ID: 1144801998

View in Genome Browser
Species Human (GRCh38)
Location 17:17935694-17935716
Sequence TCATTGGTGGACTTTAGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 772
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 752}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144801998_1144802004 12 Left 1144801998 17:17935694-17935716 CCATCTCTAAAGTCCACCAATGA 0: 1
1: 0
2: 2
3: 17
4: 752
Right 1144802004 17:17935729-17935751 CCAAGAGCCATTAGGACATAAGG 0: 1
1: 0
2: 0
3: 8
4: 97
1144801998_1144802006 19 Left 1144801998 17:17935694-17935716 CCATCTCTAAAGTCCACCAATGA 0: 1
1: 0
2: 2
3: 17
4: 752
Right 1144802006 17:17935736-17935758 CCATTAGGACATAAGGAACGAGG 0: 1
1: 0
2: 1
3: 4
4: 55
1144801998_1144802002 4 Left 1144801998 17:17935694-17935716 CCATCTCTAAAGTCCACCAATGA 0: 1
1: 0
2: 2
3: 17
4: 752
Right 1144802002 17:17935721-17935743 ATCATGCTCCAAGAGCCATTAGG 0: 1
1: 0
2: 0
3: 14
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144801998 Original CRISPR TCATTGGTGGACTTTAGAGA TGG (reversed) Intronic
900002977 1:25137-25159 TCAATGGAGGAGTTCAGAGAAGG + Intergenic
900022697 1:195662-195684 TCAATGGAGGAGTTCAGAGAAGG + Intergenic
901751101 1:11409499-11409521 TCATTGGTTGACTTTTGTAATGG - Intergenic
903758720 1:25683128-25683150 TAATACCTGGACTTTAGAGATGG - Intronic
904579768 1:31534024-31534046 ACATTGCTGGTCTTTAGAGGAGG + Intergenic
904632445 1:31852587-31852609 TCATTGATGGACATTTGAGTTGG + Intergenic
906079200 1:43072811-43072833 TCATTTTTGTATTTTAGAGATGG - Intergenic
906431053 1:45756093-45756115 TCAGTAGTGGAATTTAGATAAGG + Intergenic
906551661 1:46670775-46670797 ACATTGGAGGACTATAAAGAGGG + Intronic
906726153 1:48045813-48045835 TCATTGTTGGACATTTGAGTTGG + Intergenic
907144450 1:52219695-52219717 TCAGTAGTGGAATTTAGATAAGG + Intronic
908177890 1:61573778-61573800 TCATTGGTGGACATTTGGGTTGG + Intergenic
908368110 1:63447923-63447945 TCATTGTTGGACTTTTGGGTTGG - Intronic
908449662 1:64239765-64239787 TCATTGGTGGACATTTGGGTTGG + Intronic
908811012 1:67982369-67982391 CCATTGGTGGAGGTCAGAGAAGG - Intergenic
908904402 1:68991546-68991568 TCATTGATGGACATTTGGGATGG - Intergenic
908945151 1:69486691-69486713 TCATTGCTGGACTTTTGGGTTGG + Intergenic
908970291 1:69820758-69820780 TCATTGATGGACATTTGAGTTGG + Intronic
909087651 1:71186611-71186633 TCATTGGTGGACATTTGGGTTGG + Intergenic
909663567 1:78109781-78109803 TCATTGTTGGACATTTGAGTTGG - Intronic
910242322 1:85100717-85100739 TCATTGTTGGACATTTGAGTTGG - Intronic
910291575 1:85604909-85604931 TCATTGTTACACTTTTGAGAGGG + Intergenic
910570935 1:88701917-88701939 TCATTGTAGGACTTTAGAGGAGG + Intronic
910618334 1:89225137-89225159 TCATTGATGGACATTTGAGTTGG + Intergenic
911536074 1:99102384-99102406 TCATTGTTGGACTTTTGGGTTGG - Intergenic
911724814 1:101232305-101232327 TCATTGGTGGACATTTGGGTTGG - Intergenic
912863497 1:113236335-113236357 TCATTGTCGGAGCTTAGAGATGG + Intergenic
913243525 1:116851467-116851489 TCATTGGTGGACATTTGGGTTGG + Intergenic
913341713 1:117764371-117764393 TCATTGATGGACGTTTGAGTTGG + Intergenic
913423288 1:118697315-118697337 TCATTGATGGACATTTGAGTTGG - Intergenic
914076793 1:144360228-144360250 TCATTGATGGACATTTGAGTTGG + Intergenic
914102385 1:144606269-144606291 TCATTGATGGACATTTGAGTTGG - Intergenic
915026540 1:152835959-152835981 TCATTGTTGGACATTTGAGTTGG - Intergenic
916299098 1:163254047-163254069 TCATTGCTGGACATTTGAGTTGG + Intronic
917042104 1:170816506-170816528 TCATTGATGGACATTTGAGTTGG - Intergenic
917313469 1:173701413-173701435 TCATTGGTGGACATTTGGGTTGG - Intergenic
917555848 1:176087849-176087871 TCATTGATGGACATTTGAGTTGG - Intronic
917693373 1:177491708-177491730 TCATTGGTGGACATTTGGGTTGG + Intergenic
917900274 1:179535620-179535642 TCATTGATGGACATTTGAGTTGG + Intronic
918467359 1:184834255-184834277 TCATTGGTGGACATTTGGGTGGG + Intronic
918505741 1:185252178-185252200 TCATTGGTGGACATTTGGGTTGG + Intronic
918530640 1:185517421-185517443 TCATTGGTGGACATTTGGGTTGG - Intergenic
918642323 1:186858003-186858025 TCATTGGTGAACATTTGAGTTGG + Intronic
918919518 1:190690360-190690382 TCATTGATGGACATTTGAGTTGG + Intergenic
918919741 1:190693131-190693153 TCATTGATGGACATTTGAGTTGG - Intergenic
918955663 1:191203877-191203899 TCATTGATGGACATTTGAGTCGG - Intergenic
918967669 1:191372881-191372903 TCATTGGTGGACATTTGGGTTGG + Intergenic
919094700 1:193018028-193018050 TCATTGGTACACTGTATAGAAGG - Intronic
920252053 1:204628346-204628368 TGAACGGTGGGCTTTAGAGACGG + Intronic
920992247 1:210950615-210950637 TCATTGTTGGACTTTTGGGTTGG + Intronic
921043706 1:211459095-211459117 TCATTGTTGGACATTTGAGTTGG - Intergenic
921467720 1:215510017-215510039 TCATTGTTGGACATTAGTGTTGG - Intergenic
922858869 1:228798330-228798352 TCAATGGAGGACTTTAGAGCTGG + Intergenic
923442899 1:234038360-234038382 TCATTGTTGGACATTTGAGTTGG + Intronic
923979233 1:239302145-239302167 TCATTGTTGGACATTTGAGTTGG - Intergenic
1063000197 10:1910655-1910677 TCATTGTTGGACATTTGGGACGG + Intergenic
1063477175 10:6339461-6339483 TCATTGGAGGGCTTTACAAAGGG + Intergenic
1064206790 10:13331231-13331253 TCATTGATGGACATTTGAGTTGG + Intronic
1064492368 10:15872918-15872940 TCATTGGTGGACATTTGGGTTGG + Intergenic
1064585983 10:16839810-16839832 TCATTGTTGGACATTTGGGATGG - Intronic
1064726314 10:18283414-18283436 TCATTGGTGGACATAAGGGTTGG - Intronic
1064942627 10:20752064-20752086 TCATTGTTGGACTTTTGGGTTGG + Intergenic
1065229901 10:23587287-23587309 TCATTGGTGGACATTTGGGTTGG + Intergenic
1065254434 10:23851409-23851431 TCATTGTTGGACATTTGAGTTGG + Intronic
1065364806 10:24925063-24925085 TCATTGATGGACATTTGAGTTGG - Intronic
1065452302 10:25871581-25871603 TCATTGTTGTTGTTTAGAGATGG + Intergenic
1065472572 10:26097783-26097805 TCATTGGTGGACATTTGGGTTGG + Intronic
1065848830 10:29769499-29769521 TCATTGGTGGACATTTGGGTTGG + Intergenic
1066170408 10:32837669-32837691 TCATTGTTGGACATTTGGGATGG - Intronic
1066182679 10:32978689-32978711 TCATTGGTGGACATTTGGGTTGG + Intronic
1066599431 10:37088678-37088700 TCATTGATGGACATTTGAGTTGG + Intergenic
1066608606 10:37210363-37210385 TCATTGATGGACATTTGAGTTGG + Intronic
1066846505 10:40023664-40023686 TCATTTGCAGACTTTACAGACGG - Intergenic
1066855360 10:40199211-40199233 TCATTTGCAGACTTTACAGACGG - Intergenic
1066861803 10:40327224-40327246 TCATTTGCAGACTTTACAGACGG - Intergenic
1066867007 10:40431123-40431145 TCATTTGCAGACTTTACAGACGG - Intergenic
1066889078 10:40867839-40867861 TCATTTGCAGACTTTACAGACGG - Intergenic
1066912047 10:41319335-41319357 TCATTTGCAGACTTTACAGACGG - Intergenic
1066916142 10:41399848-41399870 TCATTTGCAGACTTTACAGACGG - Intergenic
1066918826 10:41452851-41452873 TCATTTGCAGACTTTACAGACGG - Intergenic
1066920984 10:41495315-41495337 TCATTTGCAGACTTTACAGACGG - Intergenic
1067240857 10:44491900-44491922 TCATTGGTGGACATTTGGGTTGG - Intergenic
1067726192 10:48772943-48772965 TCATTGTTGGACTTTTGGGTTGG + Intronic
1068046199 10:51889456-51889478 TCATTGATGGACATTTGAGTTGG + Intronic
1068178696 10:53494400-53494422 TCATTGTTGGACATTTGAGTTGG + Intergenic
1068201838 10:53792743-53792765 TCATTGTTGGACATTTGAGTTGG + Intergenic
1068565476 10:58569788-58569810 TCATTGGTGGACATTTGGGTTGG + Intronic
1068655026 10:59565551-59565573 TCATTGATGGACATTAGGGTTGG + Intergenic
1068699996 10:60009683-60009705 TCAGTGATTGACTTTAGAGAGGG + Intergenic
1068834827 10:61542425-61542447 TTATCAGTGGAATTTAGAGATGG - Intergenic
1069484242 10:68811030-68811052 TCGTTGTTGTAGTTTAGAGACGG + Intergenic
1070159522 10:73857686-73857708 TCATTAGAGGACTTGAGAGCAGG + Intronic
1070455826 10:76614262-76614284 TCATTGTTGGACATTTGAGTTGG - Intergenic
1070701678 10:78606572-78606594 TCATTGTTGGACTTTTGGGCTGG + Intergenic
1070995254 10:80773114-80773136 TAATATGTGGACTTTAGTGAGGG + Intergenic
1071044338 10:81355538-81355560 TCATTGATGGACATTTGGGATGG - Intergenic
1071245640 10:83759517-83759539 TTACCGGTGGAATTTAGAGATGG - Intergenic
1071445847 10:85746267-85746289 TCTTTGGGGTCCTTTAGAGAGGG + Intronic
1072017744 10:91366044-91366066 TCATTGGTGGACATTTGGGTTGG - Intergenic
1072045404 10:91649880-91649902 TCATTGATGGACATTTGAGTTGG - Intergenic
1072051083 10:91703538-91703560 TCATTGATGGACATTTGAGTTGG + Intergenic
1072775328 10:98185762-98185784 TCATTGAAAGACTTTAGGGAGGG + Intronic
1072911152 10:99502523-99502545 ACATTGGTGGACTCTAGAGAAGG + Intergenic
1072928690 10:99640962-99640984 TCATTGGTGGACATTTGGGTTGG + Intergenic
1073979382 10:109137142-109137164 TCATTGATGGACATTTGAGTTGG - Intergenic
1074487139 10:113896260-113896282 TCATTGTTGGACATTTGAGTTGG - Intronic
1074605983 10:114966750-114966772 TCATTGGTGGTATATAGAAATGG + Intronic
1074728903 10:116347374-116347396 TCATTGGTGGCCTTCAGGAAAGG + Intronic
1075998875 10:126899666-126899688 TCATTGGTGGACATTTGGGTTGG - Intergenic
1077855734 11:6122483-6122505 TCATTGTTGGACATTTGAGTTGG - Intergenic
1077930990 11:6732713-6732735 TCATTGTTGGACATTTGAGCTGG - Intergenic
1077964923 11:7119518-7119540 TCACTGGTAGAGTATAGAGAGGG - Intergenic
1078032854 11:7770951-7770973 TCATTGGTGGACATTTGGGTTGG - Intergenic
1078972295 11:16427726-16427748 TCATTGTTGGACATTTGAGTTGG + Intronic
1079344924 11:19643561-19643583 TCATTGTTGGACATTAGGGTTGG + Intronic
1079346257 11:19655486-19655508 TCATTGTTGGACATTAGGGTTGG - Intronic
1079518877 11:21301141-21301163 TCATTGATGGACATTTGAGTTGG + Intronic
1079660213 11:23028509-23028531 TCATTGTTGGACATTTGAGTTGG + Intergenic
1080079977 11:28205503-28205525 TCATTGATGGACATTTGAGTTGG + Intronic
1080181223 11:29428719-29428741 TCATTGATGGACATTAGGGTTGG + Intergenic
1080209194 11:29766066-29766088 TCATTGTTGGACATTTGAGTTGG + Intergenic
1080365079 11:31564775-31564797 TCATTGGTGGACATTTGGGTTGG + Intronic
1081037272 11:38164402-38164424 TCATTGGTGGACATTTGGGTTGG + Intergenic
1081351441 11:42057466-42057488 TCATTGATGGACATTTGAGTTGG - Intergenic
1081359501 11:42157311-42157333 TCATTGGTGGACATTTGGGTTGG - Intergenic
1082613347 11:55329685-55329707 TCATTGATGGACATTTGAGTTGG + Intergenic
1082637943 11:55619530-55619552 TCATTGTTGGACATTTGAGTTGG + Intergenic
1082684863 11:56225210-56225232 TCATTGTTGGACATTTGAGTTGG - Intergenic
1082723690 11:56709808-56709830 TCATTGGTGGACATTTGGGTTGG + Intergenic
1082967688 11:58984344-58984366 TCATTGATGGACATTTGAGTTGG + Intronic
1083502691 11:63125554-63125576 TCATTGGTGGACATTTGGGTTGG + Intronic
1083502871 11:63127375-63127397 TCATTGGTGGACATTTGGGTTGG + Intronic
1083511399 11:63212411-63212433 TCATTGGTGGACATTTGGGTTGG - Intronic
1083513204 11:63231047-63231069 TCATTGGTGGACATTTGGGTTGG + Intronic
1085000438 11:73028579-73028601 ACTTTGGTGGACTGTTGAGACGG + Intronic
1086016174 11:82170102-82170124 TCATTGGTGGACATTTGGGTTGG + Intergenic
1086057369 11:82662824-82662846 TCATTGGTGGACATTTGGGTTGG - Intergenic
1086163173 11:83746321-83746343 TCATTGTTGGACATTTGAGTTGG - Intronic
1086388898 11:86340147-86340169 TCATTGGTGGACATTTGGGTTGG + Intronic
1087224289 11:95580534-95580556 TCATTGGTGGACATTTGGGTTGG + Intergenic
1087311634 11:96550757-96550779 TCATTGATGGACTTTTGGGTTGG - Intergenic
1087854242 11:103072505-103072527 TCATTGATGGACATTTGGGATGG - Intronic
1089636485 11:119817004-119817026 TCATTTGTGGATTTTAAAGTTGG + Intergenic
1090025490 11:123163937-123163959 TCATTGTTGCATTTTACAGAGGG - Intronic
1090987114 11:131777963-131777985 TCATTGGTGGATTTCAGGGAAGG + Intronic
1091245412 11:134089705-134089727 TCATTGGTGGACATTTGGGTTGG + Intronic
1091376395 12:27200-27222 TCAATGGAGGAGTTCAGAGAAGG + Intergenic
1091912694 12:4244673-4244695 TCATTTGGGGAGTTTAGGGAAGG - Intergenic
1093521214 12:20052137-20052159 TGGTTGGTGACCTTTAGAGATGG + Intergenic
1094062851 12:26333159-26333181 TCATTGTTGGACATTTGAGTTGG + Intergenic
1095567399 12:43641509-43641531 TCATTGGTGGACATTTGGGTTGG + Intergenic
1095720726 12:45397579-45397601 TCATTGGTGGACATTTGGGTTGG - Intronic
1095830529 12:46581447-46581469 TCATTGGTGGGCATTTGAGTTGG + Intergenic
1096010498 12:48210084-48210106 TCATTGTTGGACATTTGAGTTGG - Intergenic
1096044149 12:48547276-48547298 TCATTGATGGACATTTGAGTTGG + Intergenic
1097150420 12:56974349-56974371 TCATTGGTGGACATTTGGGTTGG - Intergenic
1097385459 12:58945403-58945425 TCATTGATGGACTTTTGGGTTGG + Intergenic
1097525994 12:60737112-60737134 TCATTGATGGACCTTTGAGTTGG - Intergenic
1097527140 12:60751209-60751231 TCATTGATGGCCATTAGAGTTGG - Intergenic
1097581196 12:61459083-61459105 TCATTGATGGACTTTTGGGTTGG - Intergenic
1098685131 12:73410115-73410137 TCATTGATGGACATTTGAGTTGG + Intergenic
1098688158 12:73451817-73451839 TCATTGATGGACATTTGAGTTGG + Intergenic
1098732885 12:74061292-74061314 TCATTGTTGGACATTTGAGTTGG - Intergenic
1098820269 12:75219009-75219031 TCATTGGTGGACATTTGGGTTGG + Intergenic
1099484289 12:83208970-83208992 TCATTGATGGACATTAGGGTTGG + Intergenic
1099761028 12:86920597-86920619 TCATTGGTGGACATTTGGGTTGG - Intergenic
1099813916 12:87621041-87621063 CCATAGGTGGACTTTACAGTGGG - Intergenic
1099900786 12:88709252-88709274 TCATTGTTGGACATTTGAGTTGG + Intergenic
1099994561 12:89764312-89764334 CCATTGGTGGACTTTTGGGTTGG - Intergenic
1100035083 12:90240741-90240763 TCATTGATGGACATTTGAGTTGG - Intergenic
1100749204 12:97678677-97678699 TCATTGGTGGACATTTGGGTTGG - Intergenic
1101705045 12:107213844-107213866 TCATTGATGGACATTTGAGTTGG - Intergenic
1101860831 12:108481186-108481208 TCATTGGGTAACTTTACAGATGG + Intergenic
1102385696 12:112507617-112507639 TCATTGGTTGACTTTTGTGATGG + Exonic
1104408182 12:128536135-128536157 TCATTGGTGGACATTTGGGTTGG - Intronic
1106594125 13:31122642-31122664 TCATGGGTGGACCTGAGAGTGGG - Intergenic
1106902299 13:34366724-34366746 TCATTGATGGACATTTGAGTTGG - Intergenic
1108429921 13:50343269-50343291 TCATTGGTGGACATTTGGGTTGG + Intronic
1109609542 13:64745236-64745258 TCAGAGGTTGACTCTAGAGATGG + Intergenic
1109837948 13:67883346-67883368 TCTTTGGTGGAGATTAGACATGG - Intergenic
1109946269 13:69436290-69436312 TCATTGGTGGACATTTGGGTTGG - Intergenic
1109948271 13:69466720-69466742 TCATTGATGGACATTTGAGTTGG + Intergenic
1110031604 13:70621724-70621746 TCAATGATGCACTTTAGAAATGG + Intergenic
1110129961 13:71995752-71995774 TCATTTGTTTGCTTTAGAGATGG + Intergenic
1110367052 13:74698665-74698687 TCATTGGTGGACATTTGGGTTGG + Intergenic
1111142247 13:84134425-84134447 TCATTGATGGACATTTGAGTTGG - Intergenic
1111566461 13:90023275-90023297 TCATTGATGGACATTTGAGTTGG + Intergenic
1111599702 13:90456882-90456904 TCATTGATGGACATTAGGGTTGG - Intergenic
1111793749 13:92891319-92891341 TCATTGTTGGACTTTTGGGTTGG - Intergenic
1112667995 13:101598832-101598854 TCATTGTTGGACATTTGAGTTGG + Intronic
1113228716 13:108188803-108188825 GCAGTGGTGAACTATAGAGATGG + Intergenic
1113488631 13:110675302-110675324 TCATTGGTGGACATTTGGGTTGG - Intronic
1113530210 13:111018904-111018926 TCATTGGTGGACATTTGGGTTGG + Intergenic
1113590574 13:111496504-111496526 TCATTGATGGACATTTGGGATGG + Intergenic
1113605900 13:111605491-111605513 TCATTGATGGACATTTGGGATGG + Intronic
1114160284 14:20158232-20158254 TCATTGTTGGACATTTGGGATGG - Intergenic
1114591669 14:23870813-23870835 TCATTGATGGACATTTGAGTTGG - Intergenic
1114651746 14:24289426-24289448 CCATTGGTGGATTTTAATGATGG + Intergenic
1114880830 14:26783926-26783948 TAATTGGTGGAACTTTGAGATGG - Intergenic
1115584713 14:34798978-34799000 TCATTGATGGACATTTGAGTTGG - Intronic
1115767391 14:36637359-36637381 TCATTGTTGGACATTTGAGTTGG + Intergenic
1116052360 14:39820429-39820451 TCATTGATGGACATTTGAGTTGG + Intergenic
1116193290 14:41687581-41687603 TCATTGATGGACATTTGAGTTGG - Intronic
1116212228 14:41962950-41962972 TCATTGATGGACTTTTGGGTTGG + Intergenic
1116704536 14:48280293-48280315 TCATTGTTGGACATTTGAGTTGG + Intergenic
1117082163 14:52163423-52163445 TCATTGATGGACATTCGAGTTGG - Intergenic
1117437138 14:55727020-55727042 TCATTGGTGGACATTTGGGTTGG + Intergenic
1117866078 14:60150713-60150735 TCATTGATGGACATTTGAGTTGG + Intronic
1118956135 14:70482432-70482454 TCATTGTTGGACATTTGAGTTGG - Intergenic
1119079309 14:71676873-71676895 TCATTGGTGGACATTTGGGTTGG + Intronic
1119111268 14:71976658-71976680 TCATTGTTGGACATTTGAGTTGG + Intronic
1119152466 14:72374443-72374465 TCATTGATGGACATTAGGGTTGG - Intronic
1120042868 14:79773372-79773394 TCATTGGTGGACATTTGGGTTGG - Intronic
1120102784 14:80464358-80464380 ACATTGGGGGACTGTTGAGAAGG - Intergenic
1120499331 14:85275049-85275071 TCATTGATGGACTTTTGGGTTGG + Intergenic
1121263697 14:92584775-92584797 TCATTGATGGGCTTTGAAGATGG + Intronic
1121392451 14:93587945-93587967 TCATTGGTAGAGATTTGAGATGG + Intronic
1121759060 14:96428360-96428382 TCATTGATGGACATTTGAGTTGG + Intronic
1123786592 15:23681086-23681108 TCATTGATGGACATTTGAGTTGG - Intergenic
1124667257 15:31604188-31604210 TCATTGGTGGACATTTGGGCTGG - Intronic
1124795250 15:32771908-32771930 ACATTGGTGGACTTGGGAGGGGG + Exonic
1125619134 15:41043478-41043500 TAATTTTTGGACTTTGGAGAGGG - Intronic
1125912254 15:43451581-43451603 TCATTGTTGGACATTTGGGATGG + Intronic
1126071773 15:44871883-44871905 TCATTGGTGGACATTAGGGTTGG - Intergenic
1127050615 15:55079816-55079838 TCATTGTTGGACATTTGAGTTGG - Intergenic
1127347138 15:58112268-58112290 TCATCTGTGGACCTTATAGAGGG + Intronic
1128249440 15:66154103-66154125 TCATTGGTGGGTGTCAGAGAAGG - Intronic
1128958303 15:71972864-71972886 TTATCAGTGGAATTTAGAGATGG + Intronic
1129010975 15:72416906-72416928 TCATTGTTGGACTTTTGGGTTGG - Intergenic
1129546203 15:76398225-76398247 TCATTGATGGAGTTCAGAGGAGG - Intronic
1130799737 15:87250159-87250181 TCATTGTTGGACATTTGAGTTGG + Intergenic
1131822118 15:96284101-96284123 TGATTGGTGGACAATAGAAAAGG + Intergenic
1132450529 15:101965802-101965824 TCAATGGAGGAGTTCAGAGAAGG - Intergenic
1132504772 16:302253-302275 TCCTTGGGGGACTGTGGAGAAGG + Intronic
1133975386 16:10596567-10596589 TCACTGTTGCACTTTGGAGATGG + Intergenic
1135190939 16:20354152-20354174 TCATTGATGGACATTTGAGTTGG + Intronic
1136109563 16:28056214-28056236 TCATTGTTGGACATTTGAGTTGG - Intronic
1136694926 16:32070246-32070268 TCATTGATGGACATTTGAGTTGG + Intergenic
1136795427 16:33013506-33013528 TCATTGATGGACATTTGAGTTGG + Intergenic
1137360306 16:47808369-47808391 TCATTGGTGGACATTTGGGTTGG + Intergenic
1137363071 16:47838244-47838266 TCATTGGTGGACATTTGGGTTGG - Intergenic
1137371972 16:47915588-47915610 TCATTGGTGGACATTTGGGTTGG - Intergenic
1137525626 16:49233820-49233842 TCATTGATGGACTTTTGGGTTGG - Intergenic
1139183611 16:64776331-64776353 TCATTGTTGGACATTTGAGTTGG - Intergenic
1140684427 16:77419440-77419462 TCCATTGTGGACTTTGGAGATGG - Intronic
1203097681 16_KI270728v1_random:1275168-1275190 TCATTGATGGACATTTGAGTTGG + Intergenic
1144014808 17:11183811-11183833 TCATTGATGGACATTTGAGTTGG + Intergenic
1144801998 17:17935694-17935716 TCATTGGTGGACTTTAGAGATGG - Intronic
1146700994 17:34960200-34960222 TCATTGGAGGACTTTTGATCAGG - Intronic
1147738445 17:42655836-42655858 TTACTAGTGGAATTTAGAGATGG + Intergenic
1148949195 17:51294596-51294618 TCATTGTTGGACATTTGAGTTGG + Intronic
1149229217 17:54513552-54513574 TCATTGATGGACCTTGGAGTTGG + Intergenic
1149346153 17:55738341-55738363 TCATTGGAGCATTTTAGGGAGGG + Intergenic
1149346387 17:55740602-55740624 TCATGGGAGGATTTTAGGGAGGG + Intergenic
1150857900 17:68770723-68770745 TCATTGATGGACATTAGGGTTGG + Intergenic
1152905243 17:82966592-82966614 TCAGTGGTGGAAATGAGAGATGG + Intronic
1154381734 18:13857682-13857704 TCATTGGTGGACATTTGGGTTGG + Intergenic
1155102132 18:22621943-22621965 TCATTGATGGACATTTGAGTTGG - Intergenic
1155190740 18:23427763-23427785 TCATTGGTGGACATTTGGGTTGG - Intronic
1155260952 18:24041917-24041939 ACACTGGTGGCCTATAGAGAGGG - Intronic
1156293067 18:35765993-35766015 TCATTGTTGGACATTTGAGTTGG - Intergenic
1156470105 18:37372225-37372247 TCATTGGTGGACATTTGGGTTGG - Intronic
1156572142 18:38268362-38268384 TCATTGATGGACTTTTGGGTTGG - Intergenic
1156733985 18:40230212-40230234 TCATTGATGGACATTTGAGTTGG + Intergenic
1156936618 18:42716602-42716624 TCATTGTTGGACTTTTGGGTTGG - Intergenic
1157025794 18:43841213-43841235 TCATTGGTGGACATTTGGGTTGG - Intergenic
1157420003 18:47539215-47539237 TCATTGGTGGACATTTGGGTTGG + Intergenic
1158365063 18:56725050-56725072 TCATTGTTGGACATTTGAGTTGG + Intronic
1158571611 18:58601294-58601316 TCATAGGTGGCTTTTTGAGAAGG + Intronic
1158740260 18:60134055-60134077 TCATTGATGGACATTTGAGTTGG - Intergenic
1159271844 18:66163469-66163491 TCATTGGTGGACATTTGGGTTGG - Intergenic
1159383081 18:67687893-67687915 TCATTGGTGGACATTTGGGTTGG + Intergenic
1159423055 18:68248274-68248296 TCATTGGTGGACATTTGGGTTGG + Intergenic
1159651826 18:70986958-70986980 TCTTTGGAGGACTGTTGAGAGGG + Intergenic
1160607331 18:80061387-80061409 TCATTGGTGGACATTTGGGTTGG + Intronic
1160634728 19:66745-66767 TCAATGGAGGAGTTCAGAGAAGG + Intergenic
1162632081 19:11936104-11936126 TCATTGGTGGACATTTGGGTTGG + Intronic
1162640500 19:12005210-12005232 TCATTGGTGGACATTTGGGTTGG + Intergenic
1163225216 19:15955780-15955802 TCATAGGTGGATTTTGGGGAAGG + Intergenic
1164266111 19:23619243-23619265 TCATTGTTGGACATTAGGGTTGG - Intronic
1164482721 19:28626543-28626565 TCATTGGTGGACATTTGGGTTGG - Intergenic
1164755650 19:30686978-30687000 TCAGTGGAGGACTTTAGAAGGGG - Intronic
1165605559 19:37100799-37100821 TCATTGGTGGTATTTTGATAGGG + Intronic
1165972407 19:39643081-39643103 TCATTGATGGACTTTTGGGTTGG - Intergenic
1166164047 19:40974204-40974226 TCATTGATGGACATTTGAGTTGG - Intergenic
1166591140 19:44000308-44000330 TCATTGGTGGACATTTGGGTTGG + Intergenic
1168533442 19:57149098-57149120 TCATTGTTGGACGTTTGAGTTGG - Intergenic
925116522 2:1383122-1383144 TCATTGTTGGACATTAGGGTTGG + Intronic
925846701 2:8041191-8041213 TCATTGTTGGACATTTGAGTTGG + Intergenic
927071486 2:19535441-19535463 TCATTGGTGGACTCTACTAAAGG + Intergenic
927273626 2:21241337-21241359 TCATTGTTGGACATTTGAGTTGG + Intergenic
927773790 2:25886331-25886353 TGATTGGTGTACTTGAGGGATGG - Intergenic
928278918 2:29926992-29927014 TCATTGATGGACATTTGAGTTGG - Intergenic
928368103 2:30718341-30718363 TCATTGGTGGACATTTGGGTTGG + Intergenic
928475666 2:31624754-31624776 TCATTGATGGACTTTTGGGCTGG + Intergenic
928754487 2:34508007-34508029 TCATTGATGGACATTTGAGTTGG - Intergenic
930908169 2:56598779-56598801 TCATTGGTGGACATTTGGGTTGG + Intergenic
930908343 2:56600701-56600723 TCATTGGTGGACATTTGGGTTGG + Intergenic
931989322 2:67773969-67773991 TCAATGGTGGAATTTAGCCAGGG - Intergenic
932513745 2:72323579-72323601 TCATTGATGGACATTTGAGTTGG - Intronic
933130751 2:78672293-78672315 TCAGTGGTGTAATTCAGAGATGG + Intergenic
933928539 2:87124159-87124181 TCATTGTTGGACTTTTGGGTTGG - Intergenic
934065953 2:88342190-88342212 TCATTGATGGACATTTGAGTTGG - Intergenic
935003798 2:99049324-99049346 TCATTGATGGACATTTGAGTTGG - Intronic
935477070 2:103535461-103535483 TCATTGTTGGACATTTGAGTTGG + Intergenic
935799621 2:106681012-106681034 TCATTGTTGGACTTTTGGGTTGG + Intergenic
936478174 2:112859512-112859534 TCATTGGTGGGCATTAGGGTTGG - Intergenic
936566750 2:113588282-113588304 TCAATGGAGGAGTTCAGAGAAGG - Intergenic
936606924 2:113967916-113967938 TAATTTTTGTACTTTAGAGACGG + Intergenic
936720030 2:115239999-115240021 TCATTGATGGACATTAGAGTTGG + Intronic
936749885 2:115629212-115629234 TCATTGGTGGACATTTGGGTTGG + Intronic
936750208 2:115633175-115633197 TCATTGGTGGACATTTGGGTTGG - Intronic
936858188 2:116985088-116985110 TCATTGGTGGACATTTGGGTTGG - Intergenic
937641476 2:124216786-124216808 TCATTGATGGACATTTGAGTTGG + Intronic
938692437 2:133804678-133804700 TAAATGCTGGTCTTTAGAGAGGG - Intergenic
939479783 2:142733594-142733616 TCATTGCTGGACATTTGAGTTGG - Intergenic
939710961 2:145519532-145519554 TCATTGATGGACTTTTGGGTTGG + Intergenic
939743976 2:145946582-145946604 TCATTGGTGGACATTTGGGTTGG + Intergenic
939763252 2:146211382-146211404 TCATTGGTGGACATTTGGGTTGG - Intergenic
939845217 2:147235492-147235514 TCATTTGTGGACATTTGAGTTGG - Intergenic
940066544 2:149636285-149636307 TCATTGATGGACATTTGAGTCGG + Intergenic
940536733 2:154955042-154955064 TCATTGTTGGACATTTGAGTTGG + Intergenic
940623375 2:156142438-156142460 TCATTGATGGACATTAGGGTTGG - Intergenic
940643937 2:156370662-156370684 TCATTGATGGACATTAGGGTTGG + Intergenic
940679783 2:156771769-156771791 TCATTGGTGGACATTTGGGTTGG + Intergenic
940697380 2:156996680-156996702 TCATTGGTGGACATTTGGGTTGG - Intergenic
941075068 2:160997894-160997916 TCATTGTTGGACATTTGAGTTGG + Intergenic
941213736 2:162678510-162678532 TTATTGGTAGACTTTATACAAGG - Intronic
941577931 2:167258350-167258372 ACATGGGTGGACTGTAGATAAGG - Exonic
941743405 2:169060547-169060569 TCATTGTTGGACATTTGAGTTGG + Intergenic
941766958 2:169308619-169308641 TCATTGATGGACTTTTGGGTTGG + Intronic
941845972 2:170133648-170133670 TCATTGGTGGACATTTGGGTTGG - Intergenic
942955397 2:181767028-181767050 TCATTGATGGACTTTTGGGTTGG + Intergenic
943031610 2:182692264-182692286 TCATTGTTGGACATTTGAGTTGG - Intergenic
943131194 2:183855133-183855155 TCATTGTTGGACATTTGAGTTGG - Intergenic
943500467 2:188682308-188682330 TCATTGATGGACGTTTGAGTTGG - Intergenic
943928745 2:193821932-193821954 TCATTGTTGGACATTTGAGTTGG - Intergenic
944261490 2:197682545-197682567 TCATTGATGGACTTTTGGGTTGG + Intergenic
944613817 2:201439678-201439700 TCATTGTTGGACATTTGAGCAGG - Intronic
944655049 2:201869123-201869145 TCATTGATGGACATTTGAGTTGG - Intronic
945117038 2:206418102-206418124 TCATTGGTGGACATTTGAGTTGG + Intergenic
945418012 2:209598844-209598866 TCATTGGTGGACATTTGGGTTGG + Intronic
945429353 2:209746578-209746600 TCATTGGTGGACATTTGGGTTGG + Intergenic
946658020 2:221969890-221969912 TCGTTGGAGAGCTTTAGAGAGGG + Intergenic
948030654 2:234814832-234814854 TCATAGGTGGAATTTACAAAAGG - Intergenic
948079365 2:235192867-235192889 TCATTGGTGGACATTTGGGTTGG + Intergenic
948618727 2:239219213-239219235 TCATTGTTGGACTTTTGGGTTGG - Intronic
1169735735 20:8835605-8835627 TCATTTGTGGACTCTTGAGTAGG + Intronic
1169821455 20:9715640-9715662 TCATTGTTGGACATTTGAGTTGG - Intronic
1170122907 20:12929287-12929309 TCATTTGTGTAGTTTAGATAAGG + Intergenic
1170212755 20:13861695-13861717 TCATTGGAGGATTTTACACAAGG - Intronic
1170521116 20:17186505-17186527 TCATTGATGGACATTTGAGTTGG - Intergenic
1171068279 20:22040859-22040881 TCATTGTTGGACATTTGGGATGG + Intergenic
1171246682 20:23615746-23615768 TCATTGGTGGACCTTTGGGTTGG + Intergenic
1171352721 20:24516895-24516917 TCATTGATGGACATTTGGGATGG - Intronic
1171567082 20:26204907-26204929 TCATTGGTGGACATTTGGGTTGG - Intergenic
1171764703 20:29252992-29253014 TCATTGTTGGACATTTGAGTTGG - Intergenic
1171836503 20:30156374-30156396 TCATTGTTGGACATTTGAGTTGG - Intergenic
1172317838 20:33970119-33970141 TCATAGGCATACTTTAGAGAAGG + Intergenic
1173006549 20:39143882-39143904 TCATTGTTGGACATTAGGGTTGG - Intergenic
1173053093 20:39584198-39584220 TCATTGTTGGACATTAGGGTTGG + Intergenic
1173104294 20:40118372-40118394 TCATTGGTGGCCATCAAAGATGG - Intergenic
1174989403 20:55492888-55492910 TCATTGATGGACATTAGGGTTGG + Intergenic
1175018151 20:55813891-55813913 TCATTGATGGACATTTGAGTTGG + Intergenic
1175709046 20:61204703-61204725 TCATTGGCAGACTTGAGGGATGG - Intergenic
1177688868 21:24477243-24477265 TCATTGATGGACATTTGAGTTGG - Intergenic
1178483387 21:33000405-33000427 CCATTTTTCGACTTTAGAGAAGG - Intergenic
1179320139 21:40283601-40283623 TCTTTGCTGGTCTGTAGAGAGGG + Intronic
1180640418 22:17293693-17293715 TCATTGGTGGACATTTGGGTTGG + Intergenic
1181832483 22:25572254-25572276 TCATTGGTGGACATTTGGGTTGG + Intronic
1182152817 22:28042324-28042346 TCATTGTTGGACATTAGGGTTGG - Intronic
1182695630 22:32197804-32197826 TCATTGATGGACTTTTGGGTTGG + Intronic
1183667257 22:39253172-39253194 CCACTGGTGGTCTTTAGGGAAGG - Intergenic
1184755988 22:46516201-46516223 TCATTGGTGGACATTTGGGTTGG - Intronic
949427558 3:3935606-3935628 TCATTGATGGACATTTGAGTTGG + Intronic
949646544 3:6101540-6101562 TCATTGTTGGACATTTGAGTTGG + Intergenic
949889325 3:8721678-8721700 TCATTGTTGGACATTTGAGTTGG - Intronic
951111810 3:18812754-18812776 TGATTGGTGAACTTGGGAGAAGG + Intergenic
951172444 3:19557403-19557425 TCATTGGTGGACATTTGGGTTGG + Intergenic
951198716 3:19854224-19854246 TCATTGGTGGACATTTGAGTTGG - Intergenic
951300405 3:20989401-20989423 TCATTGGTGGACATTTGGGTTGG + Intergenic
951992172 3:28687560-28687582 TCATTGGTGGACATTTGGGTTGG + Intergenic
952030079 3:29131409-29131431 TCATTGGTGGACATTTGGGTTGG - Intergenic
952048734 3:29357445-29357467 TCATTGGTGGACATTTGGGTTGG + Intronic
952634836 3:35516741-35516763 TCATTGTTGGACATTTGAGTTGG + Intergenic
952734626 3:36676709-36676731 TCATTGTTGGACATTTGGGATGG - Intergenic
953255157 3:41283391-41283413 TCATTGGTGGACATTTGGGTTGG - Intronic
954373960 3:50184613-50184635 TCCTTGGTGGACTTCATAGATGG - Exonic
954790620 3:53130489-53130511 TGATTGATGGCCTTGAGAGAGGG + Intergenic
954996779 3:54889095-54889117 ACATTGGAGGAATTTAAAGAAGG + Intronic
955785238 3:62530802-62530824 GCATTTGTTGACTTTGGAGAGGG + Intronic
956001223 3:64732002-64732024 TCATTGGTGGACATTTGGGTTGG - Intergenic
956243237 3:67153382-67153404 TCATTGTTGGACTTTTGGGTTGG - Intergenic
956464256 3:69503279-69503301 TCATTGATGGACATTTGAGTTGG - Intronic
956471797 3:69574752-69574774 TCATTGATGGACATTTGAGTTGG + Intergenic
957133125 3:76248235-76248257 TCATTGGTGGACATTTGGGTTGG - Intronic
957141144 3:76359169-76359191 TCATTGTTGGACATTTGAGTTGG + Intronic
957169247 3:76716670-76716692 TCATTAGTGGTCTATAGAGAAGG - Intronic
957603623 3:82370705-82370727 TCATTGGTGGACATTTGGGTTGG + Intergenic
957704811 3:83766945-83766967 TCTTCAGTGGACTTTAAAGAAGG + Intergenic
957753632 3:84457708-84457730 TCATTGATGGACATTTGAGTTGG - Intergenic
958030287 3:88100554-88100576 TCATTGATGGACATTTGAGTTGG - Intronic
958066048 3:88545666-88545688 ACTTTGGAGGACTTTAGGGAAGG + Intergenic
958140059 3:89550910-89550932 TCATTGTTGGACTTTTGGGTTGG + Intergenic
958202655 3:90339684-90339706 TCATTGTTGGACATTTGAGTTGG - Intergenic
958412797 3:93837992-93838014 TCATTGTTGGACATTTGAGTTGG - Intergenic
958460328 3:94386353-94386375 TCATTGATGGACATTTGAGTTGG - Intergenic
958501135 3:94910686-94910708 TCATGGGTGGTCTGTGGAGATGG + Intergenic
958751721 3:98200060-98200082 TCATTGATGGACATTTGGGATGG - Intergenic
958980237 3:100710742-100710764 TCATTTCTGGACTTCAGAGGGGG + Intronic
959500701 3:107103084-107103106 TCATTGGTTGACTTTTGTAACGG - Intergenic
959944252 3:112110907-112110929 CCATTGGGGGTCTTTAAAGAAGG - Intronic
960746537 3:120896603-120896625 TCATTGTTGGACTTTTGGGTTGG + Intergenic
961419144 3:126786224-126786246 TCATTGTTGGACATTTGAGTTGG + Intronic
962004747 3:131337209-131337231 TCATTGTTGGACATTTGAGTGGG - Intronic
962142756 3:132807486-132807508 TCATTGTTGGACATTTGAGTTGG + Intergenic
962155669 3:132946402-132946424 TCATTGTTGGACATTTGAGTTGG + Intergenic
962657335 3:137561333-137561355 TCATTGGTGGACATTTGGGTTGG - Intergenic
963580828 3:147124594-147124616 TCATTGGTGGACATTTGGGTTGG + Intergenic
963858945 3:150286790-150286812 TTACTGGTGGATTTTAGTGATGG - Intergenic
963934633 3:151039426-151039448 TCATTGGTGGACATTTGGGTTGG + Intergenic
963963791 3:151341974-151341996 TCATTGTTGGACTTTTGGGTTGG + Intronic
964084922 3:152805242-152805264 TCATTGGTGGACATTTGGGTTGG + Intergenic
964144809 3:153447045-153447067 TCATTGATGGACATTTGAGTTGG - Intergenic
964390761 3:156195182-156195204 TCATTGATGGACATTTGAGTAGG + Intronic
964424147 3:156534102-156534124 TCTTGGGTGGACTTTAGTGCTGG - Intronic
964572381 3:158122976-158122998 TCATTGATGGACATTTGAGTTGG + Intronic
964759537 3:160121674-160121696 TCATTGATGGACATTTGAGTTGG - Intergenic
966492331 3:180541852-180541874 TCATTGTTGGACATTTGAGTTGG - Intergenic
966682688 3:182660032-182660054 TCATGGGTGTGATTTAGAGAGGG - Intergenic
967718898 3:192794478-192794500 TCAGCAGTGGTCTTTAGAGAAGG - Intergenic
970109458 4:12621080-12621102 TTGTTGCTGGACTTAAGAGAAGG - Intergenic
970612067 4:17734925-17734947 TCATTGCTGGACATTTGAGTTGG - Intronic
970856994 4:20660477-20660499 TCATTGTTGGACATTTGAGTTGG + Intergenic
971693856 4:29872606-29872628 TCATTGTTGGACATTTGGGATGG + Intergenic
971770272 4:30886717-30886739 TCATTGTTGGACGTTTGAGTTGG - Intronic
971920820 4:32936999-32937021 TCATTGGTGGACATTTGGGTTGG + Intergenic
971970860 4:33618683-33618705 TCATTGTTGGACATTTGAGTTGG - Intergenic
972964825 4:44496793-44496815 TCATTGGTGGACATTCGGGTTGG + Intergenic
973064578 4:45772880-45772902 TCATTGTTGGACATTTGAGTTGG + Intergenic
973648686 4:52975767-52975789 TCATTGTTGGACATTTGAGTTGG - Intronic
973669492 4:53201421-53201443 TCATTGTTGGACATTTGGGATGG + Intronic
973674778 4:53253483-53253505 TCATTGTTGGACATTTGGGATGG - Intronic
973731200 4:53824027-53824049 TCATTGGTGGACATTTGGGTTGG + Intronic
974253972 4:59425376-59425398 TCATTGATGGACTTTTGGGTTGG - Intergenic
974254625 4:59432967-59432989 TCATTGGTGGACATTTGGGTTGG - Intergenic
974643687 4:64666750-64666772 TCATTGTTGGACATTTGAGTTGG - Intergenic
974712089 4:65611194-65611216 TCATTGTGAGACATTAGAGATGG + Intronic
974758399 4:66243080-66243102 TCATTGGTGGACATTTGGGTTGG + Intergenic
975002229 4:69238710-69238732 TCATTGATGGACATTTGAGTTGG - Intergenic
975166214 4:71180959-71180981 TCATTGTTGGACATTTGAGTTGG - Intergenic
975218958 4:71792062-71792084 TCATTGATGGACATTTGGGATGG + Intronic
976833984 4:89348907-89348929 TCATTGGTGGACATTTGGGTTGG + Intergenic
976837771 4:89394940-89394962 TCATTGGTGGACATTTGGGTTGG - Intergenic
977755759 4:100669936-100669958 TCATTGTTGGACTTTTGGGTTGG - Intronic
977819375 4:101454256-101454278 TCATTGGTGGACATTTGGGTTGG + Intronic
977974679 4:103250663-103250685 TCATTGTTGGACATTAGGGTTGG + Intergenic
978132993 4:105222111-105222133 TCATTGTTGGACATTAGGGTTGG + Intronic
978185503 4:105852510-105852532 TCATTGATGGACTTTTGGGTTGG + Intronic
978337149 4:107681576-107681598 TTATGGGTGGATTCTAGAGAGGG - Intronic
978600511 4:110422545-110422567 TCATTGATGGACATTTGAGCTGG - Intronic
978695379 4:111570831-111570853 TCATTGATGGACATTTGAGTTGG - Intergenic
979371022 4:119886485-119886507 TCATTGTTGGACTTTTGGGTTGG + Intergenic
980199412 4:129636174-129636196 TCATTGGTGGACATTTGGGTTGG + Intergenic
980307174 4:131076621-131076643 TCATTGTTGGACATTTGAGTTGG - Intergenic
980375745 4:131946118-131946140 TCATTGGTGGGCATTTGAGTTGG - Intergenic
980610054 4:135148578-135148600 TCATTGATGGACATTGGAGTTGG + Intergenic
980765350 4:137296181-137296203 TCAGTGGTGGGCTTGATAGAAGG + Intergenic
981208464 4:142072081-142072103 TCATTGATGGACTTTTGGGTTGG - Intronic
981244909 4:142524054-142524076 TCATTGTTGGACATTTGGGATGG + Intronic
982120947 4:152143267-152143289 TCATTGATGGACTTTTGGGTTGG - Intergenic
982328616 4:154156824-154156846 TCATTGGTGGACATTTGGGTTGG + Intergenic
982525092 4:156467632-156467654 TCATTGATGGACTTTTGGGTTGG + Intergenic
982648076 4:158049066-158049088 TCATTGATGGGCATTAGAGTTGG - Intergenic
982746258 4:159105886-159105908 CCTTTGGTGGAAATTAGAGAAGG + Intronic
983159467 4:164393444-164393466 TCATTGGTGGACATTTGGGTTGG - Intergenic
983181538 4:164654807-164654829 TCATTGTTGGACATTTGAGTTGG - Intergenic
983407011 4:167343914-167343936 TCATTGTTGGACATTAGGGTTGG + Intergenic
983418685 4:167490400-167490422 TCATTGATGGACTTTTGGGTTGG - Intergenic
985108664 4:186524196-186524218 TCATTGTTGGACATTTGAGTTGG + Intronic
985501119 5:246663-246685 TAATTCATGGACTCTAGAGAAGG + Intronic
985613703 5:906523-906545 TCTTTTGTGGACTTTTGACATGG + Intronic
986432854 5:7698784-7698806 TCGTTGGTGGACTTTTGGGTTGG + Intronic
987526150 5:19052773-19052795 TCATTGTTGGACTTTTGGGTTGG - Intergenic
987698193 5:21359212-21359234 TCATTGATGGACATTTGAGTTGG - Intergenic
987725502 5:21694050-21694072 TCACTGTTGGCCTTTAGATAAGG - Intergenic
987988045 5:25175511-25175533 TCATTGATGGACTTTTGGGTTGG + Intergenic
988629312 5:32912192-32912214 TCATTGTTGGACATTTGAGTTGG - Intergenic
988918323 5:35918201-35918223 TCATTGATGGACATTTGAGTTGG - Intronic
989064640 5:37447531-37447553 TCATTGATGGACATTTGAGTTGG - Intronic
989244820 5:39242536-39242558 TCATTGGTGGACATTTGGGTTGG + Intronic
989303053 5:39917099-39917121 TCATTGGTGGACATTTGGGTTGG - Intergenic
989607722 5:43261007-43261029 TCATTGGTGGACATTTGGGTTGG + Intronic
989648405 5:43661807-43661829 TCATTGGTGGACATTTGGGTTGG + Intronic
989649123 5:43667664-43667686 TCATTGGTGGACATTTGGGTTGG + Intronic
989683706 5:44060285-44060307 TCATTGATGGACATTTGGGATGG + Intergenic
989760998 5:45016180-45016202 TGATTGGTGCATTTTACAGAGGG + Intergenic
989803923 5:45580934-45580956 TCATTGTTGGACATTTGAGTTGG + Intronic
990030797 5:51256351-51256373 TCATTGGTGGACATTTGGGTTGG - Intergenic
990035206 5:51310226-51310248 TCATTGGTGGACATTTGGGTTGG - Intergenic
990036771 5:51331177-51331199 TCATTGGTGGACATTTGGGTTGG + Intergenic
990038791 5:51354405-51354427 TCATTGGTGGACATTTGGGTTGG - Intergenic
990067591 5:51737524-51737546 TCATTGGTGGACATTTGGGTTGG + Intergenic
990084496 5:51957522-51957544 TCATTGGTGGACATTTGGGTTGG - Intergenic
990099764 5:52167220-52167242 TCATTGGTGGACATTTGGGTTGG + Intergenic
990228597 5:53685854-53685876 TCATTGTTGGACATTTGAGTTGG + Intergenic
990694206 5:58396863-58396885 TCAGTGGTGGACTCTTGAAAGGG + Intergenic
990750968 5:59015868-59015890 TCATTGGTGGACATTTGGGTTGG - Intronic
990829033 5:59935853-59935875 TCATTGGTGGACATTTGGGTTGG + Intronic
990842258 5:60095447-60095469 TCATTGATGGACTTTTGGGTTGG + Intronic
991566251 5:68008199-68008221 TCATTGGTGGACATTTGGGTTGG + Intergenic
992071754 5:73155108-73155130 TTATTGGTGGGCTTTTTAGAGGG + Intergenic
992304156 5:75418578-75418600 TCATTGGTGGACATTTGGGTCGG - Intronic
992659003 5:78939678-78939700 TCATTGGTGGACATTTGGGTTGG + Intronic
993163480 5:84319745-84319767 TCATTGATGGACATTTGAGTTGG - Intronic
993528258 5:88993370-88993392 TCATTGGTGGACATTTGTGTTGG - Intergenic
993532336 5:89039908-89039930 TCATTGATGGACATTTGAGTTGG - Intergenic
993937281 5:94020008-94020030 TCATTGATGGACATTTGAGTTGG - Intronic
994049140 5:95343053-95343075 TCATTGTTGGACATTAGGGTTGG + Intergenic
994223044 5:97218872-97218894 TCATTGGTGGACATTTGGGTTGG + Intergenic
994288362 5:97997038-97997060 TCATTGGTGGACATTTGGGTTGG - Intergenic
994472124 5:100220522-100220544 TCATTGGTGGACATTTGGGTTGG - Intergenic
994652934 5:102551960-102551982 TCATTGATGCACATTTGAGATGG + Intergenic
994835646 5:104848884-104848906 TCATTGGTGGACATTTGGGTTGG + Intergenic
994987946 5:106962051-106962073 TCATTGATGGACATTTGAGTTGG - Intergenic
995028492 5:107451968-107451990 TCATTGATGGACCTTTGAGTTGG - Intronic
995489330 5:112673889-112673911 TCATTGGTGGACATTTGGGCTGG + Intergenic
996455341 5:123674961-123674983 TCATTGTTGGACTTTTGGGTTGG + Intergenic
996934922 5:128937976-128937998 TCATTGATGGACATTTGAGTTGG + Intronic
997095476 5:130905692-130905714 TCATTGTTGGACATTTGAGTTGG + Intergenic
997097457 5:130929279-130929301 TCATTGATGGACATTTGAGTTGG - Intergenic
997579992 5:135011171-135011193 TGCTTGGAGGGCTTTAGAGATGG + Intronic
998094213 5:139388220-139388242 GCATTTGTGGAATTCAGAGAGGG + Intronic
999064246 5:148668600-148668622 TCATTGGTGGACATTTGGGTTGG + Intronic
999664621 5:153899574-153899596 CCATTGCTGGCTTTTAGAGATGG - Intergenic
999703106 5:154246205-154246227 TCATTGTTGGACATTTGAGTTGG + Intronic
999977833 5:156929504-156929526 TGATTGGTGTCCTTAAGAGAAGG + Intronic
999997471 5:157106089-157106111 TCATGGGTGGAATGTATAGATGG - Intronic
1001016328 5:168144577-168144599 TCATTGTTGGACATTTGAGTTGG + Intronic
1001863888 5:175085690-175085712 TCATTGTTGGACTTTTGGGTTGG + Intergenic
1003296185 6:4831000-4831022 TCATTGTTGGACATTAGGGTTGG + Intronic
1004137701 6:12983943-12983965 TCATTGATGGACATTTGAGTTGG + Intronic
1004187193 6:13430904-13430926 TGATGGCTGGACTGTAGAGAGGG - Intronic
1004391630 6:15214939-15214961 TAATTGTTGAACTTGAGAGATGG + Intergenic
1006207302 6:32358811-32358833 TCATTGATGGACTTTTGGGTTGG + Intronic
1006207525 6:32361276-32361298 TCATTGATGGACTTTTGGGTTGG + Intronic
1006881713 6:37345645-37345667 TCATTGGTGGACATTTGGGTTGG + Intergenic
1008072968 6:47116482-47116504 TCTTTGGTGGAGATGAGAGAAGG - Intergenic
1008154939 6:48002353-48002375 TCATTGTTGGACATTTGAGTTGG - Intronic
1009062020 6:58408384-58408406 TCATTGTTGGACATTTGAGTTGG + Intergenic
1009726162 6:67537979-67538001 ACACTGGGGGACTTTAGGGAAGG + Intergenic
1009819554 6:68782369-68782391 TCATTGTTGGACATTTGAGTTGG + Intronic
1010040802 6:71380608-71380630 ACATTGGTGGATTTTAGAGATGG + Intergenic
1010077401 6:71816362-71816384 TCATTGTTGGACATTTGAGTTGG + Intergenic
1010178526 6:73057072-73057094 TCATTGATGGACTTTTGGGTTGG - Intronic
1010307134 6:74338141-74338163 TCATTGTTGGACTTTTGGGTTGG + Intergenic
1010312384 6:74402448-74402470 TCATTGTTGGACATTTGAGTTGG - Intergenic
1010319592 6:74490418-74490440 TCATTGTTGGACTTTTGGGTTGG - Intergenic
1010349968 6:74861906-74861928 TCATTGATGGACATTTGAGTTGG - Intergenic
1010473938 6:76263229-76263251 ACTTTGGGGGACTTTTGAGAAGG + Intergenic
1010535873 6:77029460-77029482 TCATTGTTGGACTTTTGGGTTGG + Intergenic
1011299352 6:85857686-85857708 TCATTGATGGACTTTTGGGTTGG + Intergenic
1011365471 6:86576831-86576853 TCATTGATGGACATTTGAGTTGG + Intergenic
1011432895 6:87306769-87306791 TCATTGTTGGACATTAGGGTTGG - Intronic
1011548697 6:88508707-88508729 TCATTGTTGGACTTTTGGGTTGG + Intergenic
1011563350 6:88646587-88646609 TCATTGGTGGACATTTGGGTTGG - Intronic
1012067957 6:94574669-94574691 TCATTGGTGGACATTTGGGTTGG - Intergenic
1012200108 6:96395295-96395317 TCATTAGTGGAGTTTGCAGAGGG + Intergenic
1012287425 6:97408870-97408892 TCATTGGTGGGCATTTGAGTTGG - Intergenic
1012608404 6:101186512-101186534 TCATTGTTGGACATTTGAGTTGG + Intergenic
1012659788 6:101873492-101873514 TCATTGATGGACATTTGAGTTGG + Intronic
1012678072 6:102142336-102142358 TCATTGCTGGACATTTGAGTTGG + Intergenic
1012714649 6:102652746-102652768 TCATTGATGGACTTTTGGGTTGG + Intergenic
1012993294 6:105947797-105947819 TCATTGTTGGACATTTGAGTTGG - Intergenic
1013577406 6:111498138-111498160 TGAATGGTGGACTTTGGAGCGGG - Intergenic
1013715462 6:112955839-112955861 TCATTGTTGGACTTTTGGGTTGG - Intergenic
1014533388 6:122587423-122587445 TCATTGTTGGACATTAGGGTTGG + Intronic
1014650600 6:124032008-124032030 TCATTGATGGACATTTGAGTTGG - Intronic
1014700454 6:124680480-124680502 TCCTAGGTGGACTGTAAAGACGG - Intronic
1014967203 6:127770019-127770041 TCATTGATGGACATTTGAGTTGG + Intronic
1015863457 6:137704440-137704462 TCATTGGTTGACTTTTGTAACGG - Intergenic
1016094015 6:140014014-140014036 ACCTTGGTGGACTTTACATATGG - Intergenic
1016659982 6:146567140-146567162 TCATTGATGGACTTTTGGGTTGG - Intergenic
1017332995 6:153221757-153221779 TAATTGGTAGAATTTAGAAAGGG - Intergenic
1019394818 7:812184-812206 CCATTGCTGGGCTTTAGTGAGGG - Intergenic
1020497706 7:8876895-8876917 TCATTGATGGACATTTGAGTTGG + Intergenic
1021303811 7:19006470-19006492 TCATTGTTGGACATTTGAGTTGG - Intergenic
1021305684 7:19029085-19029107 TCATTGTTGGACATTTGAGTTGG - Intronic
1022158444 7:27683506-27683528 TCAGTGGTGAAATTTGGAGATGG - Intergenic
1022696737 7:32713757-32713779 TCATTGTTGGACTTTTGGGTTGG - Intergenic
1022874921 7:34518880-34518902 TCATTGTTGGACATTTGAGTTGG - Intergenic
1023321956 7:39007923-39007945 TCATTGTTGGACATTTGAGTTGG + Intronic
1024461383 7:49663084-49663106 TCATTGTTGGACATTTGGGATGG + Intergenic
1024713458 7:52045275-52045297 TCATTGGTGGACATTTGGGTTGG - Intergenic
1024822335 7:53347656-53347678 TCGTTGATGGACTTTTGAGTTGG - Intergenic
1024868564 7:53933899-53933921 TCATTGATGGACATTTGAGTTGG - Intergenic
1024893012 7:54224897-54224919 TCATTGTTGGACTTTTGGGTTGG - Intergenic
1024900906 7:54317490-54317512 TCATTGTTGGACTTTTGGGTTGG + Intergenic
1024925633 7:54611276-54611298 TCATTGTTGGACATTTGAGTTGG + Intergenic
1024956314 7:54925228-54925250 TCATTGATGGACTTTTGGGTTGG - Intergenic
1026092161 7:67309287-67309309 TCACTGGTGGAGTTTTGAGAAGG + Intergenic
1027363533 7:77433469-77433491 TCTTTGGTTGTTTTTAGAGAAGG - Intergenic
1027555737 7:79662804-79662826 TCATTGTTGGACATTTGAGTTGG + Intergenic
1028071058 7:86451343-86451365 TCTTTGCTTGGCTTTAGAGAAGG - Intergenic
1028316256 7:89406315-89406337 TCATTGGTGGACATTTGGGTTGG + Intergenic
1028347135 7:89797251-89797273 TCATTGGTGTCCCTAAGAGAAGG - Intergenic
1028439620 7:90844672-90844694 TCATTTGTTGACTGCAGAGAGGG - Intronic
1028576661 7:92359468-92359490 TCATTCGTGGACTTTTGGGTTGG + Intronic
1028886950 7:95944618-95944640 TCATTGTTGGACATTTGAGTTGG - Intronic
1029377592 7:100189164-100189186 TCACTAGTGGAGTTTTGAGAAGG + Intronic
1030287541 7:107841909-107841931 TCATTGATGGACATTTGAGTTGG - Intergenic
1030341674 7:108387955-108387977 TCATTGATGGACATTTGAGTTGG + Intronic
1030561337 7:111090729-111090751 TCATTGCTGAACTTCAGAGACGG + Intronic
1030578681 7:111323735-111323757 TCATTGTTGGACATTTGAGTTGG - Intronic
1030964582 7:115974797-115974819 TTATTATTGGTCTTTAGAGAAGG - Intronic
1031039281 7:116821897-116821919 TCATTGGTGGACATTTGGGTTGG + Intronic
1031104068 7:117517453-117517475 TCATTGGTGGACATTTGGGTTGG + Intronic
1031267595 7:119600794-119600816 TCATTGATGGACATTTGGGATGG + Intergenic
1031391566 7:121221360-121221382 TCATTGGTGGACATTTGGGTTGG + Intronic
1031574952 7:123404137-123404159 TCATTGGTGGACATTTGAGTTGG - Intergenic
1031673338 7:124578940-124578962 TCATTGTTGGACATTAGGGTTGG + Intergenic
1031914309 7:127547954-127547976 ACTTTGGTGGACTGTTGAGAAGG - Intergenic
1032344615 7:131106936-131106958 GCCTTGGTGCACTCTAGAGACGG - Intergenic
1034372413 7:150611390-150611412 TCATTGTTGGACATTTGAGTTGG - Intergenic
1035176117 7:157052368-157052390 TAATAGGTGGTCTTTAGTGACGG - Intergenic
1035236453 7:157500682-157500704 GCAATGGTGGAGTTAAGAGAAGG - Intergenic
1036992207 8:13611052-13611074 TCATTTGTGGCCTAAAGAGAGGG - Intergenic
1037172120 8:15905396-15905418 TCATTGATGGACATTTGAGTTGG + Intergenic
1037234794 8:16705156-16705178 TCATTGATGGACATTTGAGTTGG - Intergenic
1037389121 8:18374377-18374399 TCAGTGGAGGAATGTAGAGAAGG - Intergenic
1037413286 8:18620153-18620175 TCATAGGTGGGTTTTAGGGATGG - Intronic
1037440389 8:18910231-18910253 TCATTGTTGGACATTTGAGTTGG - Intronic
1039004467 8:33018567-33018589 TCATTGTTGGACATTTGGGATGG - Intergenic
1039004562 8:33019583-33019605 TCATTGTTGGACATTTGAGTTGG + Intergenic
1039097038 8:33897441-33897463 TCATTGTTGGACATTTGAGTTGG + Intergenic
1039712350 8:40068628-40068650 TCATTGATGGACATTTGAGTTGG - Intergenic
1040367430 8:46732475-46732497 TCATTGTTGGACATTTGAGTTGG + Intergenic
1040383856 8:46899701-46899723 TCATTGATGGACATTTGAGTTGG - Intergenic
1040657534 8:49528907-49528929 TCATTGATGGACATTTGAGTTGG + Intergenic
1040741761 8:50584169-50584191 TCATTGATGGACATTAGGGTTGG + Intronic
1041478066 8:58287357-58287379 TCATTGTTGGACATTTGAGTTGG + Intergenic
1041587904 8:59543298-59543320 TCATTGTTGGACTTTTGGGTTGG - Intergenic
1041603510 8:59751897-59751919 TCATTGATGGACTTTTGGGTTGG - Intergenic
1041842522 8:62288638-62288660 TCATTGATGGACATTTGGGATGG + Intronic
1042119558 8:65470952-65470974 TTATGGGTGGAATTTAGTGATGG - Intergenic
1042340698 8:67675692-67675714 TCATTTGTGGACTGTGGAGGGGG + Intronic
1042609822 8:70586017-70586039 TCATTGTTGGACATTTGAGTTGG - Intronic
1042888088 8:73574500-73574522 TCATTGATGGACTTTTGGGTTGG - Intronic
1043048309 8:75354708-75354730 TCATTGTTGGACTTTTGGGTTGG + Intergenic
1043367843 8:79556060-79556082 TCATTGATGGACATTTGAGTTGG + Intergenic
1043643698 8:82489887-82489909 TCATTGATGGACATTTGAGTTGG + Intergenic
1044007414 8:86955229-86955251 TCATTGATGGACATTTGGGATGG + Intronic
1044440321 8:92216466-92216488 TCATTGATGGACATTTGGGATGG + Intergenic
1044548788 8:93488971-93488993 TCATTGGTGGACATTTGGGTTGG - Intergenic
1044551233 8:93514730-93514752 TGATTTGTAGACTTCAGAGAAGG - Intergenic
1046203509 8:110957226-110957248 TCATTGTTGGACATTTGAGTTGG - Intergenic
1046542181 8:115599737-115599759 TCATTGGTGGACATTTGGGTTGG + Intronic
1046792491 8:118336756-118336778 TCATTGATGGACATTTGAGTTGG - Intronic
1047385036 8:124401238-124401260 TCTTTGGAGCAGTTTAGAGAGGG - Intergenic
1048182116 8:132204988-132205010 TCCTGGATGGACATTAGAGAAGG - Intronic
1049485360 8:142855668-142855690 TCATTGATGGACATTTGAGTTGG - Intronic
1049885781 9:25250-25272 TCAATGGAGGAGTTCAGAGAAGG + Intergenic
1050047644 9:1564150-1564172 TCATTGGTGGACATTTGGGTTGG - Intergenic
1050081741 9:1922634-1922656 TCATTGGTGGACATTTGGGTTGG - Intergenic
1050082684 9:1931488-1931510 TCATTGGTGGACATTTGGGTTGG + Intergenic
1050421697 9:5472206-5472228 TCATTGGTGGACATTTGGGTTGG + Intergenic
1050783471 9:9369158-9369180 TCATTGTTGGACATTTGAGTTGG + Intronic
1051302856 9:15671755-15671777 TCATTGATGGACATTTGAGTTGG + Intronic
1051328021 9:15994180-15994202 TCATTGATGGACATTAGGGTTGG - Intronic
1051452271 9:17210460-17210482 TCATTGATGGACATTAGGGTTGG + Intronic
1051984581 9:23068427-23068449 TCATTGGTGGACATTTGGGTTGG - Intergenic
1052018204 9:23494293-23494315 TAATATGTGTACTTTAGAGATGG - Intergenic
1052056151 9:23910124-23910146 TCATTGATGGACATTAGGGTTGG - Intergenic
1052131783 9:24857237-24857259 TCATTGGTGGACATTTGGGTTGG + Intergenic
1052701440 9:31942088-31942110 ACTTTGGTGGACTGTTGAGAAGG + Intergenic
1052879187 9:33590248-33590270 ACTTTGGGGGACTGTAGAGAAGG + Intergenic
1053155842 9:35778451-35778473 TAATTGAGGGACTTTAGAGAAGG - Intergenic
1053496360 9:38550873-38550895 ACTTTGGGGGACTGTAGAGAAGG - Intronic
1053666296 9:40320241-40320263 ACTTTGGGGGACTGTAGAGAAGG + Intronic
1053678949 9:40466703-40466725 TCATTGTTGGACATTTGAGTTGG + Intergenic
1053915876 9:42945288-42945310 ACTTTGGGGGACTGTAGAGAAGG + Intergenic
1054292028 9:63302241-63302263 TCATTGTTGGACATTTGAGTTGG + Intergenic
1054377449 9:64460269-64460291 ACTTTGGGGGACTGTAGAGAAGG + Intergenic
1054505669 9:65909592-65909614 TCATTGTTGGACATTTGAGTTGG - Intergenic
1054518313 9:66056042-66056064 ACTTTGGGGGACTGTAGAGAAGG - Intergenic
1057109179 9:92450492-92450514 TCATTGTTGGACATTAGGGTTGG + Intronic
1057666822 9:97052417-97052439 CCACCGGTGGAATTTAGAGATGG + Intergenic
1057676277 9:97138412-97138434 ACTTTGGGGGACTGTAGAGAAGG - Intergenic
1057676703 9:97141527-97141549 GCTTTGGGGGACTGTAGAGAAGG - Intergenic
1058075500 9:100646278-100646300 TCATTGGTGGACATTTGGGTTGG + Intergenic
1058996383 9:110302715-110302737 TTATAGGAGGACTTTAGAAAGGG + Intergenic
1059126900 9:111697588-111697610 TCATTGATGGACATTTGAGTTGG + Intronic
1059482193 9:114600213-114600235 TCTTTGGTGGACTATTGGGAAGG - Intergenic
1059630490 9:116116551-116116573 TCCCTGGAGGACTTTAGACAGGG + Intergenic
1059875040 9:118625336-118625358 TCATTGATGGACATTTGAGTTGG + Intergenic
1061829328 9:133280825-133280847 TCAGTAGTGGAATTTAGATAAGG + Intergenic
1061948710 9:133923735-133923757 TCATTGGTGGACATTTGGGTTGG - Intronic
1185692097 X:2163771-2163793 TCATTGGTGGACATTTGGGCTGG + Intergenic
1186619751 X:11226388-11226410 TCATTGGTGGACATTTGGGTTGG + Intronic
1186956024 X:14682947-14682969 TCATTGATGGACATTTGAGTTGG + Intronic
1188174837 X:26976625-26976647 TCATTGGTGGACATTTGGGTTGG - Intergenic
1188354838 X:29177990-29178012 TCATTGATGGACATTTGAGTTGG + Intronic
1189515778 X:41712226-41712248 TTACTGGTGGAATTCAGAGATGG + Intronic
1189673465 X:43437323-43437345 TCATTGGTGGACATTTGGGTTGG - Intergenic
1189875334 X:45430659-45430681 TCATTGATGGACATTTGAGCTGG + Intergenic
1189926216 X:45958416-45958438 TCTTTGGTAGAGTTGAGAGATGG - Intergenic
1190604317 X:52124895-52124917 TCATTGATGGACTTTTGGGTTGG - Intergenic
1190807089 X:53848549-53848571 TCATTGTTGGACATTTGAGTTGG + Intergenic
1191079113 X:56489910-56489932 TCATTGGTGGACATTTGGGTTGG + Intergenic
1191181490 X:57568530-57568552 TCATTGTTGGACTTTTGGGTTGG - Intergenic
1191610655 X:63108648-63108670 TCATTGATGGACTTTTGGGTTGG - Intergenic
1191669755 X:63738296-63738318 TCATTGGTGGCCTCTGCAGAGGG + Intronic
1191854748 X:65615101-65615123 TCATTGTTGGACATTTGAGTTGG + Intronic
1191930659 X:66367820-66367842 TGACCGGTGGAATTTAGAGATGG - Intergenic
1191932411 X:66388560-66388582 TCATTGTTGGACATTTGAGTTGG + Intergenic
1191983475 X:66952504-66952526 TCATTGTTGGACATTTGAGTTGG + Intergenic
1192021081 X:67391967-67391989 TCATTGATGGACTTTTGGGTTGG - Intergenic
1192251267 X:69416034-69416056 TAATTGGTAGAATTTAGAGGTGG + Intergenic
1192278678 X:69660738-69660760 TCATTGGTGGACATTTGTGTTGG + Intronic
1192541756 X:71979157-71979179 TCATTGATGGACATTTGAGTTGG + Intergenic
1192797093 X:74432945-74432967 ACACTGGTGGCCTTTAGGGAGGG - Intronic
1193051083 X:77100476-77100498 TCATTGTTGGACTTTTGGGTTGG + Intergenic
1193310326 X:80000537-80000559 TCATTGTTGGACTTTTGGGTTGG + Intergenic
1193500171 X:82265114-82265136 TCATTGTTGGACATTTGAGTTGG - Intergenic
1193577108 X:83213157-83213179 TTATTGATGGACATTTGAGATGG - Intergenic
1193588797 X:83362092-83362114 TCATTGATGGACATTTGAGTTGG + Intergenic
1193733362 X:85128043-85128065 TCATTGATGGACATTAGGGTTGG + Intergenic
1193778255 X:85670799-85670821 TCATTGTTGGACATTTGAGTTGG - Intergenic
1193816723 X:86113715-86113737 TCATTGTTGGACATTTGGGATGG + Intergenic
1193875253 X:86854735-86854757 TCATTGATGGACTTTTGGGTTGG + Intergenic
1194196931 X:90905676-90905698 TCATTGATGGACATTAGGGTTGG - Intergenic
1194999036 X:100624138-100624160 TCATTGTTGGACATTTGAGTTGG + Intergenic
1195096175 X:101503182-101503204 TCATTGTTGGACTTTTGGGTTGG + Intronic
1195118882 X:101729124-101729146 TCATTGTTGGACTTTTGGGTTGG + Intergenic
1195267682 X:103198921-103198943 TCATTGTTGGACATTTGAGTTGG + Intergenic
1195795847 X:108645977-108645999 TCATTGTTGGACATTTGAGTTGG + Intronic
1196171751 X:112595862-112595884 TCATTGTTGGACATTTGAGTTGG - Intergenic
1196307556 X:114122230-114122252 TCATTGGTGGACATTTGGGTTGG + Intergenic
1196490257 X:116257101-116257123 TCATTGATGGACTTTTGGGTTGG - Intergenic
1196594905 X:117534072-117534094 TCATTGTTGGACATTAGGGTTGG - Intergenic
1196597436 X:117561384-117561406 TCATTGTTGGACATTAGGGTTGG - Intergenic
1197575379 X:128204670-128204692 TCATTGGTGGACATTTGGGTTGG - Intergenic
1197913612 X:131512611-131512633 TCATTGTTGGACATTTGAGTTGG - Intergenic
1198164802 X:134044559-134044581 TCATTGGTGGACATTTGGGTTGG + Intergenic
1198166945 X:134067232-134067254 TCATTGGTGGACATTTGGGTTGG - Intergenic
1198198127 X:134385533-134385555 TTGTTGGTGGACTTTGAAGATGG + Intronic
1198480454 X:137035265-137035287 TCATTGGTGGGTTTTAGGTAGGG + Intergenic
1198677521 X:139146713-139146735 TCATTGGTGGACATTTGGGTTGG - Intronic
1198839363 X:140840291-140840313 TCATTGGTGGACATTTGGGTTGG + Intergenic
1199410663 X:147518671-147518693 TCATTGATGGACATTTGAGTTGG + Intergenic
1199464781 X:148123863-148123885 TCATTGGTGGACATTTGGGCTGG + Intergenic
1199911311 X:152289914-152289936 TCATTGGTGGACATTTGGGTTGG + Intronic
1200382351 X:155852045-155852067 TCATTGGTGGACATTTGAGTTGG + Intergenic
1200522060 Y:4221670-4221692 TCATTGTTGGACATTAGGGTTGG + Intergenic
1200542781 Y:4479882-4479904 TCATTGATGGACATTAGGGTTGG - Intergenic
1200632415 Y:5606566-5606588 TCATTGTTGGACATTTGAGTTGG + Intronic
1200644947 Y:5770645-5770667 TCATTGGTGGGCTTTTGGGTTGG + Intergenic
1200692955 Y:6326723-6326745 TCATTGATGGACATTTGAGTTGG - Intergenic
1200737858 Y:6819594-6819616 TCATTGGTGGACATTTGGGTTGG - Intergenic
1200802365 Y:7398406-7398428 TCAGTAGTGGAATTTAGATAAGG - Intergenic
1200880259 Y:8205297-8205319 TGATTGGTCCACTTTACAGAGGG + Intergenic
1201042317 Y:9848003-9848025 TCATTGATGGACATTTGAGTTGG + Intergenic
1201262048 Y:12168705-12168727 TCATTGGTGGACATTTGGGTTGG + Intergenic
1201313944 Y:12624415-12624437 TCATTAGTGGACATTTGGGATGG + Intergenic
1201666872 Y:16467540-16467562 TCATTGTTGGACATTTGGGATGG + Intergenic
1201855789 Y:18539787-18539809 TCATTGTTGGACATTAGGGTTGG + Intergenic
1201877532 Y:18780598-18780620 TCATTGTTGGACATTAGGGTTGG - Intronic
1201915756 Y:19179878-19179900 TCAGTAGTGGATTTTAGATAAGG - Intergenic
1201928118 Y:19312126-19312148 TCATTGGTGGACATTTGGGATGG + Intergenic
1202017719 Y:20429384-20429406 TCATTGATGGACATTTGAGTTGG - Intergenic
1202017927 Y:20431803-20431825 TCATTGATGGACATTTGAGTTGG - Intergenic
1202044312 Y:20722647-20722669 TCATTGTTGGACTTTTGGGTTGG - Intergenic