ID: 1144802000

View in Genome Browser
Species Human (GRCh38)
Location 17:17935710-17935732
Sequence TTGGAGCATGATGGCATCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 170}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144802000_1144802007 27 Left 1144802000 17:17935710-17935732 CCAATGATGCCATCATGCTCCAA 0: 1
1: 0
2: 2
3: 16
4: 170
Right 1144802007 17:17935760-17935782 CACAAGTGATGAAATACAGTTGG 0: 1
1: 0
2: 0
3: 24
4: 189
1144802000_1144802004 -4 Left 1144802000 17:17935710-17935732 CCAATGATGCCATCATGCTCCAA 0: 1
1: 0
2: 2
3: 16
4: 170
Right 1144802004 17:17935729-17935751 CCAAGAGCCATTAGGACATAAGG 0: 1
1: 0
2: 0
3: 8
4: 97
1144802000_1144802006 3 Left 1144802000 17:17935710-17935732 CCAATGATGCCATCATGCTCCAA 0: 1
1: 0
2: 2
3: 16
4: 170
Right 1144802006 17:17935736-17935758 CCATTAGGACATAAGGAACGAGG 0: 1
1: 0
2: 1
3: 4
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144802000 Original CRISPR TTGGAGCATGATGGCATCAT TGG (reversed) Intronic
906321240 1:44818243-44818265 TTGGACCAGGATGGCAGCAGTGG + Intergenic
906606873 1:47179040-47179062 TTGGAAGACGATGGCATCAGGGG - Intergenic
908033635 1:60028800-60028822 TTGGAGAAGGATGGCATGATCGG - Intronic
911053987 1:93695343-93695365 TTGGAGCCTGATGGCCTCATGGG - Intronic
911653634 1:100418290-100418312 TTGGAGAAGAAAGGCATCATGGG + Intronic
912102800 1:106232784-106232806 GTGGATGATGATTGCATCATGGG + Intergenic
912738394 1:112170718-112170740 TTCCAACATGATGGCATGATGGG + Intergenic
912780469 1:112542300-112542322 TGGGAACAGGATGGCGTCATGGG + Intronic
913221192 1:116661972-116661994 TTGGACCATGAAGTCATCTTGGG + Intronic
913555376 1:119961373-119961395 TTGGATCATCAGGGCTTCATTGG - Intronic
915216683 1:154345131-154345153 TTTGATCATGCTGACATCATTGG - Exonic
915377898 1:155413711-155413733 TTGGAACATGAGGGAATCTTAGG + Intronic
916017234 1:160761018-160761040 TTGGAGCATGGTGCCATATTGGG + Intergenic
918267731 1:182861383-182861405 TTGGAGTATGATGACATCTGGGG - Intronic
920818853 1:209361521-209361543 TTGGAGTATGGTGGCATGGTGGG + Intergenic
921307872 1:213815051-213815073 TTGGGGGATGATTGAATCATGGG + Intergenic
923574826 1:235148949-235148971 TCTGAGCATGATGGTTTCATTGG - Intronic
924791268 1:247250936-247250958 TTGGACCATCCTGGCATCCTAGG + Intergenic
1063703283 10:8406625-8406647 ATCAAGCATGATGGCATCCTGGG - Intergenic
1064235981 10:13575745-13575767 TTGGAAAATGATTGAATCATTGG + Intergenic
1064349767 10:14566343-14566365 TTGCAGCATGATGGCTTCACAGG - Intronic
1067531381 10:47076433-47076455 TTGGAGACTGATGACATCAATGG + Intergenic
1074297903 10:112208138-112208160 TTGGGGCATCTTGGGATCATTGG - Intronic
1077224657 11:1434783-1434805 TTGGGGCATGTTGGAACCATGGG - Intronic
1077868568 11:6242584-6242606 GTGGAGCTTGAGGGGATCATTGG - Intronic
1078366663 11:10712280-10712302 CTGGAGCATCCTGGAATCATAGG - Intergenic
1078451885 11:11446639-11446661 CTGGACCATGATGGCAGCAGGGG - Intronic
1079838015 11:25359091-25359113 TTGAAGCATGATCCCATGATGGG - Intergenic
1084135432 11:67176023-67176045 TTGAATGATGATGGCATTATTGG + Intronic
1084400677 11:68941187-68941209 TTGGGGGATGAGGGCACCATTGG + Intergenic
1086189499 11:84061893-84061915 TTTGAGAATGTAGGCATCATGGG + Intronic
1087223218 11:95568799-95568821 TTGGAGCATTATGGGCTCTTTGG + Intergenic
1089574141 11:119429687-119429709 TTGGAGCCTGATGTCGTGATTGG + Intergenic
1089796938 11:120988323-120988345 TTGGAGCAGAGTGGCACCATTGG - Exonic
1093949680 12:25150684-25150706 TTTCAGCAAGAAGGCATCATAGG - Intronic
1094762101 12:33545819-33545841 TTGGACCAGGATGGTAGCATAGG - Intergenic
1095252142 12:39991391-39991413 CTGGAGCATGATGGCAGCAGGGG - Intronic
1095345756 12:41147438-41147460 GTGGAACATGATTGGATCATGGG - Intergenic
1098114781 12:67163573-67163595 TTGGAGGATGATGGGACCAAAGG - Intergenic
1099772716 12:87083002-87083024 TAGGAGCAGCATTGCATCATGGG - Intergenic
1101020176 12:100545928-100545950 GTGGAGCAGGAAGGCATGATTGG + Intronic
1101730440 12:107422584-107422606 TTGGACCTTGATGGCAGCAGTGG + Intronic
1102047704 12:109840143-109840165 TTGAATCCTGATGGCACCATTGG - Intergenic
1102580523 12:113883729-113883751 CTACAGCAGGATGGCATCATGGG - Intronic
1106468015 13:30030240-30030262 AGGGAGCATGATGCCAACATAGG - Intergenic
1111303936 13:86382223-86382245 TTGGTGGATGATGAAATCATTGG - Intergenic
1113143897 13:107185595-107185617 TTGGAGAAAGAGGGCAACATAGG - Intronic
1113878985 13:113612183-113612205 TTGGAGGCAGATGGCACCATGGG - Intronic
1117096624 14:52305144-52305166 TTGGAACATTATGCCACCATAGG + Intergenic
1117250004 14:53927356-53927378 TTGGACCAACATGTCATCATTGG + Intergenic
1121002184 14:90459660-90459682 ATGGAGCATGATGGAAGCCTGGG + Intergenic
1202841875 14_GL000009v2_random:128680-128702 TTGAACCATGTTGGCATCCTTGG - Intergenic
1202911268 14_GL000194v1_random:118923-118945 TTGAACCATGTTGGCATCCTTGG - Intergenic
1123939991 15:25212174-25212196 GTGGATCCTGCTGGCATCATGGG + Intergenic
1123942550 15:25223623-25223645 GTGGATCCTGCTGGCATCATGGG + Intergenic
1123992175 15:25691760-25691782 CTGGATCATGCTGACATCATTGG + Exonic
1124830525 15:33144812-33144834 TTGTAGCATCATTTCATCATTGG + Intronic
1124925983 15:34071075-34071097 CAGGAGCATGAAGGCATCACTGG - Intergenic
1125903932 15:43372787-43372809 ATGGAGAATAATGGCATCAGGGG - Intronic
1127725456 15:61745095-61745117 TTGGAGACTGCTGGCATCATAGG - Intergenic
1128366858 15:67010457-67010479 TTGGAGGTAGATGGCATAATGGG - Intergenic
1128693530 15:69743619-69743641 TTGTAGCATGATGGCAGCCCAGG - Intergenic
1131888662 15:96948101-96948123 TTGTCACATGATGGCTTCATCGG + Intergenic
1132112314 15:99110721-99110743 GTGGAGCAAGATTTCATCATCGG + Intronic
1133635136 16:7657783-7657805 GTGGACCATGGTGGGATCATAGG + Intronic
1137672949 16:50290200-50290222 ATGGAGAGTGATGGCATCATGGG + Intronic
1144802000 17:17935710-17935732 TTGGAGCATGATGGCATCATTGG - Intronic
1146048289 17:29529025-29529047 GTGAACCATGATTGCATCATTGG - Intronic
1146504553 17:33393759-33393781 TTGGTGCAGGATGGCATTGTGGG - Intronic
1146818601 17:35965562-35965584 TTACAGTATGATGGCATCCTGGG + Intergenic
1149630361 17:58116805-58116827 ATGGAGCATGGTTGCATTATGGG - Intergenic
1156784271 18:40891942-40891964 TTGGGACATAATGGAATCATGGG + Intergenic
1159978683 18:74749429-74749451 TTGCAGCATGAGGGCAAAATGGG - Intronic
1160115762 18:76077962-76077984 TTGGAGGATGAAAGCATCTTTGG - Intergenic
1161425135 19:4198941-4198963 TTGGGACATGACGGTATCATTGG + Intronic
934991179 2:98922630-98922652 TTGGAGCTGCATGGCATCATAGG - Intronic
937628578 2:124072053-124072075 TTGAACCATGCTTGCATCATGGG - Intronic
939150667 2:138468811-138468833 CAGGAACATGATGACATCATTGG - Intergenic
941121232 2:161532773-161532795 TTAGAGCATGATGGTAGAATAGG + Intronic
941126910 2:161595133-161595155 ATGGAGCAAGATGGCAAAATAGG - Intronic
943995883 2:194764902-194764924 TTGGAGCAGGCTGGCCTCCTGGG + Intergenic
1169989586 20:11486158-11486180 TTGGAGCCTGATGACCACATAGG + Intergenic
1171127319 20:22613811-22613833 TTGGACCATTAGGGCATCAGTGG - Intergenic
1173694514 20:44997318-44997340 ATGGAGCGAGATGGCATCACAGG - Intronic
1174677164 20:52369693-52369715 TTGGACCATGAGGTGATCATAGG + Intergenic
1174988356 20:55481271-55481293 TTGGAGTATAATCTCATCATTGG + Intergenic
1175856747 20:62124833-62124855 TTGGAGCTTGGTGGCATGTTTGG + Intronic
1176630620 21:9133590-9133612 TTGAACCATGTTGGCATCCTTGG - Intergenic
1176642667 21:9321242-9321264 TTGAACCATGTTGGCATCCTTGG + Intergenic
1180351671 22:11810592-11810614 TTGAACCATGTTGGCATCCTCGG + Intergenic
1180386530 22:12181482-12181504 TTGAACCATGTTGGCATCCTCGG - Intergenic
1185181443 22:49365735-49365757 TTGGAGCATGCTGGCACCTGAGG + Intergenic
950235703 3:11318473-11318495 TTAGAGCATGATGGCCTCATAGG + Intronic
956164216 3:66384254-66384276 TTGGTGAATGATGGCAACACTGG + Exonic
957097438 3:75789407-75789429 TTGAACCATGTTGGCATCCTCGG - Intergenic
959733667 3:109632821-109632843 ATGGTTCAGGATGGCATCATGGG - Intergenic
959744343 3:109759246-109759268 TTGGAGAATGATGGAAGAATAGG - Intergenic
964610397 3:158608802-158608824 TTGGGGGATGATGGGATAATGGG - Intergenic
965112611 3:164447363-164447385 TTGGAAGGTGATGGGATCATGGG + Intergenic
966118812 3:176498865-176498887 CTGGATCATGATTGGATCATGGG - Intergenic
966618223 3:181935145-181935167 GTGGAGGATGATTGGATCATGGG - Intergenic
967111862 3:186301006-186301028 TGGGAGCATAATGGTGTCATTGG - Intronic
1202744219 3_GL000221v1_random:83774-83796 TTGAACCATGTTGGCATCCTTGG - Intergenic
970379129 4:15488996-15489018 ATGGTGCAAGATGGAATCATGGG - Intronic
971739751 4:30504117-30504139 GTGGAGGATGATTGAATCATGGG + Intergenic
972272361 4:37523545-37523567 GTGGAGCAAGATGGCAGAATAGG - Intronic
973360125 4:49157471-49157493 TTGAACCATGTTGGCATCATCGG + Intergenic
973399955 4:49630436-49630458 TTGAACCATGTTGGCATCATCGG - Intergenic
973910160 4:55572004-55572026 TTAGAGCATGGTGTCATCATTGG - Intronic
975045531 4:69798934-69798956 GTGGAGCAAGATGGTAGCATAGG + Intergenic
976805378 4:89040546-89040568 TTGGATAAGGTTGGCATCATTGG + Intronic
977212620 4:94238079-94238101 TTGGAGAATGATGGGTCCATGGG - Intronic
981657826 4:147132043-147132065 ATGAAGCATGAGGGCATAATAGG + Intergenic
983141948 4:164161120-164161142 GTGGGACATGATGGAATCATGGG + Intronic
983944179 4:173567583-173567605 TTGGAACATGGTGGCATGAGAGG - Intergenic
984867262 4:184292261-184292283 TTGGTGAATGATGCCATCACAGG + Intergenic
985895162 5:2745196-2745218 TTGCAGCATGAGAGCATTATTGG - Intergenic
986035055 5:3929570-3929592 TTGGAGGATGATGAGAGCATCGG + Intergenic
989329941 5:40245383-40245405 GTGGAGCAAGATGGCAGAATAGG + Intergenic
991293614 5:65058407-65058429 TTGGGGAATGATTGGATCATGGG + Intergenic
991960426 5:72038870-72038892 TTGGAGCACGGTGGCAGCAGTGG - Intergenic
992947807 5:81826517-81826539 TTGTAGCATGATGGTCTCAGAGG - Intergenic
993839517 5:92860048-92860070 TTGGAACATGATGGCACCAAAGG - Intergenic
994436998 5:99749019-99749041 TTGGAGCATGATGACATACTAGG - Intergenic
994542949 5:101122612-101122634 TTGGAAGATGATTGAATCATGGG - Intergenic
998545638 5:143025090-143025112 TTGGATAATGATGACATTATTGG - Intronic
998840121 5:146244588-146244610 CTGGAGTATGGTGGCATCATGGG + Intronic
998904336 5:146888423-146888445 TTGGAGCATGGTAGCAGCAGTGG - Intronic
1000814688 5:165906133-165906155 TTGGACCATGATGGAAACAGTGG + Intergenic
1001292496 5:170473815-170473837 TGGGACCCTGTTGGCATCATGGG - Intronic
1001751917 5:174137749-174137771 TTGGAGCAAGAAGGTATCAGAGG - Intronic
1002109983 5:176902165-176902187 TTGGAGACTGATGTCTTCATAGG + Intergenic
1005436703 6:25819838-25819860 TTGGATGATGATGACACCATAGG + Exonic
1005656860 6:27947413-27947435 TTTGAGCATGATGCCATGATTGG + Intergenic
1007212389 6:40205944-40205966 GTGGAGCATGGTGGCATCTCAGG + Intergenic
1008788464 6:55198827-55198849 TTGGATCCTGATGGCAGTATGGG - Intronic
1009232425 6:61079637-61079659 TTGGAGCAAGATAGCAGAATAGG - Intergenic
1012173532 6:96049501-96049523 TTGAAACAGGATGGCCTCATAGG - Intronic
1014025179 6:116638164-116638186 ATGGAGAATAATGGGATCATGGG - Intronic
1015699500 6:136020261-136020283 GTGGAGCAAGATGGCAGAATGGG - Intronic
1016337758 6:143026212-143026234 GTGGAAGATGATGGAATCATGGG - Intergenic
1019643784 7:2118386-2118408 TGGGAGCCTGATGGCAGCACAGG - Intronic
1020026365 7:4902816-4902838 GTGGTGCATGAAGCCATCATGGG + Intergenic
1022616345 7:31934714-31934736 TAGGAGAATGATGGCATAAGAGG - Intronic
1024109694 7:46132655-46132677 CTGAAGCATGAAGGCAGCATGGG + Intergenic
1024389308 7:48788564-48788586 ATGGAGCAAGATTTCATCATTGG + Intergenic
1027722646 7:81764173-81764195 TTAGAGTATGATGGCATTTTTGG - Intronic
1028721783 7:94041072-94041094 TTTGTGGATGATGGGATCATGGG + Intergenic
1028881615 7:95886578-95886600 TTGAGGCAGAATGGCATCATGGG - Intronic
1029687703 7:102160128-102160150 CTGGAGTATGGTGGCATGATTGG - Intronic
1031020453 7:116621798-116621820 GTGGAGCAAGATTTCATCATTGG + Intergenic
1031762678 7:125734291-125734313 GTGGAGGATGATTGAATCATGGG - Intergenic
1034424624 7:151007948-151007970 TTGGAGGAGGAGGGCATCCTAGG + Intronic
1039507492 8:38062432-38062454 TTGGAGCATGATGCTTTTATTGG - Intergenic
1039792655 8:40887978-40888000 TTGAAGGATGAGGGCCTCATGGG - Intronic
1041289023 8:56290852-56290874 TTGGAGAATGGTGGCATAAAGGG - Intergenic
1042326137 8:67529796-67529818 TTGGGGTATGATTGGATCATTGG - Intronic
1046321428 8:112582076-112582098 GTGGAATGTGATGGCATCATGGG + Intronic
1046649069 8:116817184-116817206 TGGGAGAATGATGGAATCATGGG + Intronic
1047225942 8:122955598-122955620 ATGGAACATGATGGCATTCTGGG - Intronic
1047532661 8:125691432-125691454 TGGGAACAGGATGGCATCTTTGG - Intergenic
1048258866 8:132928027-132928049 TTAGAGCATGCTGGGATCACAGG + Intronic
1048933033 8:139331170-139331192 TTGGATCATGAGGGCATGAATGG - Intergenic
1050020672 9:1281458-1281480 TTGGACCATGATGCCAACAACGG + Intergenic
1052214778 9:25952286-25952308 GTGGAGCAAGATGGCAGAATAGG - Intergenic
1055244078 9:74219093-74219115 ATGGAGCAAGATGGCAGAATGGG - Intergenic
1055556036 9:77475005-77475027 TAGGAGCATGATGGCTTAATGGG + Intronic
1057500144 9:95590426-95590448 TTGGAGCAGGATGGGATCCACGG - Intergenic
1058878727 9:109267831-109267853 TTGGAGTATTGTGGCATCAGGGG - Intronic
1059322358 9:113479611-113479633 TTGGGGGATGGTGGCACCATGGG + Intronic
1059515233 9:114888593-114888615 GTGGAGCAAGATGGCAGAATAGG + Intergenic
1060881975 9:127123724-127123746 CTGGAGGATGCTTGCATCATGGG - Intronic
1062123055 9:134844266-134844288 TTGGCACATGCTGGCATCCTGGG - Exonic
1203689171 Un_GL000214v1:26546-26568 TTGAACCATGTTGGCATCCTCGG + Intergenic
1203753448 Un_GL000218v1:101291-101313 TTGAACCATGTTGGCATCCTTGG - Intergenic
1203712851 Un_KI270742v1:113725-113747 TTGAACCATGTTGGCATCCTTGG - Intergenic
1203647104 Un_KI270751v1:77507-77529 TTGAACCATGTTGGCATCCTCGG - Intergenic
1186153478 X:6701229-6701251 TTGGTGCATAATGGTATCCTGGG - Intergenic
1186610560 X:11134558-11134580 TGGGAGCAGGAGGGCATCAATGG + Intergenic
1189588206 X:42483399-42483421 TTGGAGCAAGATGGCACCCAAGG + Intergenic
1189889212 X:45581391-45581413 GTGGAGCAAGATGGCAGAATAGG - Intergenic
1190588264 X:51968776-51968798 TTGGAGCAAGATGGCAGAATAGG - Intergenic
1192108347 X:68338759-68338781 TTGGAGCAACATTGCATTATTGG - Intronic
1193980372 X:88175249-88175271 TTGTAACATGATGGCAGAATAGG + Intergenic
1194192905 X:90858688-90858710 ATGGAGGATGATTGGATCATGGG + Intergenic
1194507244 X:94747430-94747452 TTGGAGCATCATTGCATTACTGG + Intergenic
1195744821 X:108106068-108106090 TAGGAGCAAGATGGCAGAATAGG - Intronic
1201079756 Y:10228313-10228335 TTGGAGCACTTTGGCATCAATGG - Intergenic
1201167091 Y:11218850-11218872 TTGAACCATGTTGGCATCCTTGG - Intergenic