ID: 1144801999

View in Genome Browser
Species Human (GRCh38)
Location 17:17935707-17935729
Sequence GAGCATGATGGCATCATTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 155}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144801999_1144802004 -1 Left 1144801999 17:17935707-17935729 CCACCAATGATGCCATCATGCTC 0: 1
1: 0
2: 1
3: 9
4: 155
Right 1144802004 17:17935729-17935751 CCAAGAGCCATTAGGACATAAGG 0: 1
1: 0
2: 0
3: 8
4: 97
1144801999_1144802007 30 Left 1144801999 17:17935707-17935729 CCACCAATGATGCCATCATGCTC 0: 1
1: 0
2: 1
3: 9
4: 155
Right 1144802007 17:17935760-17935782 CACAAGTGATGAAATACAGTTGG 0: 1
1: 0
2: 0
3: 24
4: 189
1144801999_1144802006 6 Left 1144801999 17:17935707-17935729 CCACCAATGATGCCATCATGCTC 0: 1
1: 0
2: 1
3: 9
4: 155
Right 1144802006 17:17935736-17935758 CCATTAGGACATAAGGAACGAGG 0: 1
1: 0
2: 1
3: 4
4: 55
1144801999_1144802002 -9 Left 1144801999 17:17935707-17935729 CCACCAATGATGCCATCATGCTC 0: 1
1: 0
2: 1
3: 9
4: 155
Right 1144802002 17:17935721-17935743 ATCATGCTCCAAGAGCCATTAGG 0: 1
1: 0
2: 0
3: 14
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144801999 Original CRISPR GAGCATGATGGCATCATTGG TGG (reversed) Intronic
906321241 1:44818246-44818268 GACCAGGATGGCAGCAGTGGAGG + Intergenic
913946333 1:125170688-125170710 GAATATAATGGCATCATTGAAGG - Intergenic
916149831 1:161776307-161776329 GGGCATGCTGGCATCTTTGCTGG + Intronic
916968070 1:169974907-169974929 GTGGATTTTGGCATCATTGGGGG - Intronic
920422614 1:205845359-205845381 GAGCGTGATGGCATCATCTATGG - Exonic
1063770841 10:9198035-9198057 GAGCATTATGGACACATTGGAGG + Intergenic
1067531382 10:47076436-47076458 GAGACTGATGACATCAATGGAGG + Intergenic
1069424101 10:68274608-68274630 CAGCAGGATGGCATCATCTGAGG + Intergenic
1074876872 10:117620566-117620588 GAGCAAGATGGAATGATCGGTGG + Intergenic
1075123481 10:119681372-119681394 GCGCAGGATGGCACCATTGCTGG - Intergenic
1075156129 10:119977390-119977412 GAGCATGGTGGCAGCAGTCGGGG - Intergenic
1076534369 10:131167425-131167447 GCGCAGGTTGGCATCACTGGAGG - Intronic
1077868567 11:6242581-6242603 GAGCTTGAGGGGATCATTGGAGG - Intronic
1078079868 11:8196248-8196270 GAGCATCATGGCAGAGTTGGTGG - Intergenic
1078308139 11:10211619-10211641 TAGCATGATGTCATCACTGTAGG + Intronic
1078451884 11:11446636-11446658 GACCATGATGGCAGCAGGGGAGG - Intronic
1078836791 11:15037947-15037969 GAGCAGGATGGTAGCAGTGGAGG + Intronic
1081484025 11:43514286-43514308 GAACATGATGGCATAACTGCAGG - Intergenic
1082265997 11:50119068-50119090 GAGGATGCTGCCTTCATTGGAGG + Intergenic
1082290091 11:50359504-50359526 GAGGATGCTGCCTTCATTGGAGG - Intergenic
1087269621 11:96098153-96098175 GAGAATGATGACATCACTGGTGG + Intronic
1087790249 11:102398865-102398887 GAACATGATGCCATCATTTAAGG - Exonic
1094151444 12:27288586-27288608 GAGCATGAGAGCATGGTTGGGGG - Intronic
1095225883 12:39675819-39675841 GAGCCTGATAGCCTCACTGGGGG + Intronic
1097930382 12:65177428-65177450 GAGAATGATAATATCATTGGAGG + Intronic
1098059918 12:66550843-66550865 AAGCATGATGGCCTGAGTGGTGG + Intronic
1098291238 12:68958593-68958615 GACCAAGATGGCAGCAGTGGAGG - Intronic
1101730441 12:107422587-107422609 GACCTTGATGGCAGCAGTGGAGG + Intronic
1102386787 12:112516707-112516729 GAGGATGAGGACATCTTTGGGGG + Intergenic
1102427096 12:112852375-112852397 GAGGAGGAAGGCATTATTGGTGG + Intronic
1104010262 12:124925288-124925310 GAGCAGGATGGCGCCATAGGTGG + Intergenic
1104174561 12:126317401-126317423 GAGCAGGATGACACCTTTGGAGG - Intergenic
1104556786 12:129807380-129807402 GAGCATTGTGGCCTCTTTGGTGG - Intronic
1105616641 13:22024515-22024537 GAGCATGGTGGCATGCATGGTGG + Intergenic
1110445962 13:75581161-75581183 GAACATGAAGGGATCATTAGTGG - Intronic
1114549015 14:23522694-23522716 GTTCTTGAGGGCATCATTGGAGG + Exonic
1116681965 14:47983772-47983794 CAGCAAGATGGCAGCATAGGAGG + Intergenic
1119737642 14:76993788-76993810 CAACATGATGGCATCATCAGTGG - Intergenic
1119787889 14:77326567-77326589 GGGCATGAGGGCCCCATTGGGGG + Intronic
1121141152 14:91543613-91543635 GAGCATGGTGGTGTCAGTGGAGG - Intergenic
1124925982 15:34071072-34071094 GAGCATGAAGGCATCACTGGAGG - Intergenic
1125903931 15:43372784-43372806 GAGAATAATGGCATCAGGGGAGG - Intronic
1128532354 15:68463226-68463248 GAGAAGGATGGCAGCAGTGGGGG + Intergenic
1128923215 15:71630966-71630988 GAGCATGATGGCATCTGGTGGGG - Intronic
1130354292 15:83115895-83115917 GAGCAAGATGGAATCATTGACGG + Exonic
1133202344 16:4211807-4211829 GATGATGATGGCAGCAATGGTGG + Intronic
1134529494 16:14972000-14972022 GAGCATGAAGCCATCAGTTGTGG - Intergenic
1137672950 16:50290203-50290225 GAGAGTGATGGCATCATGGGCGG + Intronic
1138613326 16:58144918-58144940 GAGCATGAGGGCATTGTTGCAGG - Intergenic
1139343988 16:66290227-66290249 GAGCCTCATGGCAGCTTTGGTGG - Intergenic
1139723106 16:68873121-68873143 GAGTATGAGGGCTTCTTTGGGGG - Intronic
1140742413 16:77953135-77953157 GAGGTTGCTGGCATCTTTGGTGG - Intronic
1144801999 17:17935707-17935729 GAGCATGATGGCATCATTGGTGG - Intronic
1147177439 17:38664606-38664628 GAGCATCAGGGCATCAGAGGGGG - Intergenic
1150171889 17:63004957-63004979 GGGCATGGTGGCATCAGTGGTGG + Intergenic
1152144247 17:78558603-78558625 GTGGATGATGTCATCATTGTAGG + Intronic
1153685985 18:7545896-7545918 GGGCCTGATGACATCATTGTAGG + Intergenic
1153918024 18:9762938-9762960 GAGCATTCTGGCCTCAATGGTGG - Intronic
1156098850 18:33569161-33569183 GGGCATGAAGGCATTTTTGGGGG + Intergenic
1156364649 18:36414661-36414683 GATGATGATGGCAACAGTGGCGG + Intronic
1159064409 18:63553957-63553979 GAGCATTATGCCTTAATTGGTGG - Intergenic
1162645408 19:12046118-12046140 AGTCATGATGGCATCACTGGAGG - Intronic
1164282377 19:23780301-23780323 GAGAATTATGGCCTCATCGGTGG - Intronic
1164593594 19:29519539-29519561 GACCCTGATGGCAGCATAGGGGG - Intergenic
1165365387 19:35362065-35362087 GAGGGAGATGGCATCTTTGGAGG + Intergenic
1165390282 19:35534700-35534722 GAGGATGTTTGCATCCTTGGGGG - Intronic
926027717 2:9558997-9559019 GAGGAAGCAGGCATCATTGGGGG - Intergenic
930526907 2:52542062-52542084 GAGCAAGATGGCAGAATTGAAGG + Intergenic
932618328 2:73250398-73250420 GATCATGATGGCATCATGCAGGG - Exonic
933291460 2:80442811-80442833 GAGGATGATGGCAACAATGATGG - Intronic
941121233 2:161532776-161532798 GAGCATGATGGTAGAATAGGAGG + Intronic
941762997 2:169265144-169265166 GAGAATGAAGGCATCTATGGAGG + Intronic
942428933 2:175889002-175889024 GAGTGTGATGGCATCTTTGTGGG - Intergenic
947019514 2:225659410-225659432 GAGCATGCCTGCATCATTGTAGG + Intergenic
1171127318 20:22613808-22613830 GACCATTAGGGCATCAGTGGAGG - Intergenic
1172888556 20:38247598-38247620 TAGGATGAGGGCGTCATTGGAGG - Intronic
1173289683 20:41703475-41703497 GAGCTTGATAGTATCATTTGTGG + Intergenic
1174040175 20:47694093-47694115 GAGCAGGGTGGCAGCTTTGGAGG - Intronic
1175092032 20:56512624-56512646 AAGCATGACGGCAGCCTTGGGGG - Intronic
1184021591 22:41825263-41825285 GAGGATGAGGACTTCATTGGCGG - Intronic
1184292343 22:43504318-43504340 GATCATGATGACATCAGTGATGG + Intronic
1185089959 22:48760795-48760817 GAGGGTGATGGCCTAATTGGAGG + Intronic
950906029 3:16539034-16539056 GAGCAGGATACCATCAGTGGTGG + Intergenic
951561991 3:23976783-23976805 CAGGATGAAGGGATCATTGGAGG + Intronic
954092362 3:48295187-48295209 GAGCTGGATGGCATCCTTGTGGG + Exonic
955444720 3:58997534-58997556 GAGCTTGAGGCCATCATTAGAGG - Intronic
956907993 3:73786822-73786844 GAGGATGCTGCCTTCATTGGAGG + Intergenic
957270442 3:78023971-78023993 GAGCAAGATGGCATCTTAAGAGG - Intergenic
957485001 3:80849103-80849125 AAACATGATAGCATCATTGAAGG + Intergenic
963654779 3:148032573-148032595 CAGCATGAAGGTATCAATGGAGG + Intergenic
965253031 3:166367784-166367806 GAGCATGACGGCTGCATAGGAGG + Intergenic
972272360 4:37523542-37523564 GAGCAAGATGGCAGAATAGGAGG - Intronic
974362155 4:60895142-60895164 GTGAAAGATGGCAGCATTGGAGG - Intergenic
974544405 4:63281862-63281884 GAGCATGAGGACATTATTTGGGG - Intergenic
974855322 4:67453915-67453937 AAGCATGATGGCTTCTTGGGAGG - Intergenic
976349521 4:84044950-84044972 CTGCATGAGGACATCATTGGGGG + Intergenic
976381011 4:84398806-84398828 TAGCATGATGGCACAATTGTAGG + Intergenic
979463201 4:121006565-121006587 GAACATCATAGCATCATAGGAGG - Intergenic
979616158 4:122745286-122745308 GTACATGATGCCATCATGGGTGG - Intergenic
980306604 4:131068467-131068489 AAGCATGATGGCTTCTTGGGAGG - Intergenic
980322430 4:131295794-131295816 GATCATGCTGGCATCCTTGAAGG - Intergenic
980418108 4:132519997-132520019 AATCATGATGGCATGAATGGAGG - Intergenic
982066644 4:151660209-151660231 TAGCATGATTCCATCAGTGGTGG - Intronic
983462461 4:168045505-168045527 GAGCATGAGAGCAGAATTGGAGG - Intergenic
983779847 4:171654686-171654708 CAGAATGATGGCATAATTGAAGG + Intergenic
986023037 5:3822605-3822627 GAGCAGAACGGCATCACTGGAGG - Intergenic
987834029 5:23137775-23137797 GAGCATGGTGGCTTCATTTTAGG - Intergenic
989236161 5:39150760-39150782 GACCATGATGGGAACAGTGGAGG - Intronic
991262519 5:64682750-64682772 GACCATGATGACAACATAGGTGG - Intergenic
991514512 5:67419837-67419859 GAGCAAGAAGGCACCATTGCTGG - Intergenic
993839516 5:92860045-92860067 GAACATGATGGCACCAAAGGAGG - Intergenic
997472290 5:134123739-134123761 CAGCATGTTGGCATCATGGTAGG + Intronic
1000667038 5:164011350-164011372 GAAAATGATGGGACCATTGGTGG + Intergenic
1003098691 6:3160724-3160746 TACCCTGAAGGCATCATTGGCGG + Intergenic
1004054571 6:12122561-12122583 CAGCAGCATGGCATCCTTGGTGG - Exonic
1005500285 6:26423242-26423264 GTGCAGGATGGCCTCATTGCAGG - Intergenic
1005530902 6:26704854-26704876 CAGCACGCTGGCCTCATTGGTGG + Intergenic
1005539894 6:26796792-26796814 CAGCACGCTGGCCTCATTGGTGG - Intergenic
1005799251 6:29403424-29403446 GAGCATGAGGACATTTTTGGAGG + Intronic
1006746004 6:36342490-36342512 GAGCATTAGGACAACATTGGTGG - Intergenic
1009755413 6:67933354-67933376 GAGCATCTTGACATCACTGGAGG - Intergenic
1010657619 6:78530402-78530424 GCCCATGAAGGCAGCATTGGTGG - Intergenic
1011027067 6:82880853-82880875 GAGCAGGGTGGCATCGTTGTTGG + Intergenic
1014300934 6:119680513-119680535 GAGAAAGATGGGATAATTGGTGG + Intergenic
1015427410 6:133087980-133088002 TAGGATGTGGGCATCATTGGAGG - Intergenic
1015665125 6:135619779-135619801 GAACATGATGGCTTCAGTAGAGG + Intergenic
1015688682 6:135895881-135895903 GAGTGTGATGGAATCAGTGGTGG - Intronic
1016075292 6:139788562-139788584 GTGCATGATGGCAGCAGTGGTGG + Intergenic
1016351952 6:143177960-143177982 GAGCAGGTTGCCATCAGTGGTGG + Intronic
1019108456 6:169690028-169690050 CAGCATGAGGGCCTCATGGGTGG - Intronic
1019108491 6:169690200-169690222 CAGCATGAGGGCCTCATGGGTGG - Intronic
1019643781 7:2118383-2118405 GAGCCTGATGGCAGCACAGGGGG - Intronic
1020041738 7:5008744-5008766 GGGAATGATGACATCATTGTGGG - Intronic
1020900776 7:14000706-14000728 CAGGATGCTGGGATCATTGGTGG + Intergenic
1021391862 7:20102719-20102741 GAGAATGACGTGATCATTGGAGG + Intergenic
1023092413 7:36629445-36629467 AGGCATGATGACATGATTGGGGG + Intronic
1024109695 7:46132658-46132680 AAGCATGAAGGCAGCATGGGCGG + Intergenic
1024729818 7:52241865-52241887 AAGCATGATGACTTCCTTGGGGG - Intergenic
1024975094 7:55106341-55106363 GAGGATGATGACAATATTGGTGG - Intronic
1030130166 7:106193144-106193166 GGGCATGATGCTATCAGTGGGGG + Intergenic
1036945738 8:13092776-13092798 CAGCATGATGGCAGCCTTGATGG + Exonic
1044699932 8:94956711-94956733 GACCAGGATGGCAGCAGTGGAGG + Intronic
1050161579 9:2725080-2725102 GAACATGACAGCATCATTGAGGG + Intronic
1051683524 9:19632719-19632741 GTGCAAGATGTTATCATTGGAGG - Intronic
1051818379 9:21135673-21135695 TAGCTTGATGACATCATTGCAGG + Intergenic
1053542857 9:38993227-38993249 CAGCATGCTGGCCTCATTGTGGG + Intergenic
1053807303 9:41816744-41816766 CAGCATGCTGGCCTCATTGTGGG + Intergenic
1054623289 9:67370683-67370705 CAGCATGCTGGCCTCATTGTGGG - Intergenic
1055244077 9:74219090-74219112 GAGCAAGATGGCAGAATGGGAGG - Intergenic
1055654118 9:78436630-78436652 GAGCAAGATGGGAGCATTTGAGG + Intergenic
1055656829 9:78459006-78459028 GAGTAGGATGGTATCATTTGTGG - Intergenic
1056714335 9:89015474-89015496 CAGCATGTTGGAATCACTGGAGG - Intronic
1058837450 9:108871131-108871153 AACAATGATGGCATCATTGATGG + Intronic
1059515234 9:114888596-114888618 GAGCAAGATGGCAGAATAGGAGG + Intergenic
1187937446 X:24349755-24349777 GAGCCTGATGGCATAATTACTGG - Intergenic
1192661900 X:73050336-73050358 GAGACTGATGGCAGCATGGGTGG + Intergenic
1193005173 X:76608862-76608884 GGGCATGATGGCATGATGGCAGG + Intergenic
1194804570 X:98311594-98311616 TAGGATGGGGGCATCATTGGGGG - Intergenic
1197536343 X:127692517-127692539 GAGCAAGATGGCAGCATAGAAGG - Intergenic
1199148152 X:144396427-144396449 GAGCAAGATGGCATAATAGGAGG + Intergenic
1199886601 X:152027102-152027124 GGGCATGATGGCATCATTAAGGG - Intergenic
1199887064 X:152030665-152030687 GGGCATGATGGCATCATTAAGGG - Intergenic
1200678528 Y:6180556-6180578 GAGCAAGATGGCAGCATAGAAGG + Intergenic
1200921495 Y:8617411-8617433 GTGAATGATGGCCTCATTGTGGG + Intergenic
1201079755 Y:10228310-10228332 GAGCACTTTGGCATCAATGGTGG - Intergenic
1202060760 Y:20885351-20885373 GAGCATTCTGGCATAATTCGAGG + Intergenic