenic
1110640205 13:77814949-77814971 AGGAATTCAGTCACATCTTCAGG - Intergenic
1111425750 13:88079159-88079181 TGGAAGTCACCTACATCTCCAGG - Intergenic
1113659054 13:112091855-112091877 GGGACTTCACACACATATCCAGG - Intergenic
1115503535 14:34071495-34071517 GGCAAGTCACTTACCTCTCTGGG + Intronic
1116150539 14:41135940-41135962 AGGAATTCACTCACGTCTTCAGG + Intergenic
1117816133 14:59599666-59599688 GGGAAGTCCATCTCATCTCAGGG + Intronic
1119485958 14:74986744-74986766 TGAAAGTCACACACATCTCCTGG - Intergenic
1119968669 14:78945063-78945085 GGGAAGTAACACACTTCACCGGG - Intronic
1121018529 14:90563882-90563904 AGTAATTCAGTCACATCTCCGGG + Intronic
1121552830 14:94815192-94815214 GGGAAGTCACTTTCCTATCCAGG - Intergenic
1123482660 15:20647255-20647277 AGGAAGGCTCTCACATCTTCTGG + Intergenic
1125021647 15:34992364-34992386 GGCAAGGAGCTCACATCTCCTGG + Intergenic
1125822542 15:42644976-42644998 GGCAATTCAGTCACATCTTCAGG + Intronic
1125981562 15:44006736-44006758 GGCAATTCAGTCACATCTTCAGG - Intronic
1127447023 15:59073560-59073582 GGCAATTCAATCACATCTTCAGG + Intronic
1132714137 16:1282436-1282458 GGGAAGGCACTCACAGGTCGTGG - Intergenic
1132888163 16:2191501-2191523 GGGAATGCTCTCACACCTCCGGG - Intronic
1135044091 16:19140455-19140477 GGGAAGTCACTAACCTCTCTGGG - Intronic
1137581315 16:49635215-49635237 GGCAAGTCACTGACTTCTCTGGG - Intronic
1139037401 16:62963850-62963872 GGGAAGTCAAATACATTTCCTGG + Intergenic
1140025797 16:71289336-71289358 GGGAAGCCAGTCCCACCTCCGGG + Exonic
1140208962 16:72955939-72955961 GAGTACTCACTCCCATCTCCTGG + Intronic
1140913182 16:79471882-79471904 GTGATGTCACTCATATCACCTGG - Intergenic
1143264296 17:5624220-5624242 AGGAAGCCACTACCATCTCCAGG - Intergenic
1144488572 17:15687692-15687714 GGGAAGTCCCTCCTGTCTCCAGG + Intergenic
1144791117 17:17859985-17860007 GGGAAGTCACTCACATCTCCTGG + Intronic
1144912439 17:18694613-18694635 GGGAAGTCCCTCCTGTCTCCAGG - Intergenic
1146259706 17:31413434-31413456 GGGAAGACACTCTCTTCTCGGGG - Intronic
1147867181 17:43560728-43560750 TCCAAGTCACTCACTTCTCCAGG + Intronic
1148481207 17:47960519-47960541 GGGAAGTCAGGCACAACCCCTGG + Intergenic
1148744350 17:49910197-49910219 GGGAAGGCACTCAGCTTTCCTGG + Intergenic
1150252715 17:63716962-63716984 GGCAAGTCACTCTGATCTCTTGG + Intronic
1150282011 17:63934322-63934344 GGGAAGACACACACATCCCGTGG + Intergenic
1150468017 17:65411423-65411445 AGCAATTCAGTCACATCTCCAGG + Intergenic
1151986270 17:77545958-77545980 TGGAGGTCACTCACATTCCCTGG - Intergenic
1153660866 18:7325078-7325100 GGCAAGTCAGTTACATCTCTGGG + Intergenic
1155089519 18:22493045-22493067 GGTAAGTCACTCCCCTTTCCAGG - Intergenic
1155512004 18:26587803-26587825 AGGAATTCAGTCACATCTTCAGG - Intronic
1157175404 18:45447122-45447144 GGGTAGTCAGTCACCTCCCCTGG + Intronic
1157488696 18:48107513-48107535 TGGAGGTCACCGACATCTCCAGG + Intronic
1158338145 18:56435563-56435585 GGCAAGTTAAACACATCTCCTGG + Intergenic
1158639800 18:59194093-59194115 GTGAAGTCACTCACGTGCCCTGG - Intergenic
1159748151 18:72264865-72264887 AGGAAGTCACTGACTTGTCCTGG - Intergenic
1163104954 19:15117997-15118019 CGGAAGTCACACACAGTTCCTGG + Exonic
1163722966 19:18906946-18906968 GGGAGGCCACTCACCACTCCAGG + Exonic
1165599256 19:37039021-37039043 AGCAATTCACTCACATCTTCAGG + Intronic
925390862 2:3493016-3493038 GGGAAGTTACTCATAGCTCCTGG + Intergenic
925585292 2:5459003-5459025 GGGAAGAAATTCACACCTCCAGG - Intergenic
926452229 2:13019142-13019164 GTGAAGTCATTCACAACACCTGG - Intergenic
927276037 2:21263192-21263214 GTGAAGTCTCTCCCAACTCCAGG + Intergenic
931895368 2:66723031-66723053 AGGAATTCAATCACATCTTCAGG - Intergenic
932186005 2:69696359-69696381 AGCAATTCAGTCACATCTCCAGG + Intronic
932310081 2:70732745-70732767 GGAAAGACACTGACTTCTCCAGG - Intronic
935157122 2:100493366-100493388 GGTAAGTCACTCAGATCTCATGG - Intergenic
935682061 2:105646851-105646873 GGAAAGTCTCTCAAACCTCCAGG + Intergenic
937077880 2:119120235-119120257 GGGAAGTGACTGAAAACTCCTGG + Intergenic
937792867 2:125981058-125981080 GGGAAGTCACTTAACTCTCAGGG - Intergenic
937982265 2:127622659-127622681 CGGAAGTGACCCACAGCTCCTGG - Intronic
938500821 2:131830632-131830654 GCGCAGTCACTGACGTCTCCTGG - Intergenic
938562434 2:132485689-132485711 GGCAATTCAATCACATCTTCAGG + Intronic
939356483 2:141109609-141109631 GGCAAGTAACTCTCATCTCAGGG - Intronic
940430371 2:153583514-153583536 GGGAATTCACTCCCAGTTCCTGG - Intergenic
941057345 2:160803786-160803808 AGCAATTCAGTCACATCTCCAGG - Intergenic
941801708 2:169666947-169666969 AGCAATTCACTCACATCTTCAGG + Intronic
942110406 2:172676538-172676560 AGCAATTCAGTCACATCTCCAGG - Intergenic
945029174 2:205647850-205647872 GGCAATTTACTCACCTCTCCAGG + Intergenic
945088089 2:206154394-206154416 GGGAAGTTACTGACATCTAGTGG + Intronic
945652006 2:212574283-212574305 AGCAATTCAGTCACATCTCCAGG + Intergenic
1169159622 20:3365923-3365945 AGCAAGTCAGTCACATCTTCAGG + Intronic
1173010101 20:39174715-39174737 GGGAAGCCACTACCATCTCCAGG + Intergenic
1175588676 20:60169395-60169417 GGGAGGTCACACACATTTCATGG - Intergenic
1176876125 21:14130885-14130907 GGGAAGGCTCTCAGATCTCTGGG - Intronic
1177407158 21:20684223-20684245 GAGAAGTCACTCATAACTACAGG - Intergenic
1178640323 21:34340110-34340132 GGGAAGTCACTCCCCTCTAAGGG + Intergenic
1179019408 21:37624863-37624885 GGTAAGTAACTGAAATCTCCAGG + Exonic
1183234140 22:36604221-36604243 AGCAATTCACTCACATCTTCAGG - Intronic
1183513699 22:38250934-38250956 GGTAAGTCACTCACATCTCTGGG - Intronic
1184339382 22:43877798-43877820 GGGAAATTCCTCACCTCTCCAGG - Intergenic
1184672307 22:46021040-46021062 GAGAAGTCAGTCTCACCTCCTGG - Intergenic
949348233 3:3097375-3097397 GGGAAGGGACTCAAATCACCTGG + Intronic
949854222 3:8445443-8445465 GGCAGGTAAGTCACATCTCCTGG + Intergenic
950314902 3:11992878-11992900 AGCAATTCACTCACATCTTCAGG + Intergenic
951448555 3:22810987-22811009 TGGAAGACAATCAAATCTCCAGG - Intergenic
952947361 3:38487318-38487340 GGGAAGGGTCTCTCATCTCCAGG + Exonic
955381963 3:58446456-58446478 AGGAATTCAGTCACATCTTCAGG + Intergenic
957882728 3:86241524-86241546 GAGAACTCACTCACATTTCTAGG + Intergenic
959109005 3:102099044-102099066 GGGAAGTCACACATCTCTCCTGG + Intergenic
959577571 3:107950753-107950775 GTGAGGTCTCTCACATCCCCAGG + Intergenic
960921428 3:122750689-122750711 TGGAAGTCAATCATTTCTCCAGG - Intronic
962752655 3:138445170-138445192 GGGGAGTCACCCACACCACCTGG - Intronic
966214225 3:177485024-177485046 AGCAATTCACTCACATCTTCAGG + Intergenic
966275066 3:178155693-178155715 GGGAAGCCACTGCCATCTCTAGG + Intergenic
972359528 4:38314397-38314419 GGGGAGTAACTTACAGCTCCAGG - Intergenic
976907235 4:90254313-90254335 AGGAAGTCGCTCACTTCTCTAGG + Intronic
977126904 4:93180797-93180819 AGGAATCCAGTCACATCTCCAGG + Intronic
977222476 4:94354385-94354407 AGGAAGCAACTCACCTCTCCTGG + Intergenic
977581845 4:98733899-98733921 GGAGAGTCACCCACATCTCCTGG + Intergenic
979124166 4:116946529-116946551 GGGAACTCACTTACATCTGAGGG - Intergenic
979966057 4:127077579-127077601 GGGAACTCCCTCCCCTCTCCAGG - Intergenic
980529568 4:134034706-134034728 AGGAATTCAGTCACATCTTCAGG - Intergenic
980693665 4:136328763-136328785 GTGGAGTCACTCAAATGTCCAGG - Intergenic
981029772 4:140112724-140112746 GGGAAGTAACCCACACCTCCTGG - Intronic
983014619 4:162597546-162597568 AGTAATTCAGTCACATCTCCAGG + Intergenic
984444488 4:179818014-179818036 GGGAAGTCATGCACAACACCTGG + Intergenic
984539616 4:181021506-181021528 GGGAAGTAACTTTCATTTCCAGG - Intergenic
984898811 4:184566019-184566041 AGCAATTCACTCACATCTTCAGG + Intergenic
985430363 4:189873635-189873657 AGGAATTCAGTCACATCTTCAGG - Intergenic
985837560 5:2281764-2281786 AGGAAGTCACTCATATATCTGGG - Intergenic
986155409 5:5169854-5169876 AGGAGGTGACACACATCTCCAGG - Intronic
986921178 5:12683733-12683755 GGGAACTGACTCACATCATCAGG - Intergenic
987716044 5:21572538-21572560 AGGAATTCAGTCACATCTTCAGG - Intergenic
988595232 5:32585035-32585057 GTGAACTCCCTTACATCTCCAGG + Intronic
989374919 5:40750883-40750905 AGGAATTCAGTCACATCTTCAGG + Intronic
990522965 5:56597447-56597469 AGCAATTCAGTCACATCTCCAGG + Intronic
990629921 5:57657250-57657272 GGGAATTCAGTCACATCTTCAGG - Intergenic
991295119 5:65072373-65072395 CTGAAGTCCCTCACATCTTCTGG + Intergenic
992918135 5:81481024-81481046 GGCAATTCAGTCACATCTTCAGG + Intronic
994466891 5:100147330-100147352 AGGAATTCAGTCACATCTTCAGG + Intergenic
997689181 5:135814119-135814141 GAGAAGTCACTCTCAACACCTGG - Intergenic
998176236 5:139903905-139903927 GGGAAGGCAGTGACAGCTCCCGG + Intronic
998719285 5:144925728-144925750 AGCAATTCAGTCACATCTCCAGG - Intergenic
1000173437 5:158726867-158726889 AGCAAGTCACTCAGATCTCTGGG + Intronic
1000878177 5:166666481-166666503 TGGGAGTCACTCAGATCCCCGGG - Intergenic
1001576304 5:172766314-172766336 AACAAGTCACTCACTTCTCCCGG - Intergenic
1002881846 6:1259743-1259765 GGCAATTCAGTCACATCTTCAGG - Intergenic
1003564606 6:7212603-7212625 TGGAAGTCACACACAGCTGCAGG + Intronic
1004634471 6:17453793-17453815 GGAAATTCACTAACCTCTCCAGG + Intronic
1005365527 6:25072632-25072654 AGCAAGTCAGTCACATCTTCAGG + Intergenic
1008044043 6:46833517-46833539 TCGAAGTCGCACACATCTCCAGG + Exonic
1008288904 6:49688089-49688111 AGGAAGTCAGTCCCATCTCTGGG + Intergenic
1009000676 6:57709522-57709544 AGGAATTCAGTCACATCTTCAGG + Intergenic
1011672511 6:89696477-89696499 GGGAGGCCACTCACATCCCAGGG + Exonic
1011856408 6:91698269-91698291 GGCAATTCAGTCACATCTTCAGG + Intergenic
1015487941 6:133792682-133792704 GGGAAGTCACTCCTGACTCCAGG + Intergenic
1016712353 6:147188525-147188547 CTGAAGTCACTCACCTCTCCAGG - Intergenic
1017038517 6:150288667-150288689 GGGAAGTCACTTAGACATCCTGG - Intergenic
1020764995 7:12308121-12308143 TGCAAGTCAGTCACATCTTCGGG + Intergenic
1022485996 7:30778051-30778073 GGCAAGTCAACCCCATCTCCTGG + Intronic
1024346231 7:48317075-48317097 GGAAATTCATTCACATATCCAGG - Intronic
1025286395 7:57665601-57665623 AGCAATTCACTCACATCTTCAGG - Intergenic
1025299729 7:57809012-57809034 AGCAATTCACTCACATCTTCAGG + Intergenic
1025611772 7:63080923-63080945 GGCAGGTCACTGACACCTCCTGG + Intergenic
1026069471 7:67105190-67105212 GAGAAGGCACTCAGATCTACAGG + Intronic
1026707436 7:72707123-72707145 GAGAAGGCACTCAGATCTACAGG - Intronic
1026953706 7:74363960-74363982 GTGTTGTCACTCACATCCCCGGG + Intronic
1027527490 7:79288656-79288678 AGGACGTCATTCAGATCTCCTGG + Intronic
1029530372 7:101121511-101121533 GGGAAGTCAGTCACAGAGCCAGG + Intergenic
1033828645 7:145224854-145224876 GGGAAATGATTCACATCTGCTGG - Intergenic
1037618424 8:20542408-20542430 GGGAAGTGACTCACCTCTTGGGG + Intergenic
1037893794 8:22638329-22638351 GGGAAGTCACTCCTGTCTCTGGG - Intronic
1040379681 8:46860442-46860464 GGCAAATAACTCACATCACCTGG - Intergenic
1041218518 8:55625555-55625577 GAGAGGGCACTGACATCTCCAGG - Intergenic
1041973465 8:63769582-63769604 GGGAAGTTACTTTGATCTCCTGG - Intergenic
1046224842 8:111264292-111264314 GGCAAGGAACTCACATTTCCAGG - Intergenic
1046864604 8:119132259-119132281 AGGCAGTCACTCACTTTTCCTGG - Intergenic
1048902587 8:139053317-139053339 AGGAATTCAGTCACATCTTCAGG - Intergenic
1051368394 9:16337588-16337610 AGGAAGTTACTCATATCCCCAGG - Intergenic
1053793863 9:41706988-41707010 AGCAATTCACTCACATCTTCAGG - Intergenic
1054151308 9:61607825-61607847 AGCAATTCACTCACATCTTCAGG + Intergenic
1054182273 9:61919001-61919023 AGCAATTCACTCACATCTTCAGG - Intergenic
1054471087 9:65538981-65539003 AGCAATTCACTCACATCTTCAGG + Intergenic
1058449359 9:105081604-105081626 GTTAAGTAATTCACATCTCCAGG + Intergenic
1058906887 9:109489199-109489221 GGAACGTCACTCACATACCCTGG - Intronic
1060300135 9:122370251-122370273 GGGAATGCACACAAATCTCCTGG - Intergenic
1061219011 9:129238074-129238096 GGGGTGGCACTCACAGCTCCAGG - Intergenic
1061516411 9:131092939-131092961 GGGAAGTCAGGCACCTCTGCGGG + Exonic
1062498851 9:136843881-136843903 GCGCAGTCACTGACGTCTCCTGG + Intronic
1186994891 X:15109845-15109867 AGGAATTCAGTCACATCTTCAGG - Intergenic
1187306800 X:18102463-18102485 TAGAAGACACTCACATCTCTTGG - Intergenic
1189708488 X:43784055-43784077 AGCAATTCACTCACATCTTCAGG + Intronic
1189923199 X:45924102-45924124 AGGAATTCAGTCACATCTTCAGG - Intergenic
1190223188 X:48526173-48526195 GAGATATCACTCACATCTACTGG - Intronic
1192823620 X:74670598-74670620 TGGAAGTCACCCACGTCTCTAGG + Intergenic
1193105338 X:77664635-77664657 GGGAGCTCACCCTCATCTCCTGG + Exonic
1195164522 X:102205914-102205936 GGGAGGCCACTCACATGTGCAGG - Intergenic
1195194337 X:102481180-102481202 GGGAGGCCACTCACATGTGCAGG + Intergenic
1198843070 X:140880060-140880082 AGGAAGTCACTCTCAACTCTAGG - Intergenic
1200121629 X:153793928-153793950 AGGCAGTCACTCACGTATCCCGG - Exonic
1200934828 Y:8729239-8729261 GAGGAGTCACGCACAGCTCCAGG - Intergenic
1202096787 Y:21259558-21259580 GGGAATTCACTCCCAGCTCCTGG - Intergenic