ID: 1144801997

View in Genome Browser
Species Human (GRCh38)
Location 17:17935684-17935706
Sequence ACTTTAGAGATGGTATAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 214}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144801997_1144802004 22 Left 1144801997 17:17935684-17935706 CCTTATTATACCATCTCTAAAGT 0: 1
1: 0
2: 0
3: 25
4: 214
Right 1144802004 17:17935729-17935751 CCAAGAGCCATTAGGACATAAGG 0: 1
1: 0
2: 0
3: 8
4: 97
1144801997_1144802006 29 Left 1144801997 17:17935684-17935706 CCTTATTATACCATCTCTAAAGT 0: 1
1: 0
2: 0
3: 25
4: 214
Right 1144802006 17:17935736-17935758 CCATTAGGACATAAGGAACGAGG 0: 1
1: 0
2: 1
3: 4
4: 55
1144801997_1144802002 14 Left 1144801997 17:17935684-17935706 CCTTATTATACCATCTCTAAAGT 0: 1
1: 0
2: 0
3: 25
4: 214
Right 1144802002 17:17935721-17935743 ATCATGCTCCAAGAGCCATTAGG 0: 1
1: 0
2: 0
3: 14
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144801997 Original CRISPR ACTTTAGAGATGGTATAATA AGG (reversed) Intronic
902170575 1:14607137-14607159 ACTTTATACATGGTATCATGAGG + Intronic
904395100 1:30214878-30214900 ACATTTGAAATGGTATTATAAGG + Intergenic
904593946 1:31631278-31631300 ATTTTAGAGATGATAAGATAGGG - Intronic
905195144 1:36270459-36270481 ACTTTAAAGAAGGTTTAAAAGGG - Intronic
905348337 1:37327175-37327197 GTTTTAGAGATGGAAAAATAGGG + Intergenic
905758040 1:40528895-40528917 ACTTTAGAGGTTGTAAAAAAGGG - Intergenic
906082127 1:43099440-43099462 ACTTTGGAAATTCTATAATAAGG - Intergenic
907686819 1:56619821-56619843 ACTTTACAGATGGGACACTAGGG + Intronic
909554677 1:76940534-76940556 ACCTTAGAAATGATATAGTATGG + Intronic
911044910 1:93620219-93620241 ACTTAGGAGCTGGTATAATAAGG + Intronic
913720987 1:121594359-121594381 ACTATAAAGAGGTTATAATAGGG + Intergenic
918019555 1:180673183-180673205 AGATTAGAGATGATCTAATATGG + Intronic
918147849 1:181773354-181773376 ATTTTATAGATGCTATAAAAGGG - Intronic
918731895 1:188008924-188008946 GCTTTAGAGATGGGAAAATGAGG - Intergenic
919488941 1:198180474-198180496 ACTTGACAGATGGTATAGGAAGG + Intronic
920244402 1:204576891-204576913 AGGTTAGAGATGGAATCATAGGG + Intergenic
920934361 1:210417533-210417555 ACTTTAGAAAATGTAAAATAAGG - Intronic
921815532 1:219559090-219559112 AATTTATAAATGATATAATAAGG - Intergenic
922079827 1:222284892-222284914 ATTTCAGAGATGTTAAAATATGG + Intergenic
922310612 1:224386317-224386339 ATTTTAGAGATGGGACAAAAAGG + Exonic
922426794 1:225504492-225504514 AATTAAAAAATGGTATAATAGGG + Intronic
924239675 1:242029162-242029184 AATTTACAGATGGAATAAAATGG + Intergenic
1063938075 10:11099512-11099534 ATTTTAGAGATGGATTAAAAAGG + Intronic
1065477542 10:26156889-26156911 TCTTTATAGATGGTAAAAAAGGG - Intronic
1066575384 10:36819202-36819224 ACTTTGGAGACTGTATAAAAAGG + Intergenic
1067340367 10:45396731-45396753 CCTTTAGTTTTGGTATAATATGG - Intronic
1067982142 10:51098634-51098656 ACTTTTGACATGGTCTAACAGGG + Intronic
1068246111 10:54371432-54371454 ACTTTTGAGAATGTATAAAATGG + Intronic
1071275566 10:84051351-84051373 AGTTTGGAGATGGAATCATAGGG - Intergenic
1072142955 10:92606386-92606408 ACTTTTGATATGGTAACATATGG + Exonic
1077944036 11:6875544-6875566 ATTTTAGAGATTGAATAGTAGGG + Intergenic
1080069481 11:28063160-28063182 ATTTTAGAGATGGGCTTATAAGG + Intronic
1081005819 11:37737510-37737532 AATTCAGAGATGATATAAAATGG - Intergenic
1084839499 11:71833468-71833490 AATTTGGAGATGGAATAAGAGGG - Intronic
1084991790 11:72932491-72932513 ATTGTAGAGAAGGTGTAATACGG - Intronic
1085092300 11:73727501-73727523 ACTTTACAGATGTGAAAATATGG + Intronic
1085175534 11:74483865-74483887 ACTTTATAGATATTATAAAATGG + Intergenic
1088924495 11:114286548-114286570 ACTTTATAGATTGAATAAAAAGG + Intronic
1091288790 11:134425094-134425116 ATTTTATAGATGGGATAATTGGG + Intergenic
1095759690 12:45816171-45816193 ACTTTGAAGATGGGATAAAACGG - Intronic
1095999624 12:48118382-48118404 ACTTTCTTGATGGTATAATTTGG + Intronic
1096405807 12:51343492-51343514 ACTTTAGAGATAGGAGAATGGGG + Intronic
1097859553 12:64504999-64505021 TCTTTTGACATGGTATAATCAGG - Intergenic
1098766108 12:74491388-74491410 ACTATAGAGCTGGGATAAAAGGG - Intergenic
1100717020 12:97316681-97316703 TATTTAGAGATAGTAGAATAAGG - Intergenic
1104073035 12:125363150-125363172 ACTTTATAGATGGTAAAGTTAGG - Intronic
1104193104 12:126502427-126502449 ACTTTTGAGAGGCTATAAGAGGG + Intergenic
1104734790 12:131130251-131130273 ACTTTACAGATGGGAAAATAAGG + Intronic
1106223363 13:27765997-27766019 ACTTTTGAGATGGCAGAATTTGG - Intergenic
1106672408 13:31920725-31920747 ATATTAAAGATGGTTTAATATGG + Intergenic
1107386659 13:39917278-39917300 ACTTCAGGGATGGTCTAAAATGG - Intergenic
1108826529 13:54418761-54418783 ACTTTACAGAGGGTTTAGTACGG + Intergenic
1109517383 13:63461725-63461747 GCTTGAGAGATGGAAGAATAAGG + Intergenic
1110571914 13:77013607-77013629 AGTTTGGAGATGGAATTATAAGG - Intronic
1111011000 13:82315055-82315077 ATTTTAAAGATGGTATCATTGGG + Intergenic
1112915682 13:104547662-104547684 AATTTAGATATGGTAAAACAAGG - Intergenic
1112961268 13:105130039-105130061 ATTTCAGTGATAGTATAATATGG - Intergenic
1115034057 14:28836119-28836141 TCTTTAGAACAGGTATAATAGGG - Intergenic
1116751788 14:48895279-48895301 ACATTATAGATGGAATAAAAAGG - Intergenic
1117430614 14:55655902-55655924 ACTTCTAAGTTGGTATAATATGG + Intronic
1118794839 14:69132692-69132714 ATTTTAGAGGTGATATAATGTGG + Intronic
1118948868 14:70415965-70415987 ATTTTAGAGATGATAAACTAAGG + Intronic
1121290531 14:92771229-92771251 ACTTTGGAGATGGTATACCCAGG - Intergenic
1122496220 14:102157632-102157654 ACTTTAGAGAAGATTTAATAAGG + Intronic
1128459679 15:67857217-67857239 AGTTTAGACAAGGTATAACAGGG + Intergenic
1129275130 15:74440409-74440431 CCTTTAGAGGTGCTAGAATAAGG - Intergenic
1131316834 15:91346708-91346730 GCTTTAGAGAGGGTATGATATGG - Intergenic
1134740612 16:16540436-16540458 AGGTTGGAGATGGTATCATAGGG - Intergenic
1134926890 16:18171736-18171758 AGGTTGGAGATGGTATCATAGGG + Intergenic
1135287150 16:21203566-21203588 ACTCTACAGATGTTATAAAATGG + Intronic
1138714505 16:59005613-59005635 CATTTAGAGATGGTATGTTAAGG - Intergenic
1143938199 17:10509342-10509364 ACTTCAGAGTTGGCAAAATAAGG + Intronic
1143943613 17:10569300-10569322 ACTTTAGAAATGTTAAAATGTGG + Intergenic
1144801997 17:17935684-17935706 ACTTTAGAGATGGTATAATAAGG - Intronic
1148899076 17:50861954-50861976 ATTATAGAGATGGTATGGTAAGG - Intergenic
1149285060 17:55153397-55153419 ACATTAGAGATGGTCTCATAAGG + Intronic
1153206057 18:2702818-2702840 CCTTTGGAAATGGTATATTATGG + Intronic
1153208677 18:2734357-2734379 ACCTTAGAGAAGGTATGATAGGG - Intronic
1155733309 18:29189141-29189163 ACTTTATTGATGGTAGGATAAGG + Intergenic
1156117271 18:33800998-33801020 ACTCAAGAGATGGTCTAAAATGG + Intergenic
1156862377 18:41852916-41852938 ACTTTACAGATGGTAATATTGGG - Intergenic
1158775382 18:60572671-60572693 AATTTGGAAAGGGTATAATATGG - Intergenic
1160373624 18:78394560-78394582 TCTTCAGAGATGGTTGAATAGGG - Intergenic
1162907310 19:13831492-13831514 ACTTTGGAGGTGGCATAATGGGG - Exonic
1163648381 19:18503073-18503095 ACTTTACAGCTGGTTTAATGTGG + Intronic
1164751997 19:30663557-30663579 ACTTTACAGATGGTGGAATTAGG - Intronic
1165883631 19:39061286-39061308 ACCTTAGAGTTGGTGTAATAGGG + Intergenic
1168435181 19:56310898-56310920 ATTTTACAGATGATAAAATAAGG - Intronic
925651532 2:6094550-6094572 ACTTTAAAGATTGTTTGATATGG - Intergenic
927223372 2:20736520-20736542 TCTTTAGGGATGGTATATTTTGG - Intronic
927435502 2:23062957-23062979 ACTGTAGAGATGGAAGCATAGGG + Intergenic
929207964 2:39319848-39319870 ATTTTAGAAATGGTAAAATATGG - Intronic
932124917 2:69136017-69136039 ATTTTAGAGATGTTAAAATGTGG - Intronic
933042986 2:77492612-77492634 ACTTTATATATGAAATAATAGGG + Intronic
933356505 2:81216785-81216807 ATTTTAGAGGTTATATAATATGG + Intergenic
936977407 2:118233329-118233351 ACATTAGATATGGCATGATAAGG - Intergenic
937748477 2:125444560-125444582 ACTACAGAGATGGTTTCATAAGG - Intergenic
941482451 2:166033580-166033602 ACTTTAGAGATAATTTAATGTGG - Intronic
941628300 2:167854851-167854873 ACTTAAGAGATGGCATCAGAAGG - Intergenic
942676977 2:178437121-178437143 ATTTTAGAGATGGCATGATATGG + Intronic
944191111 2:197005163-197005185 ACTTTGGAATTGGTATAATTAGG + Intronic
944942532 2:204644178-204644200 ACTTTAGAGGAGGTGTAACATGG - Intronic
944942739 2:204647560-204647582 ACTTTAGAGACAGTGCAATATGG - Intronic
947374261 2:229479833-229479855 ACTTTAAAGATTCTACAATATGG + Intronic
1169866807 20:10209972-10209994 ACTTTGGGGATGGTTGAATAAGG - Intergenic
1172384495 20:34524315-34524337 CCTTTTGTGATGGTATAACATGG + Intronic
1173148844 20:40548697-40548719 AATTTAGAGAGGGTACAGTAAGG - Intergenic
1174515769 20:51091336-51091358 ACTTTACAGATGGAACAATTGGG + Intergenic
1175530626 20:59672336-59672358 ACTTTAGAGATGGGAAACTGAGG - Intronic
1177127474 21:17213479-17213501 AGTTAAAACATGGTATAATATGG - Intergenic
1177671810 21:24241464-24241486 AATTTAGAGATGGTAGCATAGGG + Intergenic
1181515511 22:23409338-23409360 AGTGTAGAGATAGAATAATAAGG - Intergenic
1182128837 22:27836001-27836023 ATTTTAGAGATGTTAAAATGAGG + Intergenic
1183895670 22:40966690-40966712 ACTTAAGGGATTATATAATATGG - Intronic
1184944919 22:47796148-47796170 ACTTTGGAGATGGGATAACGAGG + Intergenic
950122626 3:10491921-10491943 ACTTCAGAGATGTTAAAATGCGG + Intronic
950741594 3:15056598-15056620 GCTTTGAAGATGGTAGAATAAGG + Intronic
950761256 3:15230157-15230179 ACTTAATAGATGGTTTATTAGGG + Intronic
950935760 3:16837445-16837467 AGGTTAGAGATGGAATCATAGGG - Intronic
950943563 3:16920354-16920376 CTTTTATAGATGATATAATAAGG + Intronic
951088633 3:18544977-18544999 AATTGAGAGATGGAATAATAAGG - Intergenic
955314065 3:57920712-57920734 CCTTCAGAGATGGCAGAATAGGG + Intronic
956819211 3:72937870-72937892 ACTTTGAAGATGGTAGGATATGG - Intronic
956838254 3:73113319-73113341 AATTCAGAGATGGTACATTATGG + Intergenic
956956248 3:74344314-74344336 ACTTTAGAATTGGAATAAAAGGG - Intronic
957364756 3:79208500-79208522 ACTTGAGAGAGAGTATAAGAAGG + Intronic
957779970 3:84806327-84806349 ACTTTAGAGATGAGAAAATAAGG - Intergenic
957812913 3:85251249-85251271 AGTTTAGAGAAGGTAAAATTTGG - Intronic
958053821 3:88384116-88384138 ACTTTGGATAGGGTATACTATGG + Intergenic
958558684 3:95713506-95713528 CTTATAGAGATGGTATTATAGGG - Intergenic
958833407 3:99116191-99116213 AATCTAAATATGGTATAATAAGG + Intergenic
960201813 3:114846100-114846122 ACATTATAGAGAGTATAATAGGG + Intronic
962668998 3:137685819-137685841 ACTTTAGAATTGATAGAATAGGG - Intergenic
964416239 3:156451398-156451420 AATTTGGAAATGGTCTAATAAGG + Intronic
964783348 3:160365326-160365348 TCTGTACAGATGTTATAATATGG + Intronic
964835991 3:160939424-160939446 CCTTTGGACATGGTATGATATGG + Intronic
965416362 3:168398604-168398626 ACATTAGAGATGTTAAAATGTGG + Intergenic
965535973 3:169824025-169824047 AATTTATAAATGGTATCATAAGG - Intronic
969780585 4:9399472-9399494 AATTTGGAGATGGAATAAGAGGG - Intergenic
970731369 4:19107605-19107627 ACTTTTTAGAAGGTAGAATAGGG + Intergenic
970861316 4:20706121-20706143 ACTTTAGACTTGGTAAAATTTGG + Intronic
970896543 4:21110086-21110108 ACTTTAGAGATGGCACCAAAGGG - Intronic
971946109 4:33279427-33279449 ACTTTAGGGATGGGATGATGTGG + Intergenic
972005094 4:34091904-34091926 ACTTTTGTTATGGTAGAATAAGG - Intergenic
972398221 4:38675151-38675173 ACTTTTCAGATGTTAAAATAAGG - Intronic
974784044 4:66594254-66594276 ACTTTTGAGATGGAAGAAAAAGG + Intergenic
975056374 4:69936295-69936317 AGGTTAGAAATGATATAATAAGG + Intronic
975144176 4:70949577-70949599 AAATTAGAGATGGTATAGGAGGG + Intronic
975683939 4:76901295-76901317 ATTTTAGAGATGTTAAAATATGG + Intergenic
976084953 4:81398384-81398406 TCTTCAGAGATAATATAATAGGG - Intergenic
978270879 4:106889075-106889097 ACAGTAGAGGTGGTAAAATACGG - Intergenic
978564878 4:110071107-110071129 AGTTTAGAGCTGGAATCATAAGG - Intronic
978673513 4:111280655-111280677 ACTTTAAAGATGGTTTAACAGGG - Intergenic
983839380 4:172437648-172437670 ACATTAGGGAAAGTATAATATGG - Intronic
987039667 5:14050103-14050125 ACTTTAGATGTGGTACAAGATGG - Intergenic
987045124 5:14100777-14100799 AATTTTGATATGGAATAATAAGG + Intergenic
987727666 5:21723552-21723574 ACTTTAGGAATGTTATAATTTGG + Intergenic
989681013 5:44029956-44029978 GATTCAGAGATGGTGTAATAGGG + Intergenic
990904368 5:60788227-60788249 ATTTTACAGATGTTAAAATACGG - Intronic
991051261 5:62274811-62274833 ACTTTAGATATATTATAATAAGG - Intergenic
991339792 5:65595925-65595947 AGTATAGATATGATATAATACGG + Intronic
991497884 5:67245451-67245473 ACTTTAGAGATGATGCAATCAGG - Intergenic
993016351 5:82539034-82539056 ACTTTAGTTGTGGAATAATAAGG + Intergenic
994721647 5:103387086-103387108 CCTTTAGTGATGGTATGCTAGGG - Intergenic
994929151 5:106158209-106158231 AATTTAGAAAGGATATAATATGG + Intergenic
996046545 5:118880230-118880252 ATTTTAGAGATGGTAAAATGTGG - Intronic
996160910 5:120163367-120163389 ATTTTAGAGATGAGATAATGGGG + Intergenic
996240396 5:121192760-121192782 AATTCAGAGATGGCATAATATGG - Intergenic
996670139 5:126108247-126108269 ATTTTATATATGGTATAATATGG - Intergenic
996720398 5:126624328-126624350 ACTGTAGAGATGATACATTAAGG + Intronic
999021414 5:148169654-148169676 ACTTTAGTGATTGTATTAGAGGG + Intergenic
999223231 5:149998957-149998979 ACTTCAAAGAGGGAATAATATGG + Intronic
1003726035 6:8765418-8765440 AATTTATAGATGGAAAAATATGG + Intergenic
1004391632 6:15214949-15214971 ACTTGAGAGATGGCATACGAGGG + Intergenic
1007876734 6:45111628-45111650 ACTTTAGAACTGAAATAATAAGG - Intronic
1008187338 6:48410345-48410367 CCTGTAGGGTTGGTATAATATGG + Intergenic
1008942326 6:57060657-57060679 AATTTAAAGATGATCTAATAGGG + Intergenic
1010226917 6:73498703-73498725 ATTTTAGAGATGTTAAAATGTGG - Intronic
1011193260 6:84756358-84756380 ACTTTGGAGTTGGGTTAATAAGG - Intronic
1011560560 6:88609597-88609619 ACTTTATAGATGGAACAAAATGG + Intergenic
1012607532 6:101176361-101176383 ACATTAAAGATGGGATAATAGGG - Intergenic
1014143818 6:117973276-117973298 ACTTTAAAGAAGGTAAAATGAGG - Intronic
1015740044 6:136444042-136444064 AATTTTGACATGGTATAACATGG - Intronic
1016504446 6:144762909-144762931 GCTTTAGAGAAGGTGTTATAAGG - Intronic
1017222387 6:151981245-151981267 ACTTTAGAAATGGCAATATAGGG - Intronic
1017642219 6:156505356-156505378 AATTTAGAGCTGGCATAATACGG - Intergenic
1021085694 7:16419742-16419764 AGTTTGGAGATGGAATCATAGGG - Intronic
1023620174 7:42063610-42063632 ACTTCAGAGATGTTAAAAGATGG + Intronic
1026030192 7:66785956-66785978 ACTTTCTAGATGGTATCCTAAGG + Intronic
1027207776 7:76115877-76115899 ACTTTCTAGATGGTATCCTAAGG - Intergenic
1027722683 7:81764858-81764880 ACCTTAGAAATAGTGTAATAAGG - Intronic
1028808987 7:95062283-95062305 ACATTTGAGATGGCATAAGAAGG + Intronic
1030037917 7:105423822-105423844 TGTTTAGAGATGGGATCATATGG - Intergenic
1030349409 7:108467267-108467289 AATTTTGAGATGGTATTTTAAGG - Intergenic
1030363445 7:108619995-108620017 ACTTTAGGGTTGGTGTAAGAAGG - Intergenic
1032826536 7:135575215-135575237 GATTTAGAGATGGTATTAGATGG + Intronic
1033378989 7:140794060-140794082 TTTATAGAGATGGTATCATAAGG + Intronic
1033888295 7:145976008-145976030 ATTTTAGAGAAAATATAATATGG + Intergenic
1036278021 8:7373412-7373434 AATTTGGAGATGGAATAAGAGGG - Intronic
1036343502 8:7938480-7938502 AATTTGGAGATGGAATAAGAGGG + Intronic
1038587210 8:28800714-28800736 AATTTACAGATGTTATAATAGGG - Intronic
1038596618 8:28891320-28891342 ACTGTAGAGATGGTGTGATGTGG + Intronic
1039065472 8:33603833-33603855 AGATTAGAGATGGAAAAATAAGG + Intergenic
1043019025 8:74977429-74977451 AATTGAGAGATGTTATAATTTGG + Intergenic
1043863135 8:85344960-85344982 CCTCTAGAGATGGTATCATTTGG + Intronic
1044444436 8:92258103-92258125 AATTCAGATATGCTATAATATGG + Intergenic
1045395112 8:101753198-101753220 AGTTAAGAAATGGTATAATCGGG + Intronic
1046477577 8:114766837-114766859 ACTTCTGAAATGGTATAATAAGG + Intergenic
1046491500 8:114958196-114958218 ATTTTAGAGTTGTTATCATACGG + Intergenic
1047919140 8:129615282-129615304 ACTATAGAGATGGCAAAAAAAGG + Intergenic
1051557509 9:18401546-18401568 ACTTTACAGATGTTAAAATTTGG - Intergenic
1052332486 9:27283841-27283863 ACTTTAGAAATGGAAAAATATGG + Intergenic
1053226387 9:36362023-36362045 AATTCAGAGATGTTAAAATATGG + Intronic
1053399308 9:37803020-37803042 ATTTTAGAGCTGTTAGAATAAGG + Intronic
1053654471 9:40202093-40202115 AATTTGGAGATGATATATTAAGG + Intergenic
1053904864 9:42831303-42831325 AATTTGGAGATGATATATTAAGG + Intergenic
1054366586 9:64348310-64348332 AATTTGGAGATGATATATTAAGG + Intergenic
1054530125 9:66174220-66174242 AATTTGGAGATGATATATTAAGG - Intergenic
1054674214 9:67838050-67838072 AATTTGGAGATGATATATTAAGG + Intergenic
1055216737 9:73872720-73872742 AGTTTAGAGATGGAATCATCTGG - Intergenic
1056020907 9:82437545-82437567 AGTATAGAGAAGGTACAATAGGG + Intergenic
1057070987 9:92099780-92099802 AGTATAGAGAAGGTACAATAGGG - Intronic
1058007933 9:99939553-99939575 ATTTTAGAGATGTTAAAATGTGG + Intronic
1186628730 X:11324691-11324713 TCTTTAGAGATGGACTAAAATGG + Intronic
1186892183 X:13969805-13969827 TCTTTATAAATGGCATAATATGG - Intergenic
1187659351 X:21522655-21522677 ACCTTAGAGATGTTAAAATTGGG + Intronic
1188962191 X:36506284-36506306 ACTTTTAAAATAGTATAATAGGG - Intergenic
1189000062 X:36934411-36934433 ACTTATGAGATTGTATAACATGG + Intergenic
1189550659 X:42089120-42089142 AGGTTAGAGATGGAATTATAGGG - Intergenic
1193566271 X:83080982-83081004 TCTGTAAAGATGGAATAATAGGG - Intergenic
1193800696 X:85932368-85932390 ACTTTGGAAATGGTATTTTAAGG - Intronic
1194738006 X:97537404-97537426 ACTTAAGTGATGCTATAATAAGG + Intronic
1194958310 X:100206916-100206938 AATGTAAAGATGGTAAAATAAGG - Intergenic
1195511225 X:105717475-105717497 ACATTAGAGAAGGTGAAATAAGG + Exonic
1196001027 X:110786314-110786336 ACATTAGAGATGAAAGAATAGGG - Intronic
1196376480 X:115038856-115038878 ATTTTAGAGATGGGAAAATAAGG - Intergenic
1196611718 X:117722525-117722547 ACTTTAAAAATGTTATAACAAGG - Intergenic
1197343012 X:125296957-125296979 TCTTCAGAGATGATATATTAGGG - Intergenic
1198118290 X:133565923-133565945 ACTTTGGAGATGATAAAATTAGG - Intronic
1201511394 Y:14768450-14768472 ACTTTAGGGAAGGGATAAGATGG + Intronic