ID: 1144791554

View in Genome Browser
Species Human (GRCh38)
Location 17:17862398-17862420
Sequence CTGTGGATGAGGGGCCAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 508
Summary {0: 1, 1: 0, 2: 5, 3: 53, 4: 449}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144791544_1144791554 -1 Left 1144791544 17:17862376-17862398 CCCTCCTGCTTCCAAGCTTCTCC 0: 1
1: 1
2: 4
3: 61
4: 531
Right 1144791554 17:17862398-17862420 CTGTGGATGAGGGGCCAGGCAGG 0: 1
1: 0
2: 5
3: 53
4: 449
1144791545_1144791554 -2 Left 1144791545 17:17862377-17862399 CCTCCTGCTTCCAAGCTTCTCCT 0: 1
1: 0
2: 5
3: 51
4: 502
Right 1144791554 17:17862398-17862420 CTGTGGATGAGGGGCCAGGCAGG 0: 1
1: 0
2: 5
3: 53
4: 449
1144791546_1144791554 -5 Left 1144791546 17:17862380-17862402 CCTGCTTCCAAGCTTCTCCTGTG 0: 1
1: 0
2: 4
3: 31
4: 364
Right 1144791554 17:17862398-17862420 CTGTGGATGAGGGGCCAGGCAGG 0: 1
1: 0
2: 5
3: 53
4: 449
1144791543_1144791554 13 Left 1144791543 17:17862362-17862384 CCTGCATGGCTGCACCCTCCTGC 0: 1
1: 0
2: 3
3: 47
4: 422
Right 1144791554 17:17862398-17862420 CTGTGGATGAGGGGCCAGGCAGG 0: 1
1: 0
2: 5
3: 53
4: 449
1144791542_1144791554 14 Left 1144791542 17:17862361-17862383 CCCTGCATGGCTGCACCCTCCTG 0: 1
1: 1
2: 5
3: 56
4: 949
Right 1144791554 17:17862398-17862420 CTGTGGATGAGGGGCCAGGCAGG 0: 1
1: 0
2: 5
3: 53
4: 449

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144791554 Original CRISPR CTGTGGATGAGGGGCCAGGC AGG Intronic
900508973 1:3049245-3049267 CAGTGGCCGAGGGGCCTGGCTGG + Intergenic
900597400 1:3488357-3488379 GTGTGGACGGGGGGCCTGGCAGG - Intergenic
900634807 1:3657788-3657810 CTGTGGAGGAGGCGCCAGGCGGG - Intronic
900782898 1:4629386-4629408 CTGGGGGTCAGGAGCCAGGCTGG - Intergenic
900895821 1:5482232-5482254 CGGGAGATGAGAGGCCAGGCAGG + Intergenic
901053684 1:6438587-6438609 CTGTGCATGCAGGGCCTGGCCGG - Intronic
901323884 1:8355802-8355824 CCTTGGAGGAGGGGCCAGGCAGG - Intronic
902412099 1:16217647-16217669 CTGGGGAGGAGGGGCGCGGCGGG - Intergenic
902480620 1:16709744-16709766 CTGTGCATGCAGGGCCTGGCTGG + Intergenic
902649598 1:17827989-17828011 CTGTGGTTGAGAGTCCAGGCTGG - Intergenic
903028903 1:20448817-20448839 CTGGGGGCGAGAGGCCAGGCCGG + Intergenic
904263799 1:29306261-29306283 GTGTGGAAGAGGGGCGAGGCGGG + Intronic
905483592 1:38279573-38279595 CTGTGGAGGAGGGGCCACAGGGG - Intergenic
905626923 1:39495400-39495422 ATATGGATGACAGGCCAGGCAGG - Intronic
905670013 1:39785371-39785393 ATATGGATGACAGGCCAGGCAGG + Intronic
905952510 1:41964108-41964130 TTGTGGAGGAGGGGCCAAGATGG + Intronic
906100288 1:43255951-43255973 CTGGGGATGAGGGGCCAGCAGGG + Intronic
906545180 1:46615338-46615360 CTGAGGATGTGTGGTCAGGCAGG - Intronic
906698955 1:47843685-47843707 CTGTGAAGGAGTGGCCAGCCAGG + Intronic
907319654 1:53594521-53594543 CCGTCGATGCAGGGCCAGGCCGG + Exonic
912415479 1:109505699-109505721 CTGTGGGTGAGGGGCTTGGAGGG - Exonic
912495645 1:110089616-110089638 GTGTGGAGGAAGGGCCAGGGAGG - Intergenic
912823395 1:112885036-112885058 CTGTGGGTGATGAGCCAGGTGGG + Intergenic
913111413 1:115660643-115660665 TTGTTTATGAGGGGCAAGGCTGG - Intronic
914876213 1:151514147-151514169 ATGTGGATCAGGGGCCAGGAGGG - Intronic
915164452 1:153940870-153940892 CTGGGGAAGATGGGCCAGGCGGG + Intronic
915300390 1:154948209-154948231 CTGGGGGTGAGGGTGCAGGCGGG - Exonic
915343244 1:155187521-155187543 CTGGGGCTGGGGTGCCAGGCTGG - Exonic
915920441 1:159972211-159972233 GTGTGGGTGAGGGGCGAGGCGGG - Intergenic
916065522 1:161132664-161132686 CCGTGGGGGAGGGGACAGGCGGG + Exonic
916415528 1:164588981-164589003 CTGGGGAGGAGGGGAGAGGCCGG - Intronic
916849881 1:168692975-168692997 ATATGGATGAAGGGCCAGGATGG + Intergenic
917250911 1:173059952-173059974 CTTCGGATAAGAGGCCAGGCTGG - Intergenic
919302669 1:195790760-195790782 CTGTGCCTGTGGGGCCAGGGAGG - Intergenic
919872414 1:201832286-201832308 CTGTGGTCCAGGGCCCAGGCTGG + Intronic
919882335 1:201908837-201908859 CTGGAGTTGAGGGGCCATGCTGG - Intronic
919938960 1:202273401-202273423 CACTGGATGTGGGGCCAGGGAGG - Intronic
920041740 1:203102380-203102402 ATGTGGAGGAGGGGGAAGGCTGG - Intronic
920170225 1:204067367-204067389 GGGTGGGTGAGGGGACAGGCAGG + Intergenic
921077643 1:211712638-211712660 CTATGCATGAGGGGCCTGGGTGG - Intergenic
921188026 1:212686342-212686364 CTGTGGGAGAGTGGCCAGGCAGG + Intergenic
921300591 1:213748022-213748044 CTGTGTATGAGGAGCCAGGTGGG + Intergenic
922566923 1:226607072-226607094 TTGGGGATGAGGCGCCAGCCTGG + Exonic
922661471 1:227433998-227434020 GAGTGGATAAGGGGCCACGCGGG - Intergenic
923130165 1:231068061-231068083 CTGTGGATTAGGGTCTAGACAGG + Intergenic
924661008 1:246016701-246016723 CTGTGGAAGAGGGGCCAGGAGGG + Intronic
1062805076 10:413195-413217 CTGTGGATAAGAGGCCATGGAGG - Intronic
1063584343 10:7337918-7337940 CTGTGTTTTGGGGGCCAGGCTGG - Intronic
1064099462 10:12451094-12451116 GTAGGGCTGAGGGGCCAGGCAGG + Intronic
1064435802 10:15310467-15310489 CTGTGGGAGAGGGGCCAGGTTGG - Intronic
1065743164 10:28815408-28815430 GTGTGGAAGAGGGCCCAAGCGGG + Intergenic
1067038922 10:42938388-42938410 CAGTGAAGGAGGGGCCAGGGAGG - Intergenic
1067831819 10:49614904-49614926 CTGTGAATGACCGGCCAGACTGG + Intronic
1069628112 10:69880621-69880643 CTGGGGATGAGGGGACAGCGAGG + Intronic
1069691823 10:70358711-70358733 CTGGGGAGGTGGGGCTAGGCTGG - Intronic
1070913531 10:80137987-80138009 CTCAGGATGTGGGGCCAGGATGG + Intronic
1071202037 10:83229934-83229956 GTGTGGATGAAGGGCCAAGGAGG + Intergenic
1071605062 10:86980204-86980226 CTGGGGAGGAGGGGACAGGGAGG + Intronic
1071967165 10:90863523-90863545 CTGAGAATGAGGGGGCAGTCAGG + Intergenic
1072936263 10:99716598-99716620 CTGTGGAGGAGTGATCAGGCTGG - Intronic
1072987027 10:100149823-100149845 CTGTGGCAGAGGGGCAAGGAGGG - Intergenic
1073073129 10:100807383-100807405 CTGTGGGTGAGGGAGCAGGTGGG - Intronic
1073073141 10:100807434-100807456 CTGTGGGTGAGGGAACAGGTGGG - Intronic
1073073164 10:100807536-100807558 CTGTGGGTGAGGGAGCAGGTGGG - Intronic
1075682169 10:124340889-124340911 TTGGAGATGGGGGGCCAGGCAGG + Intergenic
1075709086 10:124521202-124521224 CTATGGATGTGTGGCCAGCCTGG + Intronic
1075798307 10:125136237-125136259 GTGAGGGTGAGGGGCCAGCCTGG - Intronic
1076377632 10:130002343-130002365 CGGTGGAGAAGGGGCCAGTCTGG - Intergenic
1076378988 10:130012229-130012251 CCGTGCTTCAGGGGCCAGGCAGG + Intergenic
1076601472 10:131659381-131659403 GTCTGGAGAAGGGGCCAGGCTGG + Intergenic
1076791843 10:132780928-132780950 CTGAGGTCCAGGGGCCAGGCTGG + Intronic
1076995649 11:296345-296367 CTGTGGGTCAGGGGGCAGCCCGG + Intergenic
1077089647 11:772621-772643 CCTGGGAGGAGGGGCCAGGCAGG - Intronic
1077865389 11:6217724-6217746 CTGGGGAGGAGGGGGCGGGCTGG - Exonic
1078196937 11:9144167-9144189 AGGTGGATGAGAGGCCATGCCGG - Exonic
1078462876 11:11528620-11528642 ATGTGGATGATGGGCTATGCGGG + Intronic
1079022535 11:16921416-16921438 CTATGGATGAGGGGGCAGAGAGG + Intronic
1079026964 11:16956698-16956720 TTGTGGATTAGGGCCCAGGCGGG - Intronic
1079139534 11:17798859-17798881 CTGTGGATGAGGAAACAGGCTGG + Intronic
1079141418 11:17812543-17812565 CTGTGGCACAGGGGCCAAGCAGG + Intronic
1079244809 11:18744200-18744222 CTGTGGAAGATGGGCCATGCGGG + Intronic
1079336075 11:19572001-19572023 CTGTGGATGAGTAGACTGGCAGG + Intronic
1080947924 11:36995879-36995901 AGGAGGATGAGGGGCCAGCCAGG - Intergenic
1081816373 11:45945842-45945864 CTGTGGAGGTGGGGCTGGGCAGG + Exonic
1081910479 11:46696897-46696919 CTATGGCTGAGGGGCCCAGCTGG + Intronic
1081966522 11:47173435-47173457 CTTTGGGTGAGGTGCCAAGCAGG + Exonic
1083267561 11:61553829-61553851 CTGCTGCTGAGGGGACAGGCAGG + Intronic
1083292795 11:61699236-61699258 CTGTGGCTGCAGGGCCAGCCAGG - Intronic
1083333327 11:61909189-61909211 CTGGGGATGGGGGGCTGGGCGGG + Intronic
1083364369 11:62132605-62132627 CTGTAGAGGGAGGGCCAGGCAGG + Intronic
1083641814 11:64149750-64149772 CTGTGGCTGAGGGGGCAGTCAGG - Intronic
1084490600 11:69476323-69476345 CTGCCTAGGAGGGGCCAGGCAGG - Intergenic
1084545049 11:69811034-69811056 CTGTGGAGCAGAGACCAGGCCGG + Intronic
1084881936 11:72177735-72177757 GTGTGGCAGAGGGCCCAGGCCGG - Intergenic
1085046249 11:73355510-73355532 CTGTGGAGGAGGAGGCAGGTTGG - Intronic
1085049334 11:73372088-73372110 CTGGGGAGGAGAGCCCAGGCAGG + Intergenic
1085282605 11:75340873-75340895 CCGTGGGTGAGGGGCCAGAGGGG + Intronic
1085461388 11:76695991-76696013 GTGTGGATGGAGGGCCATGCAGG + Intergenic
1085462171 11:76700775-76700797 CTGGGGCTGTGGGGCCAGGGTGG + Intergenic
1086064451 11:82731903-82731925 CTGTGGCTGAGGGAGGAGGCCGG - Exonic
1086400950 11:86460497-86460519 CTGAGGATGTGAGGCTAGGCTGG + Intronic
1087078178 11:94144736-94144758 CTGAGGATGAATGGCCAGGGAGG - Intronic
1088607076 11:111541992-111542014 CTTCGGATGTGTGGCCAGGCTGG + Intronic
1089683171 11:120130738-120130760 CCATGGACCAGGGGCCAGGCTGG + Intronic
1090955520 11:131510241-131510263 CTGCGGATGAGCTGCAAGGCAGG - Intronic
1090979017 11:131700665-131700687 CTGAGGATGAGGTGCCTGGAAGG - Intronic
1091285201 11:134405041-134405063 CTGTGGATGAGGGAAGAGGAGGG + Intronic
1091306093 11:134536952-134536974 CAGTGAATGAAGGGTCAGGCAGG - Intergenic
1091776257 12:3186828-3186850 CTGGGGAGGAGGGGGCAGGATGG + Intronic
1091931721 12:4401827-4401849 CTCTGGATGCTGAGCCAGGCAGG + Intergenic
1092818515 12:12331713-12331735 AGGAGGAGGAGGGGCCAGGCAGG + Intronic
1093988769 12:25567537-25567559 GTGTGGATGAGGGGCCTAGTGGG + Intronic
1094041514 12:26125122-26125144 CGGGGGAGGAGGGGCCGGGCCGG + Exonic
1096622599 12:52874043-52874065 CTGTGGATTAGGGGCACGGGTGG - Intergenic
1096788359 12:54030462-54030484 CTGGGGCAGAGGGGCTAGGCAGG - Exonic
1097675051 12:62591285-62591307 CTGAGGGTGAGGAGTCAGGCTGG - Intronic
1098469900 12:70831438-70831460 GTGTAAATGAGGAGCCAGGCTGG + Intronic
1102235387 12:111291338-111291360 CTGTGGCTGCAGGGCCTGGCAGG - Intronic
1102625615 12:114233179-114233201 CTTTGGAAGAGGGGCCTAGCAGG - Intergenic
1103623883 12:122204499-122204521 CTGTGGACGAGAGGCCCGGGCGG - Intronic
1103791750 12:123477026-123477048 CTGAAGCAGAGGGGCCAGGCAGG + Intronic
1104054256 12:125217260-125217282 GTGGGGAAGAGAGGCCAGGCTGG + Intronic
1104426775 12:128684460-128684482 CTTTGGCTGAGGAGACAGGCAGG - Intronic
1104933710 12:132353611-132353633 CGGTGGGGGAGGGGCCTGGCAGG - Intergenic
1108442266 13:50466846-50466868 CCAAGGATGAGGGGCCAGGTGGG + Intronic
1112803706 13:103139058-103139080 CTGTGGAAGAGGGTCCAGTGGGG + Intergenic
1113469527 13:110534495-110534517 GTTTGGCTGAGGGGCAAGGCAGG - Intronic
1113741051 13:112712575-112712597 CTGTGGGTGATGGTCCCGGCTGG + Intronic
1118861829 14:69670172-69670194 CTGGGGATGAGGTACTAGGCTGG + Intronic
1119568662 14:75650455-75650477 CTGTGTATGAGGGTCCAGCTGGG + Exonic
1119572963 14:75692678-75692700 CTGTGTATGGGGAGCGAGGCAGG + Intronic
1119728476 14:76936525-76936547 CTGGGGTTGAAGGGCCAGCCTGG - Intergenic
1120649419 14:87113705-87113727 ATGGGCATGATGGGCCAGGCAGG - Intergenic
1122292783 14:100688468-100688490 CTGGGGGTGGGGGGCCAGGAAGG - Intergenic
1122447379 14:101779990-101780012 CAGTGGATGATGGCCAAGGCTGG - Intronic
1122707454 14:103629810-103629832 CCGGGGATGCGGGGCCAGGGCGG - Intronic
1122858517 14:104571705-104571727 GTGGGCACGAGGGGCCAGGCTGG - Intronic
1122884740 14:104706012-104706034 CTGTGCAGGAGGGGCCAGGTGGG - Intronic
1122989244 14:105229248-105229270 CTGAGGATGCGGAGCCAGGCTGG + Intronic
1123011263 14:105350640-105350662 GTGGGGCTGCGGGGCCAGGCTGG - Intronic
1123032273 14:105457513-105457535 GGGTGGAAGAGGGGCCAGGAGGG + Intronic
1124373858 15:29118355-29118377 CTGTGAATGAAAGGACAGGCGGG - Intergenic
1124549622 15:30667406-30667428 CTGTGTACCAGGTGCCAGGCTGG + Intronic
1124581402 15:30958323-30958345 CAGAGGCTGAGGGCCCAGGCGGG + Intronic
1124594461 15:31081628-31081650 TTGGGGAGGAGGGGACAGGCAGG - Intronic
1127891316 15:63254023-63254045 CTGAGGCTGAAGGGCTAGGCTGG - Intronic
1128369915 15:67033222-67033244 CTGTTGATGACGGGGCGGGCTGG + Intergenic
1129060014 15:72853246-72853268 CAGTGGAGGAGGGGCCCGGCAGG + Intergenic
1129302968 15:74636983-74637005 ATGTGGATTAGAGGCCTGGCTGG + Intronic
1129462068 15:75704519-75704541 ATGTGGGTGGGGGGCCTGGCCGG + Intronic
1129775252 15:78232548-78232570 CTGTGAGTGAGGGGCCAAGTGGG - Intronic
1130558959 15:84944073-84944095 CTGTGGGTGTGGGAACAGGCAGG - Intronic
1130897229 15:88181071-88181093 CTGTGCATTAGGGGCAAGTCAGG - Intronic
1132692325 16:1187185-1187207 CTGAGAATGAGGGGCCGGGAGGG + Intronic
1132834748 16:1947116-1947138 TGGTGGCTGAGAGGCCAGGCTGG + Intronic
1133234247 16:4380468-4380490 GTCTGGAAGAGGGGGCAGGCAGG - Intronic
1135134323 16:19876447-19876469 CTGCTGCTGAGGGGCCTGGCTGG - Intronic
1135590999 16:23705213-23705235 CTCTGGGTGAGGGGTCAGTCTGG + Intronic
1136186000 16:28589386-28589408 CAGGAGATGAGGGGCCAGGGCGG - Intronic
1136396473 16:29995270-29995292 CTGAGGAGGAGGGGCCTGACGGG - Intronic
1137520388 16:49190198-49190220 CTGTGGATGAAGAGTTAGGCAGG - Intergenic
1137624886 16:49901275-49901297 CACTAGATGAGGGGCCAGGGAGG + Intergenic
1138619799 16:58201706-58201728 CTGCGGGGGAGGTGCCAGGCAGG + Intergenic
1139488136 16:67270957-67270979 CCGTGGATGGGGAGGCAGGCAGG - Exonic
1139997539 16:70995098-70995120 CTGTGGCTCAGGGGGCAAGCAGG - Intronic
1140506990 16:75479726-75479748 CTGGGGACGAGGGCCCTGGCCGG + Exonic
1140514154 16:75530216-75530238 CTGGGGATGAGGGCCCTGGCCGG + Exonic
1140957254 16:79877100-79877122 ATGTAGATGAGAGTCCAGGCAGG + Intergenic
1141118406 16:81331645-81331667 ATGTGTATGAGGGGACAGGGTGG - Intronic
1141611356 16:85182811-85182833 CTGTGGATGCTGGGGCAGGAGGG - Intronic
1141621360 16:85238238-85238260 CTGGGGATGTGAGGGCAGGCTGG - Intergenic
1141941500 16:87279025-87279047 CTCTGGCTCATGGGCCAGGCTGG - Intronic
1141997000 16:87641976-87641998 CTGTGGAGGAGGGGTGGGGCTGG + Intronic
1142556545 17:782155-782177 CTGGGGATGAAGGTGCAGGCCGG - Exonic
1142640028 17:1280344-1280366 ATGAGGTTGAGGGGCCAGACGGG - Exonic
1142640325 17:1281595-1281617 CTGTGGAAGCAGGGCCGGGCAGG + Intronic
1142679130 17:1535362-1535384 CTGTGGAGGAGGGGCATGGCTGG - Intronic
1144638938 17:16927109-16927131 CTGGGGAGGAGGGCCCTGGCTGG + Intergenic
1144791554 17:17862398-17862420 CTGTGGATGAGGGGCCAGGCAGG + Intronic
1145997281 17:29111903-29111925 CTGTGGGAAAGGGGCCAGGGTGG + Intronic
1146077431 17:29744193-29744215 CCGGGGGTGAGGGGCCAGGTGGG + Intronic
1147510946 17:41068487-41068509 CTGTAGATGATGGGCCAGGGTGG - Intergenic
1147659709 17:42111034-42111056 CCCAGGATGAGGAGCCAGGCAGG + Intronic
1147916741 17:43892190-43892212 CAGTGTAGGAGGGGCCAGGCTGG - Intronic
1149682113 17:58514125-58514147 CAGTGGCTGCGGGGCCAGGATGG + Intronic
1149782566 17:59409650-59409672 CAGTGGAAGAGGGGCCATGGTGG - Intergenic
1150176852 17:63066333-63066355 CTGGGTATGTGGGGCCAGCCTGG + Intronic
1151143329 17:72016220-72016242 CTGGGGAAGAGGGGACAGGAAGG + Intergenic
1151358088 17:73571983-73572005 CTGGGCATGCCGGGCCAGGCGGG + Intronic
1152117735 17:78398991-78399013 CTGGGGGTGAGGGGCAAGGTGGG + Intronic
1152403770 17:80084983-80085005 CTGGGGGTGAGGTCCCAGGCAGG + Exonic
1152460446 17:80439483-80439505 CCGGGGTTGGGGGGCCAGGCTGG - Intergenic
1152485224 17:80586635-80586657 CTGTGGTTCAGCTGCCAGGCGGG + Intronic
1152570555 17:81119626-81119648 CTGTGGGAGCGGGGCCGGGCCGG - Intronic
1152593042 17:81222971-81222993 CTGGGGAGGTGGTGCCAGGCTGG - Intronic
1152754556 17:82081844-82081866 CTGTGGGGGAGGGGGCAGGTGGG + Intronic
1152768437 17:82153230-82153252 CTGGGGGAGAGGGGCCAGGCAGG + Intronic
1153658439 18:7305664-7305686 CAGTGATTGAGGGGCCAGGCAGG + Intergenic
1153894178 18:9543876-9543898 GTGGGGAGGAAGGGCCAGGCAGG - Intergenic
1154370937 18:13762603-13762625 GTGTGGATGGGGGAGCAGGCTGG - Exonic
1157170819 18:45403534-45403556 ATGAGGAGGAGTGGCCAGGCAGG - Intronic
1157181184 18:45499685-45499707 TTGGGGAAGAGGGGCCAGGAGGG + Intronic
1157586779 18:48806091-48806113 CTGTGGTGGAGGGGACAGCCAGG + Intronic
1158898540 18:61939220-61939242 CTGAGAAAGAGAGGCCAGGCGGG - Intergenic
1158937008 18:62373819-62373841 AGGAGGATGAGGGGTCAGGCAGG - Intronic
1160059663 18:75517576-75517598 CTGTGGATGTGGGCACAGGCAGG + Intergenic
1160785783 19:899725-899747 CTGTGGGTGGGGGGCCAGGGAGG + Intronic
1160868339 19:1265976-1265998 ATGTGGATGTGGGGGCAGCCGGG - Intronic
1160888862 19:1366409-1366431 ATGGGCCTGAGGGGCCAGGCCGG + Intronic
1161268294 19:3375297-3375319 CTGTGGAGGAGATGCCAGGCGGG - Intronic
1161310814 19:3593056-3593078 CTGTGACTGTGGGGCCAGGTAGG - Exonic
1161316941 19:3621558-3621580 CTGTGGAAGCGGCCCCAGGCTGG - Intronic
1161324326 19:3656125-3656147 GTGGGGATGGGGAGCCAGGCAGG + Intronic
1161793257 19:6373234-6373256 CTGGGGTTGTGGGGCCAGGGGGG + Intronic
1161971321 19:7582505-7582527 CAGGAGATGAGGGGCCAGGCTGG - Intergenic
1162020953 19:7868428-7868450 CGGTGCAGGAGGGGCCTGGCAGG - Intergenic
1162105218 19:8366149-8366171 CTGGGGACGTGGGGCCAGGCAGG + Intronic
1163032657 19:14554413-14554435 CTGGGGCTGAGAGGGCAGGCAGG + Intronic
1163645521 19:18486929-18486951 ATGTGGGTGAGGTGGCAGGCAGG - Intronic
1164272874 19:23688748-23688770 CTGTGGCTCAAGGCCCAGGCAGG - Intergenic
1165060525 19:33202904-33202926 GGGTAGTTGAGGGGCCAGGCCGG - Exonic
1165229282 19:34376725-34376747 CTGTGCCTTAGGGGCCAGGCAGG - Intronic
1165243465 19:34484253-34484275 CTGTCAGTGAGGGGCCAGGTGGG + Intronic
1165436180 19:35796815-35796837 CTGTGGCTGGGGGCCCAGGATGG - Intergenic
1165439446 19:35816300-35816322 CTGGGGATGAGGCCCTAGGCTGG - Intergenic
1165932667 19:39370006-39370028 CTGGGGAGGCAGGGCCAGGCTGG + Exonic
1166241969 19:41500473-41500495 CTGAGGATGAGGAGCCGGACTGG - Intergenic
1166300004 19:41907967-41907989 CTTTGGGAGTGGGGCCAGGCGGG + Intronic
1166499900 19:43332742-43332764 CTTTGGGTCAGAGGCCAGGCTGG - Intergenic
1166808643 19:45501850-45501872 CTGTGTCTGATTGGCCAGGCTGG + Intronic
1167253871 19:48415681-48415703 CAGAGGAGGAGGGGCCAGGAGGG + Intronic
1167594004 19:50418089-50418111 CTGAGGATGAGGGGCGGTGCGGG - Intronic
1167648292 19:50717381-50717403 CCTGGGATGAGGGGCCAGGCTGG - Intronic
1168189874 19:54730111-54730133 CTGTGGGTGACAGGCCAGGATGG - Intronic
1168191873 19:54744411-54744433 GTGTGGGTGAGAGGCCAGGATGG - Intronic
1168196204 19:54775781-54775803 GTGTGGGTGAGAGGCCAGGATGG - Intronic
1168204565 19:54840023-54840045 GTGTGGGTGAGAGGCCAGGAAGG - Intronic
1168206810 19:54856236-54856258 GTGTGGGTGAGAGGCCAGGATGG - Intronic
1202714659 1_KI270714v1_random:35652-35674 CTGTGCATGCAGGGCCTGGCTGG + Intergenic
925380120 2:3418954-3418976 CGGTGGAGGAGGGGCCGAGCAGG - Intronic
925614754 2:5734719-5734741 AGGTGCATGAGGGGCCAGACAGG + Intergenic
926727875 2:16012768-16012790 ATGTGGCACAGGGGCCAGGCAGG + Intergenic
926934596 2:18074267-18074289 CTGAGGATGAGGGGACAGGGAGG - Intronic
927089043 2:19696553-19696575 CTGTGGATGAGAAGACAGCCTGG + Intergenic
927780913 2:25938792-25938814 CTGTGGTTGTGGGGCCCTGCTGG - Intronic
929107787 2:38380918-38380940 CTTTGGGGGAGGGGCCAGGGAGG + Intergenic
929464100 2:42129322-42129344 CAGAGGGTGAGGGGCCAGGGAGG - Intergenic
929964570 2:46524642-46524664 CTGTGGGCAAGGGGCCAGTCAGG + Intronic
930695317 2:54406056-54406078 CTGAAGAGGAGGGTCCAGGCAGG + Intergenic
931467680 2:62505874-62505896 CCTTGGAGGAGGGGCCGGGCCGG - Intronic
932575564 2:72960646-72960668 CTGGGAATGAGGGGCTGGGCTGG - Intronic
932873677 2:75428982-75429004 CTGTGGAAGAGGAGGCTGGCTGG + Intergenic
933694861 2:85210231-85210253 GTGTGGGGAAGGGGCCAGGCAGG - Intronic
933736612 2:85500319-85500341 CTGTGCATGAAGGAGCAGGCAGG + Intergenic
934561511 2:95315868-95315890 CTGTGGATGGGGCCCGAGGCAGG - Intronic
935814098 2:106830316-106830338 TTGAGGCAGAGGGGCCAGGCTGG + Intronic
935849165 2:107199684-107199706 CTGTGGAGGGGTGGCCATGCAGG - Intergenic
936153912 2:110036118-110036140 CGGAGGAGGAGGGCCCAGGCTGG + Intergenic
936154713 2:110040373-110040395 CAGGGGATGGGGGGCCAGTCTGG + Intergenic
936189970 2:110331041-110331063 CAGGGGATGGGGGGCCAGTCTGG - Intergenic
936190773 2:110335297-110335319 CGGAGGAGGAGGGCCCAGGCTGG - Intergenic
936520713 2:113210474-113210496 CTGTGGTTGAGGAGCTGGGCTGG + Intergenic
936707231 2:115088984-115089006 CTGAGGATGAGGGGCCAACCTGG - Intronic
937981489 2:127618844-127618866 CTGGGGCTGGGAGGCCAGGCAGG + Intronic
938055587 2:128212364-128212386 CTATGGATGATGGGGCAGGGAGG - Intergenic
938229460 2:129646001-129646023 CTGTGGACAAGGAGCCATGCTGG - Intergenic
940749672 2:157611827-157611849 CTGTGGTTGTGGTGCCAGGGTGG + Intronic
941718301 2:168786833-168786855 CTCTGGAGGAGGGGGGAGGCAGG - Intronic
946456808 2:219833083-219833105 CTGGGCCTGAGGGGCCAGGCAGG - Intergenic
946716385 2:222558398-222558420 CAGTCGATGAAGGTCCAGGCAGG - Exonic
947350225 2:229235861-229235883 CTCGGGACGGGGGGCCAGGCAGG + Intronic
947669163 2:231925847-231925869 AGGTGGATGCGGGGCCAAGCTGG - Intronic
947962523 2:234251611-234251633 CTGGGGATGAGGGGCCAAGCTGG - Intergenic
948148969 2:235729529-235729551 CTGTGGATGAGAGGCTGGACCGG + Intronic
948166366 2:235865657-235865679 CTCTGGAGGAGGGGCAGGGCGGG + Intronic
948443538 2:238013796-238013818 CAGTGGGGCAGGGGCCAGGCTGG + Intronic
948515382 2:238500144-238500166 CTGTGGCTGGAGGGCCAGGCTGG + Intergenic
948739404 2:240033142-240033164 CTGTGCCTCTGGGGCCAGGCTGG + Intergenic
949071992 2:242030960-242030982 GTGTGGGTGTGGGGCCAGGCTGG - Intergenic
1168757378 20:326480-326502 CTGTGGAGGATGGTCCCGGCGGG + Exonic
1169091735 20:2865100-2865122 ATGGGGATGAGGGACCAGGAGGG - Intronic
1170554803 20:17506250-17506272 CTCTGGACAAGGGCCCAGGCTGG + Intronic
1170855206 20:20046707-20046729 CTGTGGCTCTGGGGCCAGTCGGG - Intronic
1172188385 20:33046210-33046232 CTGTGGATGAGTGACCTGGTGGG + Intergenic
1172292268 20:33784509-33784531 AGGTGGATCAGGGGCCAGGAAGG - Intronic
1173040247 20:39455371-39455393 CTGTGAATTAGAGGACAGGCTGG - Intergenic
1174148711 20:48470635-48470657 CTGTGGATGAGGGTTTGGGCAGG - Intergenic
1174292565 20:49519486-49519508 GTGAGGAGGAGGGGCCAGGAAGG - Intronic
1174573506 20:51521170-51521192 CTGTGGAGGAAATGCCAGGCTGG + Intronic
1174812353 20:53657849-53657871 CTCTGGATGATGGGGGAGGCAGG + Intergenic
1175031215 20:55956204-55956226 CTATGGATGAGGGCAGAGGCAGG + Intergenic
1175573987 20:60046654-60046676 CTGTGGCTGAGGGGCTGAGCCGG + Intergenic
1175738059 20:61400773-61400795 CAGCGGAGGTGGGGCCAGGCCGG - Intronic
1175973138 20:62697203-62697225 CTGTGGACCTTGGGCCAGGCTGG + Intergenic
1176024124 20:62977269-62977291 CTGGGGCTGGGGGGCAAGGCAGG - Intergenic
1176113547 20:63421498-63421520 CTGTGGCTGATGGGGCAGGAAGG - Intronic
1176363869 21:6020800-6020822 CCGTGTATGAGGGGGCAGGAGGG + Intergenic
1178007610 21:28240649-28240671 CTGTGGAGGAGGGAGGAGGCAGG - Intergenic
1178806904 21:35846825-35846847 ATGGGGAGAAGGGGCCAGGCAGG - Intronic
1179566650 21:42253157-42253179 CCCTGGATGCAGGGCCAGGCAGG - Intronic
1179759649 21:43517745-43517767 CCGTGTATGAGGGGGCAGGAGGG - Intergenic
1180054668 21:45351686-45351708 CGGTGGACAAGTGGCCAGGCAGG - Intergenic
1180085525 21:45506445-45506467 GTGTGTCTGAGGAGCCAGGCTGG - Intronic
1180815700 22:18787920-18787942 GTGTGTATGCGGGGCCAGGGTGG - Intergenic
1180858005 22:19060189-19060211 CAGTGAGGGAGGGGCCAGGCTGG - Intronic
1181056402 22:20262392-20262414 GAGTGGGTGATGGGCCAGGCTGG + Intronic
1181164656 22:20976819-20976841 CGGTGGATGAGAGCCCAGCCAGG - Intronic
1181201888 22:21222255-21222277 GTGTGTATGCGGGGCCAGGGTGG - Intronic
1181699861 22:24614713-24614735 GTGTGTATGCGGGGCCAGGGTGG + Intronic
1182073152 22:27477323-27477345 CTTTGGATGTGGGGACAGCCTGG - Intergenic
1182459697 22:30475073-30475095 CTGGGGTTTAGGGGGCAGGCTGG - Intergenic
1182791558 22:32957337-32957359 CTGGGAATGAGAGGCCTGGCCGG + Intronic
1183089154 22:35509603-35509625 ATGTGGCTGAGAGGCCAGGTGGG - Intergenic
1183424489 22:37731917-37731939 CTGTGCCTGAGGAGCCATGCTGG - Intronic
1183522072 22:38301258-38301280 CTGTGAGTGTGGGGCCGGGCAGG - Intronic
1183794578 22:40105158-40105180 CTGAGGATGAAGGGCCTGGCAGG + Intronic
1184034262 22:41911074-41911096 CTGCGGGTGAGGGGCCCGACCGG - Intronic
1184409908 22:44320404-44320426 CCGTGGATCAGGGGGCAGGGAGG + Intergenic
1184543213 22:45143970-45143992 CTGTGGATAAGTGGTCAGACTGG - Intergenic
1184778387 22:46634527-46634549 CTGTGGACCAAGGACCAGGCTGG - Intronic
1184976700 22:48067321-48067343 ATGAGGAGAAGGGGCCAGGCAGG - Intergenic
1185047759 22:48537522-48537544 CTGGGATTGAGAGGCCAGGCTGG - Intronic
1185083491 22:48723048-48723070 CTGGGGCTCAGGGGACAGGCTGG - Intronic
1185100652 22:48839253-48839275 CTGTGGGGAAGGGGCCTGGCAGG - Intronic
1185280662 22:49968588-49968610 CTGTGGAGGGCGGGCGAGGCGGG - Intergenic
1185411491 22:50685288-50685310 TGGTGGGTGTGGGGCCAGGCTGG + Intergenic
1203225023 22_KI270731v1_random:73173-73195 GTGTGTATGCGGGGCCAGGGTGG + Intergenic
1203265805 22_KI270734v1_random:13611-13633 GTGTGTATGCGGGGCCAGGGTGG - Intergenic
1203331138 22_KI270738v1_random:89927-89949 CTGTAGCTGAGGGTCCAGTCTGG + Intergenic
951550164 3:23869484-23869506 CTTGGGGTGAGGGGGCAGGCAGG - Intronic
952533156 3:34282850-34282872 ATGAGTATGAGAGGCCAGGCAGG - Intergenic
952585097 3:34882909-34882931 AAGTAGATGAGGGGCCAGGAGGG + Intergenic
952919691 3:38276120-38276142 CGGTGGGTGAGGGGGCATGCGGG - Intronic
953310686 3:41875355-41875377 CTGTGTACCAGGTGCCAGGCTGG - Intronic
953413180 3:42701566-42701588 TAGCGGATGTGGGGCCAGGCGGG + Intronic
953620113 3:44525848-44525870 TGGTGGGTGAGGGGCCAGGCTGG - Intergenic
953856613 3:46504056-46504078 CTGTGACTGAGGGGTAAGGCAGG + Intergenic
953997801 3:47534091-47534113 CTGGGGAGGAGGAGCCAGGCTGG + Intergenic
954295751 3:49673888-49673910 TTGAGGATGAAGGGCAAGGCGGG - Intergenic
954371536 3:50171698-50171720 CTGTGGGTGAGCAGCCAGGCGGG + Intronic
954706520 3:52483644-52483666 CTGTGGATGTGGGCTCAGGCTGG + Intronic
954751687 3:52817615-52817637 GTGTGGATGAGGGGAATGGCAGG - Intronic
956733240 3:72215990-72216012 CTGAGGAGGAGTGGCCAGGGAGG - Intergenic
958896635 3:99836818-99836840 CAATGGCTGAGGGGCCAGCCAGG - Intronic
959149326 3:102590056-102590078 ATGTGGAGGAGGGGCCTGGTAGG + Intergenic
959297486 3:104555501-104555523 CTGTGGATTAGTTGCCAAGCAGG - Intergenic
961381103 3:126497091-126497113 CTGTGGAGGAGGAGGCGGGCAGG - Intronic
961482576 3:127193490-127193512 CTGGGGCTGAGGGAACAGGCTGG - Intronic
961634852 3:128326859-128326881 CTCTAGATGAGAGGCCAGGATGG - Intronic
961658643 3:128456921-128456943 CTGGGGGAGAGGGGACAGGCAGG + Intergenic
961816810 3:129555329-129555351 CTGTGGCCGATGGGCCATGCGGG - Exonic
963017332 3:140838385-140838407 CTGGGGATGAGGGGCTTGGAGGG + Intergenic
965629178 3:170713344-170713366 CTGTGGATGAAGAGCCAGCCTGG + Intronic
966397548 3:179518414-179518436 TTGGGGCTGAGGGGACAGGCGGG - Intergenic
968481421 4:834746-834768 CTGTGGGTGAGGGGACAGATGGG + Intergenic
968598877 4:1499783-1499805 CTGTGGAGCAGGGGCCTGGCTGG - Intergenic
968651849 4:1763312-1763334 CTGTGGACGGGCGGCCGGGCTGG + Intergenic
968669701 4:1842500-1842522 CTGTGGATGAGAGGCAAGAGCGG - Intronic
968759504 4:2434774-2434796 CTGTGGATGTGGGTGCAGCCTGG - Intronic
968916792 4:3500145-3500167 GTGGGGAGGAGGGGCTAGGCAGG + Intronic
968982066 4:3855655-3855677 AGGTGAGTGAGGGGCCAGGCAGG - Intergenic
969343805 4:6558825-6558847 CTTTAGATGGGAGGCCAGGCAGG - Intronic
969470540 4:7385065-7385087 CTGTGGAGCAGGGGCCAGGGTGG + Intronic
971968630 4:33593990-33594012 ATGTGGATTGGGGGCCAGGAAGG - Intergenic
973992075 4:56419089-56419111 CTGGGGATGAGGGATGAGGCAGG + Intronic
974715956 4:65669508-65669530 CTGGGGCGGAGGGGCTAGGCGGG - Intronic
975683977 4:76901755-76901777 CTGAGGATGAGAGACCAGGTTGG + Intergenic
977983819 4:103359101-103359123 CAGTGGAGGAGGGGCCTGGTGGG + Intergenic
980103673 4:128566488-128566510 CTGTGGAAGAGGGGCCCCGATGG + Intergenic
980112034 4:128644960-128644982 CTGGGACTGAGGGGACAGGCAGG + Intergenic
982235619 4:153249023-153249045 CTGTTGCTGGAGGGCCAGGCGGG + Intronic
982261511 4:153498257-153498279 CTGAGGCTGAGGGGCCTGGGAGG + Intronic
982315339 4:154025543-154025565 CTGCAGTGGAGGGGCCAGGCTGG + Intergenic
983831184 4:172329897-172329919 CTGTGGAAAAGTGGCCAGACTGG - Intronic
984443564 4:179804696-179804718 GAGTGGATGAGGAGGCAGGCTGG - Intergenic
985179420 4:187240558-187240580 CTGTGGATGTAAGGACAGGCAGG - Intergenic
985341082 4:188955410-188955432 CTCTGGAGGAGGGGCCTGGTGGG - Intergenic
985508103 5:296295-296317 GTGTGGGTGTGGGGCCAGGCTGG - Intronic
985531865 5:438603-438625 CTGTGGGTCCGGGGCCATGCGGG + Intergenic
985535148 5:460524-460546 CTGTGGATGGGCGGCCAGTGGGG - Intronic
985649752 5:1101955-1101977 CTGTGGCTGGGGGGCTTGGCAGG - Intronic
985721870 5:1493711-1493733 AGGTGGGTGAGGGGCCACGCAGG + Intronic
985739933 5:1609374-1609396 GTGTGGGTGTGGGGCCAGGCTGG + Intergenic
986024626 5:3838902-3838924 TTGTGGATGAGGAGGCAGCCAGG + Intergenic
986637290 5:9835738-9835760 CTGTGGGAGAGGGGCCCAGCAGG - Intergenic
987602911 5:20095153-20095175 CGGGGGATGAGGGGCAAGGGAGG + Intronic
989323623 5:40165283-40165305 CTGTGCAGGAGTGGCCAGGTAGG - Intergenic
989499624 5:42150253-42150275 ATGTGGAGGAGGGGCCTGGTGGG + Intergenic
990320010 5:54620626-54620648 CCGTGGAGGAGGAGCCAGACAGG + Intergenic
992150228 5:73895295-73895317 CAGAGGATGAGAGGCCAGGGTGG + Intronic
992618531 5:78569736-78569758 CTGTGGTTGAGTGGCAGGGCCGG - Intronic
994511806 5:100713458-100713480 CTCTGGATGAGATGCCAGGGAGG - Intergenic
997932590 5:138084429-138084451 CTGTGGTTGGGGGAGCAGGCAGG - Intronic
998092615 5:139380100-139380122 AAGTGGATGGGAGGCCAGGCTGG + Intronic
998227408 5:140337605-140337627 CAGTGGCAGAGGGGCCAGGCTGG + Intronic
999887451 5:155938445-155938467 CTGTTTATGAGGTGTCAGGCTGG + Intronic
1001395990 5:171419922-171419944 CTGTGCAGGAGGCGCCTGGCCGG - Exonic
1001892780 5:175353087-175353109 CGGTGGATAAGGGGTCACGCTGG + Intergenic
1002204535 5:177553883-177553905 CTGTGGCTGAGGGAGCAGGTGGG + Intronic
1002780000 6:358552-358574 CTGAGGCTGAGGGGCAGGGCTGG + Intergenic
1002880527 6:1246963-1246985 CTGTGGATGATCTGCCAAGCAGG + Intergenic
1003217842 6:4131325-4131347 CTGTAGCTGAGGGGCTAGGGTGG + Intronic
1003494089 6:6648857-6648879 TGGTGGGGGAGGGGCCAGGCTGG - Intronic
1004719546 6:18255395-18255417 CTGAGGATGAGGTGCAAGGCTGG - Intronic
1006019888 6:31111754-31111776 CTGTGGATGAGAGACCAGGGAGG + Exonic
1006580358 6:35073520-35073542 CTGAGGAAGAGGGGACAGGAGGG - Intronic
1006683594 6:35814529-35814551 CTGTGGCTGAGGGGGAAGGAGGG - Exonic
1006794231 6:36721826-36721848 TTGTGGGTGAGGGTCCGGGCTGG - Exonic
1007616397 6:43182179-43182201 CTGAGGAGGCGGGGCCAGGACGG + Exonic
1008044275 6:46835557-46835579 CTGTGGCTGGGGAGACAGGCAGG + Intronic
1011696909 6:89921292-89921314 CTGTGGAAGTGAGCCCAGGCTGG - Intergenic
1016076851 6:139805528-139805550 GTGGGGATGGGGGGCCAGGGGGG + Intergenic
1017415220 6:154213256-154213278 CTCTGGCTGAGGGAGCAGGCTGG + Intronic
1017520246 6:155195676-155195698 ATGGGGAGTAGGGGCCAGGCTGG + Intronic
1018768210 6:166950746-166950768 CAGATGATGAGGGGCCAGCCCGG + Intronic
1019037308 6:169072510-169072532 ATGTGGGAGAGTGGCCAGGCTGG - Intergenic
1019659204 7:2214553-2214575 CGGTGGTTGTGGGGCCTGGCAGG - Intronic
1019998012 7:4737652-4737674 ATCTGGCTGAGGGTCCAGGCAGG - Intronic
1022006797 7:26272926-26272948 CTCTGGATCAGAGGCCAGGGTGG + Intergenic
1022427712 7:30284713-30284735 CTGCGAAGGAGGGGCCGGGCTGG - Exonic
1023814495 7:43939192-43939214 CAGTGGAGGAGGGGCAGGGCAGG + Intronic
1024279907 7:47710326-47710348 CTGTTGGTGAGGGGCCCGGACGG + Intronic
1024362961 7:48487786-48487808 CTGTGTGTGAGGGGGCAGGGTGG + Intronic
1024696058 7:51857750-51857772 CTGTGAAGGAAGGGCCAGCCAGG + Intergenic
1026227956 7:68459278-68459300 CTGTCGAGGAGGGGCCTGGTGGG - Intergenic
1026866328 7:73826228-73826250 CTGGGGACTTGGGGCCAGGCGGG + Intronic
1027024565 7:74841570-74841592 GTGTGGATGAGGGGGAAGGATGG - Intronic
1027063200 7:75102552-75102574 GTGTGGATGAGGGGGAAGGATGG + Intronic
1028920540 7:96305972-96305994 CTGTGGAATAGGGCCCAGGAGGG - Intronic
1029487427 7:100852262-100852284 CAGCGGGTGAGGGGCGAGGCTGG + Intronic
1030078553 7:105757924-105757946 CTGTGTACCAGGGCCCAGGCAGG - Intronic
1032092898 7:128920533-128920555 CAGGGGATGAGGGGGCAGGAGGG + Intergenic
1032840244 7:135707772-135707794 CTGTGTATCAGGGAACAGGCTGG - Intronic
1033657601 7:143383504-143383526 CTCTGGAGGAGAGGCCTGGCTGG + Intronic
1033724808 7:144103618-144103640 GTGAGGATGAGGGACCAGGAGGG - Intergenic
1034074792 7:148221354-148221376 CAGAGGATGTTGGGCCAGGCTGG + Intronic
1034213772 7:149387370-149387392 CTGTGGAGGTGGGGCGTGGCAGG - Intergenic
1034437994 7:151072212-151072234 CTCTGGATTTGAGGCCAGGCTGG + Intronic
1034438809 7:151076394-151076416 CGATGGACGAGGGGACAGGCTGG + Exonic
1034939393 7:155220570-155220592 GTGTGGAGGAGGGGCCAGGCTGG - Intergenic
1035284176 7:157795741-157795763 CTGTGGACGAGGCGGGAGGCGGG + Intronic
1035421090 7:158729562-158729584 CTGTGGAAGAGGGGCAAGTGAGG + Intergenic
1035712506 8:1729389-1729411 GTGGGCACGAGGGGCCAGGCAGG + Intergenic
1036626843 8:10479386-10479408 GTGTGGAAGGGGGGCCAGGCGGG + Intergenic
1036648402 8:10626094-10626116 CTGTGGAGGAAGGGGCAGGGCGG + Intronic
1037725621 8:21480461-21480483 CTGTGGAACATGGGCCAGACAGG + Intergenic
1038310285 8:26441107-26441129 CTGTGGGGGAAGGGGCAGGCGGG + Intronic
1038483818 8:27919644-27919666 CAGTGGATGAGAAGGCAGGCAGG + Intronic
1039118907 8:34123959-34123981 TTTTGGATGAGTGGCCAGGGAGG + Intergenic
1040512872 8:48110667-48110689 CTGTGGGTGAGGGGCGGTGCTGG + Intergenic
1040602921 8:48902262-48902284 CTGAGGGTGAGGGGCCATCCGGG - Intergenic
1041776488 8:61528720-61528742 CTGTGGGTGAAGGGGCAGGAAGG - Intronic
1042483901 8:69331259-69331281 GTGTGGGTGTGGGGTCAGGCTGG - Intergenic
1042509581 8:69597407-69597429 CTGGGGATGAGGTCCCAGGTGGG - Intronic
1044648258 8:94467667-94467689 CTATGCTTGGGGGGCCAGGCAGG - Intronic
1045110014 8:98931457-98931479 ATGTGCATGAGGGATCAGGCTGG - Intronic
1045495027 8:102700845-102700867 CTGGGGAGGAGGAGCCTGGCTGG - Intergenic
1046969407 8:120204854-120204876 GTGGGGTTGAGGGTCCAGGCAGG + Intronic
1047175649 8:122538056-122538078 GAGTAGATGAGGGGCCAGGCTGG - Intergenic
1048290340 8:133176456-133176478 AAGTGGATGTGGGGCAAGGCAGG - Intergenic
1049240493 8:141535327-141535349 CTGGGGAGGAGGGGGCAGTCAGG + Intergenic
1049336713 8:142090411-142090433 CTGAGGGTGAGGGTCCGGGCTGG + Intergenic
1049373306 8:142277893-142277915 CTGAGAAGGAGGGGCCTGGCAGG - Intronic
1049416746 8:142498868-142498890 CAGTGGAGGAGGGGACAGGTGGG + Intronic
1049583729 8:143423677-143423699 CTGTGAGGGTGGGGCCAGGCTGG + Intronic
1049655285 8:143794477-143794499 GTGGTGGTGAGGGGCCAGGCAGG - Intronic
1049797673 8:144504029-144504051 CAGTGGGTGAGGTGGCAGGCGGG - Intronic
1050412899 9:5384809-5384831 CTGTGTGTGAGGGGCTATGCTGG - Intronic
1051508518 9:17851530-17851552 CTCTGAATGAGGAGCCTGGCTGG + Intergenic
1051595922 9:18824344-18824366 GTGTGTAAGAGGGGCCAGGTTGG - Intronic
1053135681 9:35649173-35649195 CTGGGGATGAGGGGCCAAGAGGG - Intergenic
1053477821 9:38394681-38394703 CTGGGGGTGAAGGGACAGGCAGG + Intronic
1053653327 9:40191434-40191456 CTGTGGCTGGGGAGACAGGCAGG - Intergenic
1053903729 9:42820724-42820746 CTGTGGCTGGGGAGACAGGCAGG - Intergenic
1056102738 9:83315441-83315463 CGTTGGAGGAGGGGCCTGGCGGG + Intronic
1057396917 9:94688845-94688867 CTGGGGAAGAGGGGCAAGGATGG + Intergenic
1057552381 9:96061427-96061449 TTGTGGTTGAGGGACCAGGAGGG - Intergenic
1058904075 9:109467356-109467378 CTGGGGGTGCGGGGACAGGCAGG - Intronic
1059234081 9:112747631-112747653 GTGTGCATGAGGGGCGAGGGAGG - Intergenic
1059394519 9:114025923-114025945 CTGTGCATGGCGGGCAAGGCTGG + Intronic
1059429714 9:114242566-114242588 CTCGGGCTGAGGGCCCAGGCAGG - Intronic
1059452018 9:114376614-114376636 TTGAAGATGAGGGGCCTGGCAGG + Exonic
1059691186 9:116687435-116687457 CCGTGGCTCAGCGGCCAGGCGGG + Intronic
1060027280 9:120183846-120183868 CTGTATGTGAGGAGCCAGGCAGG + Intergenic
1061328628 9:129878930-129878952 CTGTGGCTCCGGGGCCCGGCAGG + Intronic
1061444198 9:130628575-130628597 CTGGGGATGAGGGGCCCAGTGGG + Intronic
1061917034 9:133760666-133760688 CTGAGGATGAGGGATCAGGAAGG + Intergenic
1061955032 9:133956858-133956880 CTGTGGGGGACAGGCCAGGCAGG + Intronic
1062010201 9:134263081-134263103 CAGTGGTGGAGTGGCCAGGCTGG + Intergenic
1062034194 9:134375548-134375570 GTGTGGATGATCGGCCTGGCGGG + Intronic
1062218202 9:135400349-135400371 CTGGGGATGGGGTGCCAGGTTGG - Intergenic
1062464876 9:136676526-136676548 CTGGGGAGGCGGGGTCAGGCTGG - Intronic
1187066759 X:15847956-15847978 CTGTGGATAAGGAGCGAGGATGG - Intronic
1187147019 X:16646234-16646256 CGGTGGTTGAGGGTGCAGGCTGG + Intronic
1188416238 X:29938463-29938485 CTGTAGATAAGGGCCCAGGCAGG - Intronic
1189975561 X:46458596-46458618 CTGTGGATGAGAGTACTGGCTGG + Intronic
1190216285 X:48481533-48481555 GTGGGGTGGAGGGGCCAGGCAGG + Intronic
1190239656 X:48647603-48647625 CTGGAGAGGAGAGGCCAGGCAGG + Intergenic
1190260775 X:48795486-48795508 CTGTGGGTCAGGCGGCAGGCTGG + Intergenic
1192543554 X:71994791-71994813 CTGGTGATGGGGGGCCAGCCAGG + Intergenic
1192626595 X:72734946-72734968 CTATGGGTGAGGGGTCATGCAGG - Intergenic
1192705119 X:73521047-73521069 CAGTGGATGAGGGTTCAGGAAGG + Intergenic
1193152625 X:78140402-78140424 CTGTGGGTGAGGGGCTGGGAAGG - Intergenic
1196221085 X:113112839-113112861 TTGTGACTGAGGGGACAGGCAGG + Intergenic
1196990848 X:121327023-121327045 CTGTGGATTAGGGGCCATGCTGG + Intergenic
1198083981 X:133265689-133265711 CTGCGGAGGAGGGGACAGCCCGG + Intergenic
1200101217 X:153689807-153689829 GTGCGGAAGAGGGGCCAGGCCGG - Intronic
1201540859 Y:15103268-15103290 ATGTGGGTGAAGGGTCAGGCAGG + Intergenic