ID: 1144794673

View in Genome Browser
Species Human (GRCh38)
Location 17:17882948-17882970
Sequence TCCCCAAGGCTGCCCACGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 117}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144794667_1144794673 -5 Left 1144794667 17:17882930-17882952 CCCACCCCATGCAGCACTTCCCC 0: 1
1: 0
2: 3
3: 36
4: 334
Right 1144794673 17:17882948-17882970 TCCCCAAGGCTGCCCACGAAAGG 0: 1
1: 0
2: 0
3: 17
4: 117
1144794668_1144794673 -6 Left 1144794668 17:17882931-17882953 CCACCCCATGCAGCACTTCCCCA 0: 1
1: 0
2: 2
3: 37
4: 389
Right 1144794673 17:17882948-17882970 TCCCCAAGGCTGCCCACGAAAGG 0: 1
1: 0
2: 0
3: 17
4: 117
1144794666_1144794673 -4 Left 1144794666 17:17882929-17882951 CCCCACCCCATGCAGCACTTCCC 0: 1
1: 0
2: 5
3: 38
4: 425
Right 1144794673 17:17882948-17882970 TCCCCAAGGCTGCCCACGAAAGG 0: 1
1: 0
2: 0
3: 17
4: 117
1144794664_1144794673 7 Left 1144794664 17:17882918-17882940 CCTGGTACCTACCCCACCCCATG 0: 1
1: 0
2: 2
3: 23
4: 267
Right 1144794673 17:17882948-17882970 TCCCCAAGGCTGCCCACGAAAGG 0: 1
1: 0
2: 0
3: 17
4: 117
1144794669_1144794673 -9 Left 1144794669 17:17882934-17882956 CCCCATGCAGCACTTCCCCAAGG 0: 1
1: 1
2: 0
3: 19
4: 254
Right 1144794673 17:17882948-17882970 TCCCCAAGGCTGCCCACGAAAGG 0: 1
1: 0
2: 0
3: 17
4: 117
1144794671_1144794673 -10 Left 1144794671 17:17882935-17882957 CCCATGCAGCACTTCCCCAAGGC 0: 1
1: 1
2: 0
3: 18
4: 187
Right 1144794673 17:17882948-17882970 TCCCCAAGGCTGCCCACGAAAGG 0: 1
1: 0
2: 0
3: 17
4: 117
1144794665_1144794673 0 Left 1144794665 17:17882925-17882947 CCTACCCCACCCCATGCAGCACT 0: 1
1: 0
2: 10
3: 61
4: 599
Right 1144794673 17:17882948-17882970 TCCCCAAGGCTGCCCACGAAAGG 0: 1
1: 0
2: 0
3: 17
4: 117
1144794661_1144794673 30 Left 1144794661 17:17882895-17882917 CCTGGGCTGCCTGCATAGCTGGA 0: 1
1: 0
2: 1
3: 42
4: 349
Right 1144794673 17:17882948-17882970 TCCCCAAGGCTGCCCACGAAAGG 0: 1
1: 0
2: 0
3: 17
4: 117
1144794663_1144794673 21 Left 1144794663 17:17882904-17882926 CCTGCATAGCTGGACCTGGTACC 0: 1
1: 0
2: 0
3: 8
4: 98
Right 1144794673 17:17882948-17882970 TCCCCAAGGCTGCCCACGAAAGG 0: 1
1: 0
2: 0
3: 17
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144794673 Original CRISPR TCCCCAAGGCTGCCCACGAA AGG Intronic
902116352 1:14124880-14124902 TCCCCAGTGCTGCCCCCGACAGG - Intergenic
902881734 1:19376043-19376065 TCCCCAAGGCTGGCCCTAAATGG + Intronic
903323179 1:22554578-22554600 TCCCCAGTGCTGCAAACGAACGG - Intergenic
906711634 1:47934542-47934564 TCCCCAAAGCTGCTCACGCGAGG - Intronic
915299156 1:154942134-154942156 TCCCCAAGTTTGCCCAAGTAGGG - Intergenic
915556644 1:156664503-156664525 TCTCTAAGGCTGCCCATGGAAGG - Intergenic
916232826 1:162557126-162557148 TCCCCAAGGCTGCTTATAAAAGG + Intergenic
921047019 1:211484983-211485005 TCCCTAAGCCTGACCTCGAAGGG + Intronic
922464948 1:225840117-225840139 ACCCCAATGCTGCCCACAGAAGG + Intronic
922505523 1:226123395-226123417 TCCCCAAGCCTGCCCACTGATGG + Intergenic
923008645 1:230071365-230071387 TCCCGATGGCTGCCCACTACTGG - Intronic
1062925531 10:1313195-1313217 TCCCCAAAGCTGTCCCCCAATGG - Intronic
1067222487 10:44353934-44353956 TCCCCATGGCTGCCCATGGCAGG + Intergenic
1067530909 10:47072063-47072085 TCCCCATGGCCCCCCACCAATGG + Intergenic
1069636892 10:69930438-69930460 TCCCCAAGGCCCCCCAGGAAAGG + Exonic
1070098906 10:73366695-73366717 TCCACAAGGCAGCCCAGCAAGGG + Intergenic
1073333006 10:102683260-102683282 TCCCCAAAGGTTACCACGAAAGG + Intronic
1073480247 10:103782004-103782026 TCCCAGAGGCTGCCCAGGAATGG - Intronic
1073906923 10:108292709-108292731 TCCCCAAAACTGCCCAAGACAGG + Intergenic
1075950517 10:126473620-126473642 TCCCCCAGGCTGCCCACCTCTGG + Intronic
1076491548 10:130865109-130865131 TTCCCAGGGCTGCCCAAGACAGG + Intergenic
1076884513 10:133255586-133255608 TCCCCGTGGCTGCCCAAGCAGGG - Intergenic
1077443430 11:2579181-2579203 TCCTCAAGGCTGGCCTCGAGGGG - Intronic
1078376308 11:10796122-10796144 TGCCCAACCCTCCCCACGAAGGG - Intergenic
1082086851 11:48057512-48057534 TACCCAAGGCTGCCCGTGACTGG - Intronic
1083361152 11:62109216-62109238 TCCCCAAAGCAGCCAACGACTGG + Intergenic
1085203115 11:74713631-74713653 TCCCCATTCCTGCCCACCAAGGG + Intronic
1090004167 11:122985019-122985041 GCCCCAGGGCTGCCCAGGGAAGG + Intergenic
1091207870 11:133833409-133833431 TCCCCAGGCCGGCCCGCGAAGGG + Intergenic
1092046027 12:5432363-5432385 TCCCCAAACCTGCCCACCCAAGG - Intronic
1092755162 12:11756552-11756574 CCCCCAAGGGTGCCCAGGCAAGG + Intronic
1096715246 12:53487209-53487231 TCCCCCACCCTGCCCACCAAGGG + Exonic
1102016032 12:109648607-109648629 TCCCCAGGGCTGGACACGAGGGG + Intergenic
1102493967 12:113306528-113306550 TCGCCAGGGCTACCCACGGATGG - Exonic
1103480088 12:121245176-121245198 TCCCGCCGGCTGCCCTCGAATGG + Exonic
1105503036 13:20988902-20988924 TACGCCAGCCTGCCCACGAAGGG - Exonic
1105785157 13:23740949-23740971 TGTCCAAGGCTGCCCAGGAGAGG + Intronic
1106214787 13:27686395-27686417 TACCCAAGGCTGCCCACCCTAGG + Intergenic
1110357249 13:74581342-74581364 TCCCCAAAGCTTTCCATGAATGG - Intergenic
1117245815 14:53885824-53885846 TCCCCAAGGCAGCAAAGGAACGG + Intergenic
1119535056 14:75396116-75396138 TCCCCAGGGAAGCCCAGGAAGGG - Intergenic
1124594089 15:31079468-31079490 TCTCCAGGGCAGCTCACGAAGGG + Intronic
1127291943 15:57579060-57579082 TCCCCCAGGATGCCCACTCATGG + Intergenic
1128984333 15:72208194-72208216 TCCACATGGCTCCCCAGGAAGGG + Intronic
1131985651 15:98040924-98040946 TCTCCAGGGCTGCCCAGGAGAGG - Intergenic
1132407097 15:101549851-101549873 TCCCGTAGGCTGCCCTGGAAAGG + Intergenic
1133281960 16:4671684-4671706 TCCCCAGGGCAGCCCAGGAATGG + Intronic
1138263307 16:55641169-55641191 TCCCCCAGGCTGGGCCCGAATGG - Intergenic
1140584832 16:76277234-76277256 GCCCCAAGGAGGCCCACGAACGG + Intergenic
1141757109 16:85998578-85998600 TCCCAAAGGCCGCTCAGGAAAGG - Intergenic
1143736821 17:8916798-8916820 TTCCCAAGGCAGCCCACGATGGG + Intronic
1143855261 17:9843544-9843566 TCCCCATGGCTTCCCAGGAAAGG + Intronic
1144029116 17:11304081-11304103 TACCCAAAGCTTCCCAGGAAAGG - Intronic
1144794673 17:17882948-17882970 TCCCCAAGGCTGCCCACGAAAGG + Intronic
1146946687 17:36878156-36878178 TCCCCACCCCTGCCCACCAACGG - Intergenic
1148830370 17:50426757-50426779 TCCCCAAGTTTGCCCATGAAGGG - Intronic
1150655824 17:67038695-67038717 TCCCCAAGGCTGCCCTCAAGTGG + Intergenic
1151547008 17:74799380-74799402 GTCCCAGGGCAGCCCACGAAGGG - Intronic
1151950529 17:77351175-77351197 TTCCCAAGGCTGCACATGGAGGG + Intronic
1152044809 17:77928968-77928990 TCCCCCAGGCTGCTGTCGAAGGG + Intergenic
1152904559 17:82963135-82963157 CCCCCAAGGCTGCCCGAGGATGG - Intronic
1153521538 18:5958901-5958923 TCCTCAAGTCTGTCCACGTAGGG - Intronic
1163127580 19:15252587-15252609 ACCCCATGGCTGCCCAGGAAGGG - Intronic
1163590770 19:18193101-18193123 TCCCCGAGGCTGCCTGCGATTGG + Intergenic
1164989376 19:32673559-32673581 TCTCCAAAGCTTCCCCCGAAGGG + Intronic
1165891000 19:39112182-39112204 TCCCCAATCCAGCCCAAGAAGGG - Intergenic
1166198345 19:41220656-41220678 TTCCCTGGGTTGCCCACGAAGGG - Exonic
924993621 2:337825-337847 GTCCCAAGGCTGCACACAAAAGG - Intergenic
926243481 2:11105194-11105216 TTCCCAAGGCTGCTCATCAATGG - Intergenic
927865449 2:26584785-26584807 TCCCCAGGGCTCCCCACGGCCGG - Intronic
933715282 2:85355268-85355290 TCCCCCAGGTTCCCCACGGATGG - Intronic
933775669 2:85769831-85769853 GCCCCTAGGGTGCCCACCAAGGG + Intronic
942516546 2:176759679-176759701 TCCTGCAGGCTGCCCAAGAATGG + Intergenic
944903454 2:204239260-204239282 TGCCCAAGGCTGCACAATAATGG + Intergenic
948752475 2:240140429-240140451 TCCCCAGGGCTGCCCACACTGGG - Exonic
1171972373 20:31572505-31572527 TCTCCAATGCTGCCCCCAAAAGG - Intronic
1172559215 20:35871014-35871036 TCCTCCAGGCTGTCCACTAATGG + Exonic
1174549266 20:51349887-51349909 TCCTAAAGGCTGCCCCAGAAAGG - Intergenic
1178604760 21:34026033-34026055 TCCCCAAGCCTGGCTACGCAGGG + Intergenic
1180183762 21:46129540-46129562 TTCCCAGGGCTGCCCCCGACAGG + Intronic
1180604475 22:17046517-17046539 CCCCCAAGGTTGCCCAGGTAAGG - Intergenic
1180693366 22:17736598-17736620 TTCACAATGCTGCCCAAGAAGGG - Intronic
1182472568 22:30557454-30557476 CCCCCAAGGCTGCCCAGGCCTGG + Intronic
1182559365 22:31147726-31147748 TGCCCAAGGCTGCCCAGGAGGGG - Intergenic
1183870334 22:40736971-40736993 GCCCCAAGGCTGCCCAGGCCCGG - Intergenic
1185347795 22:50318008-50318030 TCTCCAAGGCAGCCTAAGAAGGG + Exonic
949536765 3:5002409-5002431 TCCCCAAGTCAGCCCAAGCATGG + Intergenic
952357687 3:32599928-32599950 TCCCCAATGCTGACCAGGCATGG - Intergenic
961666559 3:128496605-128496627 TCCCGGAGGCTGCCCGAGAATGG + Intergenic
961945754 3:130685759-130685781 TCCTCAAAGCTGCCCTTGAAAGG + Intronic
963853933 3:150235123-150235145 TCCCAAAGACTTCCCACAAAGGG - Intergenic
967171547 3:186826544-186826566 TCCCCAAGGCTGCTCCAGCAGGG + Intergenic
968422871 4:499787-499809 ACCCAAAGGCTGCTCAGGAAAGG - Intronic
968486754 4:866645-866667 ACCCCACGGCTGCCCTCGCAGGG + Intronic
968574696 4:1360162-1360184 TCCCAAGGGCTGCCCACGGGGGG + Intronic
968760981 4:2442733-2442755 TCCCCACGGCAGCCCACCCAGGG + Intronic
969350040 4:6593205-6593227 TCCCCAAGCCTCCCCAAGATGGG + Exonic
969845688 4:9918436-9918458 TCCCCATGGCTGCCTAGGGATGG + Intronic
971072480 4:23110618-23110640 TCCCCAAGTGTGCCAAAGAAAGG - Intergenic
972174504 4:36386792-36386814 TCCCCAAGGCTCCCCATGGAAGG - Intergenic
985085184 4:186305997-186306019 TTCCCAACTCTGCCCACGGAAGG + Intergenic
985492211 5:186678-186700 TCCCCAGCCCTGCCCAGGAAGGG + Exonic
989320020 5:40123015-40123037 TCCCCAAAGCTACCCACAAAAGG - Intergenic
991943497 5:71877667-71877689 TCCACAAGGCTGCTCACCAAAGG + Intergenic
999431739 5:151530968-151530990 TCCCCATGGCTCCCCTGGAATGG - Intronic
1001416125 5:171545737-171545759 TCCCCAAGGCCGCTCAACAAGGG - Intergenic
1005807552 6:29488603-29488625 TACCCAAGGATGCCCAGGACTGG - Intergenic
1005834116 6:29695081-29695103 TCCCCAAGCCTGCCCCACAATGG + Intergenic
1010694148 6:78949306-78949328 TCACTAAGACTGCCCAGGAAGGG - Intronic
1010735247 6:79436772-79436794 TCCTCAAGGCTGCTCACCATAGG - Intergenic
1016250750 6:142038965-142038987 TCCCGAAGGAGGGCCACGAAGGG + Intergenic
1019395936 7:817478-817500 TCCCCAGGGCTCCCCAGGACAGG + Intronic
1021050122 7:15972919-15972941 TCCCCAAGGCAACCCAGCAAAGG + Intergenic
1022537747 7:31108344-31108366 TCACCAAGCATGCCCAGGAAAGG - Exonic
1023757569 7:43433915-43433937 CCCCCAAGGATGCCCAGGATTGG + Intronic
1023842827 7:44106629-44106651 TCCCCCAGGCCGCCCAAGAAGGG + Exonic
1023982190 7:45076684-45076706 TCACACACGCTGCCCACGAAAGG - Intergenic
1024197575 7:47074024-47074046 TCCCCAAAGCTGCCCAGGTCAGG - Intergenic
1034435744 7:151062073-151062095 CACCCAAGGCTGCCCAGGGAGGG - Intronic
1035285465 7:157803373-157803395 TCCAGAGGGCAGCCCACGAAAGG - Intronic
1038006451 8:23434560-23434582 GCCCCAAGGCTGCCCACAGAGGG - Intronic
1045649490 8:104328858-104328880 CCCCCAGGGCTGCCTACAAAGGG + Intergenic
1048419717 8:134265679-134265701 TCCACAAGGCTGCCATCCAATGG - Intergenic
1049039401 8:140100602-140100624 GCCCCAATGGTGCCCAGGAAGGG - Intronic
1050210776 9:3253521-3253543 TCTCCAATTCTGCCCAAGAAAGG + Intronic
1051604739 9:18908247-18908269 TCCCCAAGGCTGCCAACAGCAGG - Intronic
1058914987 9:109557036-109557058 TCCCCAATGCTGTCCAGGTATGG - Intergenic
1059392336 9:114007130-114007152 TCCCCAAGGCTGCTCATCACCGG + Intronic
1062022825 9:134327172-134327194 TCCCCAAAGCAGCCCACGCCCGG + Intronic
1062512447 9:136914233-136914255 TCCCCCAGGCTGCCCACGGCAGG - Intronic
1062570476 9:137182787-137182809 TCCCCAAGGCCGACCAGGCAAGG - Intronic
1187018086 X:15350434-15350456 TCTCCAAGGCAGCCAATGAACGG + Intronic
1189345468 X:40237878-40237900 TACCCACGGATGCGCACGAAGGG - Intergenic
1195753730 X:108180776-108180798 TCCCCAAGGCTGCCCTCAGGAGG + Intronic
1200166347 X:154038257-154038279 TCCCCAAGGCTGTCCCCCAGGGG + Intronic