ID: 1144802001

View in Genome Browser
Species Human (GRCh38)
Location 17:17935719-17935741
Sequence TAATGGCTCTTGGAGCATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 138}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144802001_1144802007 18 Left 1144802001 17:17935719-17935741 CCATCATGCTCCAAGAGCCATTA 0: 1
1: 0
2: 0
3: 11
4: 138
Right 1144802007 17:17935760-17935782 CACAAGTGATGAAATACAGTTGG 0: 1
1: 0
2: 0
3: 24
4: 189
1144802001_1144802006 -6 Left 1144802001 17:17935719-17935741 CCATCATGCTCCAAGAGCCATTA 0: 1
1: 0
2: 0
3: 11
4: 138
Right 1144802006 17:17935736-17935758 CCATTAGGACATAAGGAACGAGG 0: 1
1: 0
2: 1
3: 4
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144802001 Original CRISPR TAATGGCTCTTGGAGCATGA TGG (reversed) Intronic
905404928 1:37726223-37726245 TCCTTGCTCGTGGAGCATGAAGG - Intronic
907345898 1:53779958-53779980 TAATGGCTCCTGGAGAATGTAGG - Intronic
911795283 1:102068209-102068231 TAATGGCTGTTTGTGCAGGAAGG - Intergenic
917175319 1:172228041-172228063 TAATGGCTCTCTGAGTATTATGG + Intronic
917312992 1:173696116-173696138 TTATGGCTCAGGGGGCATGAAGG + Intergenic
920566586 1:206978954-206978976 TAATGGTTTTTTGAGCAGGATGG + Intergenic
923235441 1:232028558-232028580 TAATGCCTCTTTAAGCATTAGGG + Intronic
1064682159 10:17821304-17821326 TCATGGATCTTGGGGGATGATGG - Intronic
1065779041 10:29149853-29149875 TAATGTGTCTTGGCTCATGATGG + Intergenic
1069504197 10:68982371-68982393 CACTGGCTTTTGGACCATGATGG + Intronic
1070801074 10:79244638-79244660 TGATGGCTCTTCCAGCAGGAAGG + Intronic
1071145168 10:82561195-82561217 TAATGCCTCTTGGGGGAGGAAGG + Intronic
1071456216 10:85853385-85853407 TGATGGTGCCTGGAGCATGAAGG - Intronic
1075910298 10:126118916-126118938 TAATGGCTTTTGGAGCAACTTGG - Intronic
1076020008 10:127064951-127064973 TAATGGCTCTGGGAACCTCATGG + Intronic
1078913542 11:15756283-15756305 TAATGCCTCATGGATCTTGAGGG + Intergenic
1080634935 11:34115485-34115507 TCATGGCACTTGGAGTATAATGG - Intronic
1080837204 11:35950214-35950236 TGATGGATCTTGGACCTTGATGG + Intronic
1081113778 11:39172004-39172026 TAATGGCTATTGGAGTATAAAGG - Intergenic
1081305446 11:41506190-41506212 TAATGGCACTTGCAGCAAAAAGG + Intergenic
1081481659 11:43495378-43495400 TAATGGCTCATGGAACTTGAAGG + Intergenic
1081861286 11:46334541-46334563 TAATGGCTCTGGGGCCATCAGGG + Intronic
1081979987 11:47260245-47260267 TAATGGCACTTGGCAAATGAGGG + Intronic
1082688390 11:56268716-56268738 TGAGGCCTGTTGGAGCATGAGGG + Intergenic
1088453548 11:110009334-110009356 TAATGGATACTGGAGTATGAAGG - Intergenic
1091602965 12:1929071-1929093 GAAGGGCTCTTGGATCATTACGG + Intergenic
1093110155 12:15142202-15142224 TAATGACTCTTGGATTATTAAGG - Intronic
1094390775 12:29947992-29948014 TAATGCCTCTTAGAGGATCATGG - Intergenic
1096034640 12:48455252-48455274 TCATGGCTTTTGGAGCAACATGG - Intergenic
1098097862 12:66979260-66979282 TAATGGTACTTGCAGGATGACGG - Intergenic
1112932452 13:104759137-104759159 CAATGACCCTTGGTGCATGATGG - Intergenic
1113247502 13:108414268-108414290 AAATGGCTTTGGGAGCCTGAGGG + Intergenic
1114539534 14:23444479-23444501 CAATTGCTCTTGCAGGATGAGGG + Intergenic
1116918387 14:50547651-50547673 AAATGGCACTTGGAAAATGATGG + Intronic
1118062760 14:62158536-62158558 TAATGGCTCGTTGTACATGAGGG + Intergenic
1121614115 14:95301449-95301471 TCCTGGCTTTTGGAGCAGGATGG - Intronic
1121701194 14:95955365-95955387 CAATGGCTCCTTGACCATGAGGG + Intergenic
1121709226 14:96025057-96025079 AAAAGGATCTTGGAGCATGCTGG - Intergenic
1121787621 14:96674246-96674268 AAAGGGACCTTGGAGCATGAGGG - Intergenic
1127169559 15:56286458-56286480 AAATGACTCTTGGAGCATCTAGG + Intronic
1128290029 15:66471294-66471316 CAATGGCTCTTGCAGCTTGGAGG - Intronic
1130286960 15:82564113-82564135 TAATTGCTATTGGAGTAGGATGG - Intronic
1131122357 15:89830452-89830474 TGATGGCTCGTGGAGGCTGAGGG - Intergenic
1132140718 15:99391350-99391372 TAAGGGCTCTGGGTGCATGTTGG - Intergenic
1133182911 16:4072190-4072212 TAAAGGCTCAGGGACCATGAAGG + Intronic
1133886127 16:9829456-9829478 AAATTCCTCTTGGATCATGAAGG + Exonic
1133918129 16:10127521-10127543 TAAAGGCTCTTGGTGCACAAGGG - Intronic
1135802895 16:25515526-25515548 TAATGTCTTTTGCAGCATCATGG + Intergenic
1137652974 16:50136248-50136270 AGATGGATCTTGGAGGATGATGG - Intergenic
1138319016 16:56095088-56095110 TGATGGATCTTGGAGAATGACGG - Intergenic
1144802001 17:17935719-17935741 TAATGGCTCTTGGAGCATGATGG - Intronic
1147166650 17:38596934-38596956 TAATAGGTATTGCAGCATGAGGG - Intronic
1148389947 17:47264329-47264351 GGATGGCTCATGGGGCATGAGGG - Intronic
1149325583 17:55526659-55526681 TAATGGCTTTTGGATGATCATGG + Intergenic
1150864851 17:68839127-68839149 TCATAGCTCTTGAAGAATGAGGG - Intergenic
1151144848 17:72030929-72030951 TTGTGGATCTAGGAGCATGAGGG + Intergenic
1151556070 17:74847341-74847363 GTATTGCTCTTGGATCATGAAGG + Exonic
1152398261 17:80048472-80048494 TCATGCCTCATGCAGCATGATGG - Intronic
1154363567 18:13686233-13686255 TAATGTCTCTTTGGGCCTGATGG - Intronic
1154411151 18:14142933-14142955 GAATGGCTCTTGGAGGCTCAAGG + Intergenic
1156537680 18:37879641-37879663 AGATGGATCTTGGAGAATGACGG + Intergenic
1159148401 18:64485195-64485217 TAATGTGTGTTGGAGCAAGAGGG + Intergenic
1160320199 18:77884156-77884178 TCATGGCTCTTGCAGCACCACGG + Intergenic
1168305009 19:55430428-55430450 TGATGGCTCTTGGGGGATGATGG + Exonic
1202707014 1_KI270713v1_random:31559-31581 TTCTGGCTCTTGGAGCAGGCCGG + Intergenic
925880371 2:8347127-8347149 TCATGCTTCTTGGAGCCTGAAGG - Intergenic
928133224 2:28668546-28668568 TGCTGGCTTTGGGAGCATGAAGG - Intergenic
929316360 2:40483800-40483822 TACTGTCTCGTGGACCATGATGG - Intronic
930398362 2:50850655-50850677 AAATGGCTCTTTAAGCATGAAGG - Intronic
939696405 2:145330282-145330304 TACTAGCTTTTGCAGCATGAAGG - Intergenic
940544842 2:155070704-155070726 AGATGGCTCTTGGAGAATGATGG - Intergenic
941042660 2:160640677-160640699 TAATGGATGTAGGAGCAAGAGGG - Intergenic
946769687 2:223076208-223076230 TAATTGCTCATGTAGCATAAGGG + Intronic
1168810909 20:704005-704027 TAATGGCTCTTTGATCCTCAGGG + Intergenic
1168893223 20:1307608-1307630 CAATGGCTGTTGGAGCATTGGGG - Exonic
1169096132 20:2900413-2900435 CAATGGCTCATGGAACTTGAAGG - Intronic
1173575701 20:44111908-44111930 TCAAGACTCCTGGAGCATGAGGG - Exonic
1174955300 20:55091203-55091225 TATTGGAACTTGGAGCTTGATGG - Intergenic
1175326598 20:58133531-58133553 TAATTCCTTTTGCAGCATGACGG + Intergenic
1175933579 20:62504938-62504960 TCATGGCCCTTGGAGGGTGATGG - Intergenic
1176861904 21:14015482-14015504 GAATGGCTCTTGGAGGCTCAAGG - Intergenic
1177733744 21:25062381-25062403 TAATGGTTCCTGGAGAAAGAAGG - Intergenic
950165808 3:10797904-10797926 TAATGTCCTTTGCAGCATGAAGG + Intergenic
950293122 3:11803769-11803791 TAATGTCTTTTGCAGCAAGATGG + Intronic
950393227 3:12713075-12713097 GAATGGATCCTGGAGGATGATGG - Intergenic
953121903 3:40052604-40052626 TAAAGGCTCTTGATACATGATGG - Intronic
955397290 3:58566359-58566381 TTATCCCTCTTGGAGCAGGAGGG + Exonic
956218083 3:66871082-66871104 TAAGGCCTATTGGAGAATGAAGG + Intergenic
956340554 3:68218831-68218853 TATGGTCTCTTGGAGCTTGATGG - Intronic
957262075 3:77915038-77915060 TAATACCTCTAGGAGAATGAAGG - Intergenic
957617658 3:82552054-82552076 TCAGGGCTCTTGGAGCATCCAGG - Intergenic
958786494 3:98602392-98602414 GAATGGCTCATGGAGTCTGATGG + Intergenic
959044315 3:101454868-101454890 TAGTTTCTTTTGGAGCATGATGG + Intronic
963566797 3:146940086-146940108 AGATGGATCTTGGAGAATGATGG + Intergenic
963972793 3:151447960-151447982 CAAAGGCCCTTGGAGCATGATGG - Exonic
967105364 3:186251183-186251205 TAAGGGCTGTGGGAGCATCAAGG + Intronic
967336249 3:188347905-188347927 TAATGGCTCTCTGAGAATAATGG + Intronic
967592583 3:191295957-191295979 TAACAGCTTTTGGAGAATGAAGG - Intronic
976136959 4:81948077-81948099 TATGGACTCTAGGAGCATGATGG - Intronic
977598975 4:98915504-98915526 TATTGGCTGTTGGCCCATGAGGG - Intronic
977635976 4:99299079-99299101 TAATGGCACTGGCAGCAAGATGG + Intergenic
980198421 4:129621865-129621887 TATTAGCACTTGGAGCAAGAAGG + Intergenic
980541646 4:134202985-134203007 TAAGGTCTCTTAGAGCATGAAGG - Intergenic
980809780 4:137861166-137861188 TAAGGGCTAATGGAGCATCATGG - Intergenic
981980319 4:150784326-150784348 TCCTGGCTCTTTGAGCCTGATGG + Intronic
982002512 4:151033912-151033934 TAATTGCTTTTGGAGTATCATGG - Intergenic
982289157 4:153762213-153762235 AAATGGCTCTTGCCACATGAAGG - Intergenic
983838018 4:172417298-172417320 TAATTTCCCTTGGAGAATGAGGG - Intronic
985241491 4:187935397-187935419 GTCTGGCTCTTGGAGCTTGAAGG - Intergenic
986788870 5:11141419-11141441 TGATGGCTCTTGGTGAATAAAGG + Intronic
986999400 5:13644265-13644287 AAATGGAGCTTGGATCATGATGG - Intergenic
989602913 5:43216513-43216535 TATTGGCACTTAGTGCATGAAGG + Intronic
990260216 5:54014105-54014127 TAATGGTTATTGGAGCATTTTGG + Intronic
991415810 5:66391894-66391916 TAATGGCTGTTGCAGCATATTGG + Intergenic
994503088 5:100605114-100605136 TTTTGGCTCTTGGGGCATAATGG + Intergenic
995233184 5:109794344-109794366 TAATAGCTCATGGATTATGATGG + Intronic
1000416868 5:160993009-160993031 AGATGGATCTTGGAGAATGATGG + Intergenic
1001365259 5:171131476-171131498 TACTGGATCTTAGAACATGATGG - Intronic
1004822772 6:19385887-19385909 TAATGTCTTTTGGAGCATCTTGG + Intergenic
1005680256 6:28199612-28199634 CAATCGCTCTAGGAGCATTAGGG + Intergenic
1007901792 6:45420296-45420318 GAAGGGCTCTGAGAGCATGAGGG - Intronic
1008714087 6:54267065-54267087 AAATGGCTATTGGAGAATGAAGG - Intergenic
1012567706 6:100680513-100680535 TAATGGCTCTTTGGGAATGCTGG - Intronic
1013320856 6:108987561-108987583 TAATGGCTCTCAGAGCATAAAGG + Exonic
1014888749 6:126815868-126815890 GAAGGCCTGTTGGAGCATGAGGG + Intergenic
1017179919 6:151541560-151541582 TAATGGGGCTTGGTGTATGATGG + Intronic
1017481332 6:154859363-154859385 GAATGGCTCTTGATGTATGATGG + Intronic
1017494750 6:154973652-154973674 AAATGCCTCATGGACCATGATGG - Intronic
1018644758 6:165937189-165937211 CAATGGCACGTGGAGCTTGATGG - Intronic
1020565525 7:9789657-9789679 TAATGTTCCTTGGAGAATGAAGG + Intergenic
1023359449 7:39400445-39400467 AAATGGATCCTGGAGCCTGAGGG - Intronic
1024043010 7:45569360-45569382 TATTTCCTCTTGGAGCATGTGGG - Intergenic
1030335252 7:108318427-108318449 TAATGTCTCTAGGATAATGATGG + Intronic
1031728332 7:125264812-125264834 TATGGGCTCTTGGACCAAGACGG + Intergenic
1036401178 8:8409867-8409889 TAAAGCTTCTTGGTGCATGAAGG - Intergenic
1041585549 8:59513255-59513277 TCATGGCTCTTGTGTCATGAGGG - Intergenic
1043774696 8:84251213-84251235 TGATGGCTTTTGCAGCATCAAGG + Intronic
1045273009 8:100677905-100677927 TAATAGGACTTGGAGAATGAGGG - Intergenic
1045447912 8:102286490-102286512 TAATGGCTCATCAAGCATAAAGG + Exonic
1046378211 8:113415709-113415731 TAATGGGTTTTGGAGAATTAGGG - Intronic
1047570860 8:126097430-126097452 AGATGGCACTTGGAGAATGATGG + Intergenic
1049952512 9:659265-659287 TCTTGGCTCTTGGAGCCTTAGGG + Intronic
1052498019 9:29253193-29253215 TAATGTCTTTTGCAGCAAGATGG + Intergenic
1058190324 9:101906949-101906971 AAATGGCATTTGGAGCTTGAGGG + Intergenic
1187426439 X:19181567-19181589 TCAAGGCTCCTGGAGTATGAAGG + Intergenic
1191742641 X:64452200-64452222 AGATGGATCTTGGAGAATGACGG - Intergenic
1193549028 X:82866785-82866807 TAATGGCTCTTGAAGGAGTAAGG + Intergenic
1194041391 X:88945817-88945839 TAATGGCTGTTAGAGAAGGAAGG - Intergenic
1194833332 X:98652389-98652411 TCAGGGCTCTTAGAGCATTATGG + Intergenic
1198729823 X:139717279-139717301 AATTGGTTTTTGGAGCATGAAGG - Intergenic