ID: 1144802006

View in Genome Browser
Species Human (GRCh38)
Location 17:17935736-17935758
Sequence CCATTAGGACATAAGGAACG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 55}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144802000_1144802006 3 Left 1144802000 17:17935710-17935732 CCAATGATGCCATCATGCTCCAA 0: 1
1: 0
2: 2
3: 16
4: 170
Right 1144802006 17:17935736-17935758 CCATTAGGACATAAGGAACGAGG 0: 1
1: 0
2: 1
3: 4
4: 55
1144802001_1144802006 -6 Left 1144802001 17:17935719-17935741 CCATCATGCTCCAAGAGCCATTA 0: 1
1: 0
2: 0
3: 11
4: 138
Right 1144802006 17:17935736-17935758 CCATTAGGACATAAGGAACGAGG 0: 1
1: 0
2: 1
3: 4
4: 55
1144801999_1144802006 6 Left 1144801999 17:17935707-17935729 CCACCAATGATGCCATCATGCTC 0: 1
1: 0
2: 1
3: 9
4: 155
Right 1144802006 17:17935736-17935758 CCATTAGGACATAAGGAACGAGG 0: 1
1: 0
2: 1
3: 4
4: 55
1144801998_1144802006 19 Left 1144801998 17:17935694-17935716 CCATCTCTAAAGTCCACCAATGA 0: 1
1: 0
2: 2
3: 17
4: 752
Right 1144802006 17:17935736-17935758 CCATTAGGACATAAGGAACGAGG 0: 1
1: 0
2: 1
3: 4
4: 55
1144801997_1144802006 29 Left 1144801997 17:17935684-17935706 CCTTATTATACCATCTCTAAAGT 0: 1
1: 0
2: 0
3: 25
4: 214
Right 1144802006 17:17935736-17935758 CCATTAGGACATAAGGAACGAGG 0: 1
1: 0
2: 1
3: 4
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144802006 Original CRISPR CCATTAGGACATAAGGAACG AGG Intronic
907146877 1:52242691-52242713 CCATCAGTACATAAGAAACTAGG - Intronic
909255732 1:73418846-73418868 CCTTTAGGATATAAAGAATGTGG + Intergenic
921171543 1:212554372-212554394 TAATTAGGACATAAGGAAACAGG - Intergenic
924424259 1:243936198-243936220 CCATGAGCACATAAGGTATGTGG - Intergenic
924498457 1:244613013-244613035 ACATTAGGAAATAAGGAAATAGG + Intronic
1065811242 10:29445734-29445756 CCATTAGGACACAGGGAGCATGG - Intergenic
1065908811 10:30283546-30283568 CCATTAGGACACAGGGAGCATGG - Intergenic
1071141131 10:82510590-82510612 CCATTAGAACGGAAGGAACAAGG + Intronic
1080011230 11:27461741-27461763 CCATGTGGACATAAGGAGCAGGG - Intronic
1080975948 11:37340656-37340678 ACAGTGGGACATAAGGAAAGAGG - Intergenic
1081501864 11:43674905-43674927 ATAATAGGACATAAGGAAAGAGG - Intronic
1094530073 12:31266012-31266034 CCATTAGCACCTTTGGAACGAGG - Intergenic
1098798029 12:74918063-74918085 ACATGAGTACATAAGGAACATGG + Intergenic
1118964510 14:70567402-70567424 CCCTTAGGACAAAGGGAATGTGG + Intergenic
1130717583 15:86350857-86350879 CCATTAGGGCATAAGCCACCAGG - Intronic
1136602722 16:31306215-31306237 TCATTAGGACACAAGGAAAAAGG - Intronic
1137884383 16:52086834-52086856 GCATAAGGACATAAGGGAGGTGG + Intergenic
1141553070 16:84819141-84819163 CCCTTAGCTCTTAAGGAACGTGG + Intergenic
1143112620 17:4560698-4560720 CCATTAGGACACAAGGCCCGAGG + Exonic
1144802006 17:17935736-17935758 CCATTAGGACATAAGGAACGAGG + Intronic
1155298696 18:24409108-24409130 CCGATAGGACAGAAGGAACTTGG + Intergenic
1156358867 18:36366334-36366356 ACATTAAGACAAATGGAACGAGG + Intronic
1156892785 18:42208988-42209010 CCATTAGGTCATAAGGGGTGAGG + Intergenic
1158506328 18:58049255-58049277 GCATTAGCACAGAAGGAACTGGG + Intronic
1160700993 19:507345-507367 CAATAAGGACACAAGGAAAGTGG + Exonic
1161618374 19:5285278-5285300 CCATGAGGACATAGGGGATGAGG - Intronic
935254734 2:101299721-101299743 CCATTACCACACAAAGAACGTGG - Intronic
941351363 2:164441147-164441169 CCATTGGGACAAAAGGAACAAGG + Intergenic
1170195090 20:13681316-13681338 CCATCAGGACATTAGGAACTAGG - Intergenic
1176104295 20:63378541-63378563 GCATTAGGAAATAAGGAACGGGG + Intergenic
1177519732 21:22204091-22204113 CCCTGAGGACTTAATGAACGTGG + Intergenic
1179586289 21:42375974-42375996 CCATTGGGACATCATGAAGGGGG - Intronic
1183614343 22:38934266-38934288 CCATTAAGTCAAAAGGCACGGGG + Intergenic
1185362345 22:50415862-50415884 CCATTAGGACAGAGGGATGGTGG + Intronic
950265175 3:11568236-11568258 CCCCTAGGACATAAGGTGCGAGG - Intronic
952906421 3:38141893-38141915 CCATTAGGAAATAAGGCTCAAGG - Exonic
953478031 3:43222508-43222530 TCATTGGGGCATAAGGAAAGTGG + Intergenic
960177946 3:114539463-114539485 ACCTTAGGACATAAGCAATGTGG + Intronic
964569955 3:158099653-158099675 CCATGAGGACAGAAGGGACTAGG + Intronic
965516523 3:169627828-169627850 CAATTAGGAAATCAGGAAAGAGG + Intronic
967319673 3:188183261-188183283 CAAAGAGGACATAAGGAAGGTGG - Intronic
968387964 4:160983-161005 CCAAAAGGACATGAGAAACGTGG + Exonic
970410216 4:15798641-15798663 CCATTTGGCCATATGCAACGTGG - Intronic
971611896 4:28736461-28736483 CCATCTGGACATATGGAATGAGG + Intergenic
974874397 4:67685625-67685647 CCATTAGGTCCTACGTAACGGGG - Intronic
979113999 4:116797675-116797697 ACATTCTGACATAAGGAATGAGG - Intergenic
990007103 5:50956329-50956351 CCATAAGGAATTAAAGAACGTGG + Intergenic
990767686 5:59205024-59205046 CCATTCTAACATAAGGAACTAGG + Intronic
996974520 5:129414495-129414517 CCATGAAGATATAAGAAACGGGG + Intergenic
997405710 5:133645005-133645027 CCATTAGGACCAAAGGGACAGGG - Intergenic
1000534984 5:162468870-162468892 CCATAAGCACATAAGCAACATGG - Intergenic
1002283414 5:178146605-178146627 ACATTAGGTCATGAGGAAGGCGG - Intronic
1006717179 6:36128095-36128117 CCATGAGAGCCTAAGGAACGGGG - Intronic
1016672285 6:146722818-146722840 CCATTAGAACAGAAGGAAGGTGG - Intronic
1023210505 7:37798941-37798963 CCAATAGAACACAAGGAAAGTGG + Intronic
1029167882 7:98607725-98607747 CAATCAGCACATAAGCAACGTGG + Intergenic
1041362480 8:57067507-57067529 GCATGAGGACATGAGGAATGGGG + Intergenic
1042065689 8:64873087-64873109 CAATGAGGACAAAAGGAACTTGG - Intergenic
1048574129 8:135677748-135677770 CCATTAGGACATCATGAAGATGG + Intergenic
1052479560 9:29006282-29006304 CCTTTAGGACAAAAAGAACACGG + Intergenic
1199995269 X:153020652-153020674 CCATTAGGAAATAAGTATGGAGG + Intergenic