ID: 1144801001

View in Genome Browser
Species Human (GRCh38)
Location 17:17927209-17927231
Sequence CAATGGGGGTGGAGTCCAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 153}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144800994_1144801001 1 Left 1144800994 17:17927185-17927207 CCAACAGCATGAAACTGCATTCT 0: 1
1: 0
2: 0
3: 28
4: 397
Right 1144801001 17:17927209-17927231 CAATGGGGGTGGAGTCCAAAGGG 0: 1
1: 0
2: 0
3: 8
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144801001 Original CRISPR CAATGGGGGTGGAGTCCAAA GGG Intronic
900339509 1:2181333-2181355 CAATGGGGCTGGGGGCCCAAGGG - Intronic
900752099 1:4404971-4404993 CACTGGGTGTTGAGTCCACAGGG - Intergenic
901909240 1:12441274-12441296 AAATGGGGATGGAGTTGAAAAGG + Intronic
904461372 1:30682461-30682483 CAATGGGGGTGGAGAACCCAGGG - Intergenic
904539418 1:31222766-31222788 CAAGGAGTTTGGAGTCCAAAAGG + Intronic
904968855 1:34403099-34403121 ACATGGGGGTTGAGTCCACAAGG + Intergenic
905433355 1:37940590-37940612 CCATGGGGTAAGAGTCCAAAGGG + Intronic
905789610 1:40783299-40783321 AAGTGGAGGTGGAGTCCGAAGGG - Intergenic
908621518 1:65986319-65986341 CAATGCTGGTGGAGTACAGATGG + Intronic
908696699 1:66850716-66850738 AAATGGGGGTGGAATCTAAAGGG + Intronic
912278773 1:108290462-108290484 CAGTGGGGGTGGTGTCCCAGTGG + Intergenic
912289453 1:108403895-108403917 CAGTGGGGGTGGTGTCCCAGTGG - Intronic
915905411 1:159873284-159873306 AAATGGGGCTGGAGCCCAGAGGG - Intronic
918773923 1:188603805-188603827 CAATTGTGGTGTAATCCAAAAGG - Intergenic
920459459 1:206128054-206128076 CAATGGGGCTGGAGTCTCCAGGG + Intergenic
920541254 1:206779786-206779808 CAATGAGGCTGGAGTGCAGAGGG - Intergenic
922020367 1:221698410-221698432 CAATGGGGGTGACTTCCAGAAGG - Intergenic
1064346224 10:14534936-14534958 TTATGGCGGTGGAATCCAAATGG - Intronic
1065833276 10:29634026-29634048 GTATGGGGGTGGAGTTCAGAAGG - Intronic
1066515018 10:36149030-36149052 GAATGGGAGAGGAGGCCAAAGGG - Intergenic
1068632768 10:59314679-59314701 AAGTGGGGGTGGGGTCCAAGGGG - Intronic
1070151716 10:73809276-73809298 CTATGGTGGGGGAGTTCAAAAGG + Intronic
1070584926 10:77756971-77756993 CACTGGAGGTGGAGCCCAATGGG + Intergenic
1073064518 10:100750234-100750256 GAATGGGGGGGGAGTGAAAATGG + Intronic
1074003228 10:109393181-109393203 CACTGGGGGTGGAGCCAAAATGG + Intergenic
1076466795 10:130688513-130688535 CAAGGGGAGGGGACTCCAAAGGG - Intergenic
1081443065 11:43101133-43101155 AAATGGGGGTGGAGCCAAGATGG - Intergenic
1082088874 11:48072385-48072407 CCATGAGGGTGGAGTCCTAATGG + Intronic
1084662866 11:70557462-70557484 CAGTGGGGGAGGAGCCCAGATGG + Intronic
1084864012 11:72041216-72041238 CAGTGGGGGTGGGGCCCAGAGGG + Intronic
1084951333 11:72667501-72667523 CAATGGAGGTGGAGAACAATGGG + Intronic
1086116971 11:83262726-83262748 CAAATGGGGTGGTGTACAAATGG - Intronic
1088714765 11:112539301-112539323 CAATGGGGGTGTGGTTCCAAAGG + Intergenic
1099112566 12:78580267-78580289 AAAGGTGGTTGGAGTCCAAATGG + Intergenic
1103821523 12:123702525-123702547 CCGTGGGGGTGGAGTCCAACAGG - Intronic
1106118454 13:26837626-26837648 CAATCATGGTGGAATCCAAAGGG + Intergenic
1108416490 13:50202688-50202710 AAATGGAGCTGGAGTGCAAAGGG + Intronic
1108689938 13:52850906-52850928 AAATGGGGCCGGAGTCCCAAAGG + Intergenic
1108783446 13:53866044-53866066 AAATGGGGGTAAAGGCCAAATGG + Intergenic
1109323027 13:60833328-60833350 CCATGGGGGTGGAGCCAAGATGG - Intergenic
1111457086 13:88498479-88498501 TAATGGGGATGGAGAACAAATGG - Intergenic
1117108884 14:52428017-52428039 CAATGTGGCTGGAGTCTAATGGG - Intergenic
1121106499 14:91283353-91283375 CGATGGGGGTGGAGTTGGAAGGG + Exonic
1121298176 14:92847174-92847196 CAAAGGGGGTGTTGTCCATACGG + Intergenic
1121511188 14:94514588-94514610 CATTGGGGGTGGGGTGCAATTGG + Intronic
1126721938 15:51590943-51590965 CAAGGGGGGTGGAGCCAAGATGG + Intronic
1128983182 15:72200848-72200870 GAATGGGGGTAGAGGGCAAATGG - Intronic
1131055019 15:89370008-89370030 AAATGGAGGTGGGGTACAAAGGG - Intergenic
1131753422 15:95534692-95534714 CCATGGGGCTTCAGTCCAAAAGG + Intergenic
1134036805 16:11037274-11037296 GAAGGTGGGTGGGGTCCAAATGG - Intronic
1138085759 16:54132357-54132379 CAAAGGGAATGGAGTCCAATGGG + Intergenic
1141263026 16:82471026-82471048 TCATGGGTGTGAAGTCCAAAAGG + Intergenic
1141348434 16:83270449-83270471 CAATGGGGGTGGCTTACTAAGGG - Intronic
1142599744 17:1047847-1047869 CAATGGGGCTGAAGTCCAGGTGG + Intronic
1142670388 17:1485296-1485318 GATTGGGGGTGGATCCCAAAGGG + Intronic
1142989612 17:3721610-3721632 CAATGGGGGTGGAAAAGAAAGGG - Intronic
1143137647 17:4720605-4720627 CAATGAGGTTGGTGTCCACAGGG - Exonic
1144801001 17:17927209-17927231 CAATGGGGGTGGAGTCCAAAGGG + Intronic
1145388442 17:22435712-22435734 CAAAGGGGGTGAAGCCCCAAGGG - Intergenic
1147416802 17:40297473-40297495 TGTTGGGGGTGGAGGCCAAAGGG + Intronic
1157939180 18:51908185-51908207 CAACTGGGGCAGAGTCCAAAAGG + Intergenic
1158117824 18:54016312-54016334 CAATGTGGCTGGAGTTCACAGGG - Intergenic
1158765655 18:60447292-60447314 CCATGGGAGTGGAGTCCAACAGG + Intergenic
1161954033 19:7483066-7483088 CAAGGGGGGTGGGGTCCCAAGGG - Intronic
1162719964 19:12656523-12656545 CACTGGGGGAGGAGTCCCAGCGG + Intronic
1165467821 19:35985626-35985648 AAATGGGGGTGGAGTCAGAAGGG - Intergenic
1167017472 19:46850529-46850551 CATTGGGGGTGGTGTTCCAAGGG - Intronic
926894311 2:17667915-17667937 CAAGGGCTGTGGAGTCAAAATGG + Intronic
928908850 2:36398026-36398048 CAATGGGTGTGGGGAGCAAAGGG - Intronic
930152673 2:48074617-48074639 CAATGGGCGGGGTTTCCAAAAGG + Intergenic
932320536 2:70819321-70819343 CAGTGGGGGTGGGGTGCAGAGGG - Intronic
938905173 2:135830157-135830179 AACTGGGGGTGGACTTCAAACGG - Intronic
939893598 2:147766519-147766541 CAAGGGGGGTGGAGCCAAGATGG + Intergenic
940855067 2:158723309-158723331 CTGTGGGGGTGGAGGACAAATGG - Intergenic
941781738 2:169452778-169452800 AAATGGGGGTGGAGCCAAGATGG + Intergenic
943275433 2:185861520-185861542 CAATGGGGGAGGAGATGAAAAGG - Intergenic
944524461 2:200604261-200604283 GAATGGGGGTGGGGTCCCCATGG + Intronic
945734270 2:213579270-213579292 AAATGGGGCTTGATTCCAAAGGG + Intronic
947356479 2:229301144-229301166 CGAGGGAGTTGGAGTCCAAATGG - Intergenic
1169124368 20:3116361-3116383 GAATGAGGGTGAAGGCCAAAGGG + Intronic
1171277992 20:23874948-23874970 CCATGGGGGTGGAGAGGAAATGG + Intergenic
1173166398 20:40689585-40689607 GGATGGGGGTGGGGTGCAAAGGG - Intergenic
1177137983 21:17327479-17327501 CAATGGGGGAGGAGCCAAGATGG + Intergenic
1180037900 21:45259346-45259368 AAACGGGGCTGGAGTCCAGAGGG - Intergenic
1181719631 22:24763836-24763858 CTGTGGGAGCGGAGTCCAAAGGG - Intronic
1182081973 22:27535991-27536013 CAAGTGTGGTGGAGTCCACAGGG + Intergenic
1182548963 22:31090953-31090975 CAAGGGGGGTGGACTCTAGAAGG - Exonic
1184038086 22:41927992-41928014 AGATGGGGGTGAAGGCCAAAGGG + Intergenic
949234534 3:1792513-1792535 AAATGGGGGAGGGGTCAAAATGG + Intergenic
950309670 3:11946081-11946103 CAATTTGGGTAGAGCCCAAAGGG - Intergenic
950713532 3:14831182-14831204 CAGTGTGGGTGGAGTGCAGAAGG + Intronic
950794130 3:15496786-15496808 GAATGGGTATTGAGTCCAAAGGG - Intronic
953902220 3:46849812-46849834 AAATGGGGGAGGGGTCCAAGTGG + Intergenic
954939230 3:54355821-54355843 AAATGGGCATGCAGTCCAAATGG - Intronic
959807508 3:110574559-110574581 CAATGGGTGTAGGGGCCAAAGGG - Intergenic
961804351 3:129478255-129478277 CACTGGGGGGGGAGCACAAATGG - Intronic
965614224 3:170576706-170576728 CAGTGGGGGTGGAGTGCTATTGG + Intronic
966347748 3:178997819-178997841 CCGTGGGGTTGGAGCCCAAAAGG + Intergenic
967154160 3:186677446-186677468 CCATGGGGGTGGTGTCCATGGGG - Exonic
967154171 3:186677476-186677498 CCATGGGGGTGGTGTCCATGAGG - Exonic
968690726 4:1988489-1988511 CAAAGGGGGTGGGGCCCAAGGGG + Intronic
972373526 4:38448908-38448930 TAAGGGGGGTGGAGTCAAGATGG - Intergenic
973647805 4:52967702-52967724 CAATGGGGAGAGATTCCAAAAGG - Intronic
974580007 4:63785421-63785443 CAAAGGGGGTAGAGAGCAAAGGG + Intergenic
975472086 4:74781566-74781588 CAATGGGGGTGGATTTTAGATGG - Intronic
976727155 4:88225840-88225862 CAATGATGGTGGAGGGCAAAAGG + Intronic
977789885 4:101087234-101087256 CAATGGGGATCAAGTCCTAAGGG + Intronic
978125553 4:105131090-105131112 CCAGTGGGGTGGAGCCCAAAGGG - Intergenic
981909726 4:149964925-149964947 CAATGGGGGTGGAAGAGAAAGGG - Intergenic
982174539 4:152693356-152693378 CAATGGTGATGGAGTGCGAAGGG - Intronic
982419069 4:155172635-155172657 TAATGTGGGTGGAGTTTAAAAGG - Intergenic
984074213 4:175154380-175154402 CCATGAGGGTGGAGCCCTAATGG + Intergenic
990744129 5:58941384-58941406 CAGTGGGGGAGGCTTCCAAATGG + Intergenic
995476366 5:112552393-112552415 CAGTGGAGGAAGAGTCCAAAGGG + Intergenic
996013136 5:118502894-118502916 AAATGGGGGTGGAGCCAAGATGG - Intergenic
1000928047 5:167217629-167217651 CAATGGAAGTGGTTTCCAAATGG + Intergenic
1001422078 5:171595688-171595710 AAATGGGGATGGAGTACAACGGG + Intergenic
1003168453 6:3701564-3701586 GAATGGGGCTCGAGTGCAAAGGG + Intergenic
1007253298 6:40511045-40511067 CCATGGGGGAGAAGGCCAAAGGG + Intronic
1007327353 6:41072796-41072818 CACTGGGGGTGGTGTCAAAGCGG + Intronic
1008382032 6:50846823-50846845 CTATGGGTGTGGAGGCCAGAAGG - Exonic
1009675531 6:66814871-66814893 CAATGTGGTTCGAGTACAAAAGG - Intergenic
1010977043 6:82327034-82327056 CAATGTGGGTGCAGTGAAAAGGG - Intergenic
1011511058 6:88101342-88101364 CCATGGGGGTAGAGTCCCCATGG + Intergenic
1013431975 6:110063607-110063629 GAATGGGGGTGGAGGGCAAGGGG - Intergenic
1020754739 7:12188779-12188801 CATTGGAGGTGGAGTCTAATTGG + Intergenic
1021010334 7:15455769-15455791 CAAAGGAGGTGGAATCAAAATGG - Intronic
1022053933 7:26709361-26709383 CAAAGGGTGTGGAGTGGAAAAGG + Intronic
1024261327 7:47576265-47576287 CACTGGGCCTGGAGCCCAAAAGG + Intronic
1024447969 7:49503795-49503817 CAAATGGGCTGGAGTCCTAAGGG + Intergenic
1024628824 7:51230949-51230971 CAATGGCAGTGGAGATCAAAGGG + Intronic
1026301109 7:69098777-69098799 CAATGGGTGGGGAGTTCAGAAGG + Intergenic
1029604298 7:101589346-101589368 CAATTGGAGAGGAGACCAAATGG + Intergenic
1031274542 7:119702643-119702665 TAATGAGGGTGGAGTCCTTATGG - Intergenic
1033381970 7:140830384-140830406 AACTGGGGTTGGAGGCCAAAGGG - Intronic
1033505886 7:141999420-141999442 CCATGGCTGTGGAGTCCAAAGGG + Intronic
1033534081 7:142296150-142296172 AAAGTGGGGTGGAGTCAAAAGGG + Intergenic
1035286883 7:157812359-157812381 CAAAGGGAGTGGAGTGGAAAGGG - Intronic
1041945683 8:63439505-63439527 CAATGGGGGTCTGCTCCAAATGG + Intergenic
1045384299 8:101656409-101656431 CAGAGGGGGTGGTTTCCAAAGGG + Intronic
1045385958 8:101671030-101671052 CAAGGGGGGTGGAGCCAAGATGG + Intergenic
1047464552 8:125099727-125099749 TAGTGGGGGTGGGTTCCAAAGGG + Intronic
1049738292 8:144221703-144221725 CATTGCAGGTGGTGTCCAAAAGG - Intronic
1050817790 9:9837436-9837458 CAATGGGGAAGGCTTCCAAAAGG - Intronic
1050838596 9:10116769-10116791 TAATGTTGGTGGAATCCAAAAGG - Intronic
1053854770 9:42327605-42327627 CAATTGGGGTAGAGTTGAAAGGG + Intergenic
1057135198 9:92682501-92682523 CAATGGGCGTGGGGGCCAGATGG + Intergenic
1057536877 9:95918740-95918762 CAATGAGAATGGATTCCAAATGG - Intronic
1059417485 9:114170882-114170904 CAATGGCGGTGAGGTCAAAAGGG + Intronic
1061000895 9:127901969-127901991 CAATGGGGGAGGAATCAAAGAGG + Intronic
1189666357 X:43358963-43358985 CCATGAGGGTGGAGTCCTCATGG + Intergenic
1191182012 X:57574274-57574296 CAATGTGGGTGGGTTCTAAATGG + Intergenic
1191215546 X:57929232-57929254 CAATGTGGGTGGGTTCTAAAGGG - Intergenic
1194418238 X:93638971-93638993 CAATCATGGTGGAATCCAAACGG - Intergenic
1195345177 X:103943060-103943082 TAATGGAGATGGAGTACAAATGG + Intronic
1195792895 X:108608156-108608178 CATTGTGGGTGGAGTGTAAATGG - Intronic
1197918712 X:131564901-131564923 CAATGGGTGTGGATTTTAAAGGG - Intergenic
1200232023 X:154448854-154448876 CAGTGGGGCTGGAGACCAAGAGG + Intronic
1200435310 Y:3143435-3143457 CAATCAGGGTGGAGGGCAAAAGG + Intergenic
1201245922 Y:12003574-12003596 AAATGGGGGTGGAGCCAAGATGG - Intergenic
1202340492 Y:23859577-23859599 CAGTGGAGGTGGAATGCAAATGG + Intergenic
1202530274 Y:25810505-25810527 CAGTGGAGGTGGAATGCAAATGG - Intergenic