ID: 1144795695

View in Genome Browser
Species Human (GRCh38)
Location 17:17889596-17889618
Sequence CCTCACAGGCAGGAGGTGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 218}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144795685_1144795695 -5 Left 1144795685 17:17889578-17889600 CCAGGACCCCCAACCATGCCTCA 0: 1
1: 0
2: 1
3: 36
4: 274
Right 1144795695 17:17889596-17889618 CCTCACAGGCAGGAGGTGTTAGG 0: 1
1: 0
2: 1
3: 27
4: 218
1144795682_1144795695 13 Left 1144795682 17:17889560-17889582 CCATGGGTTCTACCTCTGCCAGG 0: 1
1: 0
2: 1
3: 18
4: 256
Right 1144795695 17:17889596-17889618 CCTCACAGGCAGGAGGTGTTAGG 0: 1
1: 0
2: 1
3: 27
4: 218
1144795684_1144795695 1 Left 1144795684 17:17889572-17889594 CCTCTGCCAGGACCCCCAACCAT 0: 1
1: 0
2: 2
3: 30
4: 283
Right 1144795695 17:17889596-17889618 CCTCACAGGCAGGAGGTGTTAGG 0: 1
1: 0
2: 1
3: 27
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144795695 Original CRISPR CCTCACAGGCAGGAGGTGTT AGG Intronic
900972846 1:6001018-6001040 CCTCACAGGCAGGGAGAGTGGGG + Intronic
902255977 1:15188845-15188867 GATCACAGCCAGGAAGTGTTGGG + Intronic
902617248 1:17630522-17630544 CCTAACATGCAGGAGGACTTGGG - Intronic
904694653 1:32322221-32322243 AGTCAGAGGCAGGAGGTGTGGGG - Intronic
906712765 1:47943885-47943907 CCTGGCAGGCAGTAGGTGTGTGG - Intronic
906946577 1:50299863-50299885 CTGCACAGTCAGGAGATGTTCGG + Intergenic
907936148 1:59044032-59044054 CCTCACAGGCATGAGATATCTGG + Intergenic
910092901 1:83486651-83486673 CCTTGGAGGCAGGAGGGGTTGGG - Intergenic
910208905 1:84774584-84774606 ACTCACAGGCAGCAGCTGTGAGG + Intergenic
910855719 1:91693339-91693361 CATCACAGGAGGGAGGTCTTTGG + Intronic
915626708 1:157118378-157118400 CCTCACAGGCAGTAAGTGGCAGG + Intergenic
916786956 1:168093269-168093291 CCTTACAAGCAGAAGGTATTTGG + Intronic
916850789 1:168701259-168701281 CTTCACAGCCTGGAGTTGTTTGG - Intronic
917069471 1:171134417-171134439 CCTCACAGTCAGGAAATGATGGG - Intergenic
918452268 1:184670882-184670904 CCTCAAAAGCAGGAAGGGTTGGG - Intergenic
920054465 1:203182244-203182266 CCTCACAGGCATGAGGGGTGGGG + Intronic
923345432 1:233047005-233047027 CTTCACAGCCAGGTGGTGTTCGG - Intronic
924368356 1:243320528-243320550 CGTCAAAGGCAGGAGGGCTTAGG + Intronic
1063150683 10:3333615-3333637 CCTGAGAGGCAGGAGCTGGTGGG + Intergenic
1063546603 10:6987597-6987619 CCTCACGGGCAGGAGGTACCTGG - Intergenic
1063733836 10:8729971-8729993 TCTCATAGGCAGGAAGAGTTGGG + Intergenic
1064107572 10:12513010-12513032 CCTCACGAGCAGGAGAGGTTTGG + Intronic
1067243448 10:44516480-44516502 ACAGACAGGCTGGAGGTGTTAGG - Intergenic
1067764048 10:49071815-49071837 CCACACATGCAGGAGGGGTTGGG + Intronic
1069848506 10:71390089-71390111 TCTCACAGCCAGGATGTGCTGGG + Intergenic
1069860376 10:71467509-71467531 CCTCACAGGCTGGTGGTGCTGGG - Intronic
1070256132 10:74814265-74814287 CCTCGCAGGCTGGAGATGGTGGG + Intergenic
1070333590 10:75435074-75435096 CCACACAGGGTGGAGGTCTTAGG + Intronic
1070618510 10:77988071-77988093 ACTGACAGCCAGGATGTGTTGGG - Intronic
1070730942 10:78827964-78827986 CATCACAGGCTGGAGGTGGAGGG - Intergenic
1071264219 10:83949856-83949878 ACTCACAGGCAGAAGGTGAAGGG - Intergenic
1072993928 10:100226558-100226580 AGTCACAGGCAAGAGATGTTAGG - Intronic
1075046500 10:119150348-119150370 CCTGGCAGGCAGGAGGTGCTGGG + Intronic
1075734262 10:124654438-124654460 GCTCCCAGGGAGGTGGTGTTTGG + Intronic
1075938727 10:126369476-126369498 CCTCACAGGCAGCCGGTTCTTGG - Intronic
1076175194 10:128362911-128362933 CCACACAGGCAGGAGATGATGGG + Intergenic
1077236390 11:1483955-1483977 CTTCACAGGCAGGGGGAGCTGGG + Intronic
1081228156 11:40551041-40551063 CCTGACTGGGAAGAGGTGTTAGG - Intronic
1081236355 11:40652111-40652133 CCTAACAGTCAGGAGGTGCACGG - Intronic
1081659907 11:44881723-44881745 GCACACAGGTAGGAGGTGGTTGG + Intronic
1083649404 11:64192668-64192690 CCTCACAGGAAGAAGGTGGGCGG - Intronic
1085126398 11:74005421-74005443 CACCACAGGCAGGATGTGGTAGG - Intronic
1087176407 11:95100104-95100126 CTTCATAGACATGAGGTGTTTGG + Intronic
1088653682 11:111979042-111979064 CCAAACAGGCAGGAGGGGTAGGG - Intronic
1088755037 11:112878627-112878649 CCTCTCGGGCAGGAGGGCTTTGG + Intergenic
1089288096 11:117420416-117420438 CCACAGAGGCAGGACGTCTTAGG + Intergenic
1089707929 11:120294022-120294044 CCTCATAGCCAGGAGGTGTGAGG - Intronic
1094141963 12:27190589-27190611 CTTCACTGGAAGAAGGTGTTTGG + Intergenic
1096542404 12:52315123-52315145 CCTCACAGCCTGAATGTGTTGGG - Intronic
1099229664 12:80007532-80007554 GCTCTCTGGCATGAGGTGTTTGG + Intergenic
1101998969 12:109544910-109544932 CTTCACAGGCAGGAGGAAGTGGG - Intergenic
1102485335 12:113251667-113251689 CCTAACAGGCAGGAGGGCTGTGG - Intronic
1102522431 12:113486920-113486942 CCACAGAGGCAGCAGGTGTAGGG - Intergenic
1102906732 12:116682059-116682081 CCCCACAGGCATGCTGTGTTGGG + Intergenic
1102999869 12:117377071-117377093 CCTCACAGCAAGGAAGTGTTGGG - Intronic
1108030860 13:46228168-46228190 CCTCACAGGCAGTCTGTGATAGG + Exonic
1108629414 13:52267012-52267034 CCTGTCAGGAAGGAGGGGTTGGG - Intergenic
1108656641 13:52539476-52539498 CCTGTCAGGAAGGAGGGGTTGGG + Intergenic
1109602141 13:64644887-64644909 CCTCACATGCTATAGGTGTTAGG - Intergenic
1113667319 13:112149732-112149754 CCTCACAGGGGGAAGGTGGTGGG - Intergenic
1114985237 14:28218118-28218140 CCACACAGGGAGGAGGCATTTGG - Intergenic
1116427936 14:44812795-44812817 GCTCACAGGCATGACCTGTTTGG - Intergenic
1118075698 14:62296158-62296180 CCTCACATGAAGGAGAAGTTTGG + Intergenic
1119700671 14:76752488-76752510 CATCACAGGCAGGCTGGGTTAGG - Intergenic
1121850555 14:97218478-97218500 CATCACCAGCAGCAGGTGTTTGG - Intergenic
1122129433 14:99596584-99596606 CCTCACAGGCAGAGGGTTCTGGG - Intronic
1122703330 14:103604997-103605019 CCTGGCACGCAGGAGGTATTCGG - Intronic
1125261022 15:37824833-37824855 TCCCACCGGCAGGAGGTGTCTGG + Intergenic
1127776780 15:62270207-62270229 CCCAACAGGGAGGAGTTGTTGGG - Intergenic
1129241394 15:74254404-74254426 CCTCACTGACCAGAGGTGTTTGG - Intronic
1132950308 16:2558062-2558084 CCTTCCAGGCAGGAGGTCTCAGG + Intronic
1132964040 16:2642108-2642130 CCTTCCAGGCAGGAGGTCTCAGG - Intergenic
1135657735 16:24266276-24266298 CACCACAGGCAGCTGGTGTTGGG + Intronic
1137546901 16:49411008-49411030 CCCCACAGGCAGGTGGGGCTTGG - Intergenic
1138336736 16:56259301-56259323 CCTTGCACTCAGGAGGTGTTGGG + Intronic
1138507537 16:57485828-57485850 CCCCATAGGCAGGAGGGGGTCGG + Intronic
1138577466 16:57917242-57917264 AGTCACAGGCAGGTGGTGTTGGG - Intronic
1139939670 16:70596163-70596185 CCTCAGAGGCAGGAGGGGTGAGG + Intronic
1141970707 16:87480629-87480651 ACCCAGGGGCAGGAGGTGTTGGG - Intronic
1143265720 17:5635663-5635685 CCTTCCAGGAAGGAGGTGTGAGG - Intergenic
1144358065 17:14464640-14464662 GAACACAAGCAGGAGGTGTTTGG + Intergenic
1144795695 17:17889596-17889618 CCTCACAGGCAGGAGGTGTTAGG + Intronic
1145959468 17:28879100-28879122 CATCACAGGCAGAAGGTGGAGGG - Intergenic
1146550665 17:33777775-33777797 CCTCCCAGGTAGCAGGTGTGCGG + Intronic
1147165625 17:38591699-38591721 CCTTCCAGGCAGGAGGAGTCAGG - Intronic
1148144714 17:45355876-45355898 CCTCAGAGCCAGGAGGTGAGAGG - Intergenic
1148896958 17:50844412-50844434 CCTAGCAGGCTGGAGGTGCTGGG - Intergenic
1150464219 17:65378123-65378145 AATCACATGCAGGAGGTTTTGGG - Intergenic
1150479685 17:65499614-65499636 TCTCAGAGGTAGGAGATGTTGGG + Intergenic
1151530765 17:74703313-74703335 CCTCATAGGCAGGTGGGGCTGGG + Intronic
1151700986 17:75742518-75742540 CCACACAGGCGGGAGGTGCGAGG - Intronic
1154202705 18:12310024-12310046 CCTAACAGGAAAGAGGTGTCAGG + Intronic
1157388005 18:47276155-47276177 CCTTGCAGGCAGGAATTGTTGGG + Intergenic
1157404407 18:47410886-47410908 CCACACAGACAGGAGGGGGTTGG + Intergenic
1158413715 18:57231191-57231213 CCTCACAGAGGGGAGGTGTTTGG - Intergenic
1160418916 18:78731062-78731084 CCTCACAGACAGGCGGTGGGAGG - Intergenic
1160819241 19:1050007-1050029 GCTCACAGGGAGGAAGTGGTGGG - Intronic
1160871869 19:1281419-1281441 CCTCAAAGGCGGGATGCGTTGGG + Intergenic
1161114522 19:2489201-2489223 CCGCCCCGGCAGGAGGGGTTGGG + Intergenic
1161414005 19:4134496-4134518 CCTGACACACGGGAGGTGTTTGG + Intergenic
1161675302 19:5643944-5643966 CCTCACTTGCAAGAGGTTTTCGG + Intronic
1161907960 19:7171466-7171488 ACTCATAGGCAGGAGGTCTGTGG - Intronic
1162055655 19:8062374-8062396 CCAGACGGGCAGGAGGTGGTGGG - Exonic
1162738225 19:12758289-12758311 CCTCTCAGGCAGTGGGGGTTGGG - Exonic
1164877025 19:31698455-31698477 CCACACAGGCAGGCTGGGTTTGG + Intergenic
1165175887 19:33929478-33929500 GCTCAGAGGCAGCCGGTGTTAGG - Intergenic
1165819706 19:38666633-38666655 TCTCAGAGGCAAGAAGTGTTTGG - Intronic
1166210039 19:41300649-41300671 CCCGACATGAAGGAGGTGTTCGG + Intronic
1168138733 19:54370182-54370204 CCTCCCAGGCAGGAAGGGTGGGG - Intronic
1168159295 19:54498315-54498337 CCTCCCAGGCAGGAAGGGTGGGG + Intronic
1168340055 19:55617560-55617582 CCTGGCAGGCAGGAGGTCTCCGG - Exonic
1168428072 19:56255566-56255588 GGTCACAGGCAAGAGGGGTTTGG - Intronic
925111396 2:1341411-1341433 CCTCACAGAAAGGAGGAGTGGGG + Intronic
925455201 2:4010179-4010201 CCTCACAGGCAGGACTTCATGGG - Intergenic
931333269 2:61311248-61311270 CCTCACAGGCAGAGGGTGGAAGG - Intronic
932232533 2:70094595-70094617 TCTCACTGGCAGGAGGTGGCAGG - Intergenic
932731357 2:74224399-74224421 CCAGACAGGCAGGAGGGGCTGGG - Intronic
935636653 2:105254318-105254340 CCTCACAGGCAGGCTGTGTCAGG + Intergenic
937232298 2:120405278-120405300 CCTCACACGCAGTAGGTGCCTGG + Intergenic
938383724 2:130850534-130850556 CCTTGCAGGGGGGAGGTGTTGGG - Intronic
939118486 2:138088549-138088571 CTTCACAGCCAGGAGGTTTGGGG - Intergenic
941654673 2:168130481-168130503 CCTCAGAGGCAGGTCCTGTTAGG + Intronic
942631063 2:177949748-177949770 ACTCAAAGGAAGGAGCTGTTGGG + Intronic
943777450 2:191781895-191781917 GCTCACAGGAAGGAGGTGAAGGG + Intergenic
943880585 2:193139902-193139924 GCTCACAGGCAGAAGGGGCTTGG - Intergenic
945041872 2:205749234-205749256 CCTCACTTACAGTAGGTGTTTGG + Intronic
945529668 2:210935665-210935687 CCACAGAGGTAGGAGGTATTTGG - Intergenic
946170075 2:217889902-217889924 CATCAGGGGCAGGAGGTCTTTGG - Intronic
946979434 2:225192079-225192101 TCTCACAGGTAGCAGGTGGTGGG + Intergenic
947563583 2:231178976-231178998 TCTCACCTGCATGAGGTGTTAGG - Intergenic
947634510 2:231673270-231673292 CCTCGGAGGAAGGAGGCGTTTGG + Intergenic
947704321 2:232262152-232262174 CTTAACATGAAGGAGGTGTTAGG + Intronic
1168970363 20:1926735-1926757 CCTCACAGCCAGGAGGTGGTGGG + Intronic
1171517812 20:25751369-25751391 CCTCGCAGGCAGGAGAGGTTTGG + Intergenic
1172180930 20:33003029-33003051 AATCACAGGCTGGTGGTGTTGGG - Intronic
1174140001 20:48406059-48406081 CTTCACCAGCAGGAGGAGTTGGG + Intergenic
1174575015 20:51531150-51531172 CCTGCCTGGCAGGAGATGTTTGG - Intronic
1175065119 20:56277576-56277598 CTTCAGAGGCAGGAAGTGTTTGG - Intergenic
1175475092 20:59266826-59266848 CCTTTCAGGAAGGAGGGGTTGGG + Intergenic
1175636725 20:60590575-60590597 CATCACAGGCACCAGGTGTGTGG - Intergenic
1179043765 21:37827972-37827994 CCTCACAGCTAGGAGGTGGCTGG + Intronic
1179808539 21:43855320-43855342 CTTCCCAGGCAGGAGGGGTGTGG + Intergenic
1180219296 21:46347881-46347903 CCACACAGGGAGGAGGTTTTGGG + Intronic
1180986876 22:19910159-19910181 CCCCACAGGCAGGAGCTGCCTGG + Intronic
1181625644 22:24120445-24120467 TCTCTCACCCAGGAGGTGTTGGG + Intronic
1182786365 22:32911194-32911216 CCACACAGAAAGGAGGTATTTGG + Intronic
1183489721 22:38109897-38109919 CCTCACAGGTGGGTGGTGTGAGG + Intronic
1183505603 22:38207065-38207087 CCACACAGGGAGGAGGTGTGTGG + Intronic
1184087225 22:42272115-42272137 CCTGGCATGCAGGAGGTGTTGGG - Intronic
952759778 3:36903716-36903738 CCTCACAGGCAGGAGTCTGTGGG - Intronic
954646222 3:52133203-52133225 CCTCACATGCAGAAGGTGGAAGG - Intronic
954647182 3:52138730-52138752 CCACACAGGAAGGACGTGTGTGG + Intronic
960608187 3:119529640-119529662 CCACACACGTAGGAGGTGTCCGG + Intronic
960640348 3:119817174-119817196 CCCCTCATGCAGGAGTTGTTCGG + Exonic
960810258 3:121621514-121621536 ATTACCAGGCAGGAGGTGTTGGG - Exonic
961452120 3:127006931-127006953 CCTCAGAGACAGGAGGTGCGTGG + Intronic
961464517 3:127073120-127073142 CCTCAGAGGCTGGAGGAGTCTGG - Intergenic
968708192 4:2093490-2093512 CCACACAGTCAGGAGCTGATAGG + Intronic
968732063 4:2273870-2273892 CCACACAGGCAGGAGGAGGAGGG - Intronic
968816347 4:2823743-2823765 CCTCATAGGCAGGAGGGGCTGGG - Intronic
968871930 4:3246709-3246731 CCTCCCAGGCAGGAGCAGCTGGG + Intronic
969135701 4:5027037-5027059 GCTGACAGCCAGGAGGTGTTGGG + Intergenic
969239497 4:5889314-5889336 CCTCCAAGACAGCAGGTGTTTGG + Intronic
969612727 4:8236252-8236274 CCACACAGGCAGGTGGGGTCAGG - Intronic
975021989 4:69501747-69501769 CCTCAAAGGCAGGATTGGTTAGG - Intronic
978310234 4:107379270-107379292 CATCAGAGGCAGGTGGTGTAGGG + Intergenic
980875357 4:138656838-138656860 CAGCACAGCCACGAGGTGTTAGG - Intergenic
983755411 4:171328917-171328939 TCTCAGAGGCAGGAGATGTGAGG + Intergenic
983903677 4:173163401-173163423 CCTCACTGGCAGGCGGTGGGAGG - Intergenic
985065690 4:186118820-186118842 CCTCCCAGGCAGTGGGTGCTTGG - Intronic
985760734 5:1747287-1747309 ATTCCCAGGCAGGAGGGGTTAGG + Intergenic
986052803 5:4105545-4105567 CCTCCCAGGCAGGAGCAGTGGGG + Intergenic
990119957 5:52439040-52439062 ACTCAAAGGAAGGAGCTGTTGGG - Intergenic
992017903 5:72594499-72594521 CCACAGGGGCAGGAGCTGTTGGG + Intergenic
992875238 5:81047642-81047664 GCTCACAGTCAGATGGTGTTTGG + Intronic
997255215 5:132423204-132423226 CAGCATAGGCAGGAGGAGTTGGG + Intronic
997699134 5:135884185-135884207 ACTCAAAGGCAGGGGGTGGTTGG - Intronic
997995803 5:138585399-138585421 CTTAACATGCAGGTGGTGTTGGG + Intergenic
999232434 5:150069693-150069715 CCTGCCAGGCAGGAGGGGCTTGG + Intronic
999284030 5:150383372-150383394 CTTCAGAGCCAGGTGGTGTTGGG + Intronic
1001794374 5:174489949-174489971 CCTCACAAGAAGGTGATGTTAGG + Intergenic
1004737259 6:18419947-18419969 CCTGAAAGGCAGGAGGAGATGGG + Intronic
1006080095 6:31560123-31560145 TCTCACAGGCTGGAGCTTTTCGG + Intergenic
1006422906 6:33946585-33946607 GCTTTCAGGCAGGAGCTGTTGGG - Intergenic
1006586526 6:35118345-35118367 CATCACAATCAGCAGGTGTTTGG - Exonic
1007130642 6:39470362-39470384 CGTCACAGGCAGGAGCTGCAAGG - Intronic
1007280167 6:40706401-40706423 AGTCAGAGGCAGGAGGTTTTAGG + Intergenic
1010082565 6:71881299-71881321 CCTCACACAAAGCAGGTGTTTGG + Intergenic
1011507246 6:88059261-88059283 TCACACAGGCAGGAAGTGGTAGG + Intronic
1014629399 6:123770782-123770804 CCTCACAGGCGGGCTGTGTTTGG - Intergenic
1018427199 6:163694219-163694241 CCTCACAGGGAGGAGGTGGCTGG + Intergenic
1018767253 6:166944418-166944440 CCACACAGGCAGGGGCTGTGGGG - Intronic
1019265686 7:116367-116389 GGGCACAGGCTGGAGGTGTTGGG - Intergenic
1019533303 7:1514438-1514460 CCTCCCAGGCTGGATGTGCTGGG + Intergenic
1020035850 7:4962753-4962775 CCTCATCGGCAGGAGGGGATAGG - Intergenic
1025143310 7:56483604-56483626 CCTGGCAGGCAGGAGAGGTTTGG + Intergenic
1025149514 7:56537890-56537912 CCTGACAGGCAGGAAAGGTTTGG + Intergenic
1025710067 7:63900476-63900498 CCTGGCAGGCAGGAGAGGTTTGG + Intergenic
1027309760 7:76943146-76943168 CCTTGGAGGCAGGAGGGGTTGGG - Intergenic
1027953617 7:84851727-84851749 CCTCTCAGGCAGGAAATTTTAGG + Intergenic
1029213225 7:98925944-98925966 CCACACAGGCTTCAGGTGTTAGG + Intronic
1032406199 7:131657687-131657709 CCTGACAAACAGGAGGTGTTTGG + Intergenic
1033195143 7:139321311-139321333 CTTCCCAGGCAGGAGGGGGTGGG + Intergenic
1035143105 7:156784317-156784339 CATCAGAGGCAGGAGATGATAGG - Intronic
1035336556 7:158133209-158133231 CCTAACAGGCAGGAGGAGTCCGG + Intronic
1038190467 8:25315206-25315228 CCTCACAGTGAGGGGGTGTCTGG - Intronic
1038310017 8:26439312-26439334 CCTGAGAGGCAGGAGGTGCTTGG + Intronic
1038324026 8:26557934-26557956 CCTCACAAGCATTTGGTGTTAGG - Intronic
1038444012 8:27590738-27590760 TCCCACAGGCTGGAGGTGGTGGG + Intergenic
1038703992 8:29877047-29877069 CCTCACAGGCTTGAAGTGATGGG + Intergenic
1038762187 8:30394621-30394643 CCAGCCAGGCAGGATGTGTTTGG + Intronic
1039165512 8:34675272-34675294 CCTTACAGGCAGGATATCTTGGG - Intergenic
1039913180 8:41840857-41840879 CCTAACAGGCATGAGGTGAAAGG - Intronic
1040044459 8:42948161-42948183 TCTCACAGGTAGGAAGTATTGGG - Intronic
1040456704 8:47605334-47605356 CTTCACGAGCAGGAGGTGTAGGG + Intronic
1041259333 8:56006583-56006605 CCTCACCAGAAGGAGGTGGTGGG - Intronic
1042843423 8:73147417-73147439 CCTGTCAGGCAGGAGGGGGTAGG - Intergenic
1043551421 8:81377103-81377125 CCTCAGAGGCAAGAGGAGATTGG + Intergenic
1045300623 8:100907524-100907546 CCTCACATGCAGCAGGTGCCTGG - Intergenic
1047031150 8:120882499-120882521 CCTCTCAGGAAGAAGGTGTTTGG - Intergenic
1048773749 8:137922906-137922928 GTTCACAGGCAGGAGAAGTTGGG + Intergenic
1049210255 8:141383099-141383121 CCTGACACGTAGAAGGTGTTTGG + Intergenic
1049510024 8:143022633-143022655 CCACAGCGGAAGGAGGTGTTGGG + Intronic
1051405985 9:16738180-16738202 CTTCAGAGGCAAGAAGTGTTAGG + Intronic
1051748394 9:20317233-20317255 ACTCACAGGCACCAGGTGTTAGG + Intergenic
1053423632 9:37997031-37997053 GCTGACAGGCAGGAGGTGGGTGG + Intronic
1054864932 9:69990224-69990246 ACTCACTGGCAGGAGCTGGTGGG - Intergenic
1056756490 9:89385174-89385196 CCTCAAAGGCAGAAGGGGGTAGG - Intronic
1057185268 9:93053908-93053930 CCTGGCATGCAGTAGGTGTTTGG + Intergenic
1059409495 9:114123274-114123296 GCATACAGGCAGGAGGTGGTGGG + Intergenic
1059529487 9:115022950-115022972 CCTGACATGCAGCAGGTGTTGGG - Intronic
1059922871 9:119177779-119177801 CCTGTCAGGCAGGAGGAATTGGG + Intronic
1060192691 9:121603116-121603138 CCTCCCAGCCAGAAGGTGCTGGG + Intronic
1061146205 9:128800284-128800306 CCTGGCAGGCAGCTGGTGTTGGG + Intronic
1061536226 9:131252004-131252026 CCTCACAGGGAGGAGGGTTCCGG - Intergenic
1062022981 9:134327758-134327780 CCTCACATCCAGGAGGGGCTAGG - Intronic
1062254525 9:135614773-135614795 CCACACAGGGAGGAGGAGCTGGG - Intergenic
1062399838 9:136367493-136367515 CCCCACTGCCAGGAGGGGTTTGG + Intronic
1185556913 X:1028880-1028902 CCTCACAGGCGGGCTGTGTGGGG - Intergenic
1187620391 X:21046976-21046998 ACTCACAGGGAGGAAATGTTAGG - Intergenic
1189014769 X:37085868-37085890 CCAGCCAGGCAGGATGTGTTTGG + Intergenic
1191153316 X:57243434-57243456 CCTCACAGTCAGGAGGCATGGGG - Intergenic
1192544140 X:71998728-71998750 ACTCTCAGGGAGGAGGTGTCTGG + Intergenic
1197718574 X:129728322-129728344 CCTCACAGCCTGGAGGTCTCCGG + Intergenic
1199279727 X:145986801-145986823 CCTAACAGGCAGGAAATGCTTGG - Intergenic
1199599371 X:149532819-149532841 TCTTACAGGCAAGAGGAGTTAGG - Intronic
1199651262 X:149947388-149947410 TCTTACAGGCAAGAGGAGTTAGG + Intergenic