ID: 1144802566

View in Genome Browser
Species Human (GRCh38)
Location 17:17940576-17940598
Sequence CTTATTCCTGCTCTTTGTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 403
Summary {0: 1, 1: 0, 2: 4, 3: 38, 4: 360}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144802566_1144802568 -2 Left 1144802566 17:17940576-17940598 CCTGAACAAAGAGCAGGAATAAG 0: 1
1: 0
2: 4
3: 38
4: 360
Right 1144802568 17:17940597-17940619 AGGTAAGCCTGAAAGAATGAAGG 0: 1
1: 0
2: 2
3: 21
4: 284

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144802566 Original CRISPR CTTATTCCTGCTCTTTGTTC AGG (reversed) Intronic
900670787 1:3853215-3853237 GTCATTCCTGCTCTTCCTTCTGG - Intronic
900819890 1:4878572-4878594 CTTCTACCTGCTTTTTATTCTGG - Intergenic
902050081 1:13556710-13556732 CTTGTAACTGCTCTTTGGTCAGG + Intergenic
902364211 1:15960527-15960549 CCTTTTCCTGGTCTTTTTTCAGG - Intronic
902431822 1:16369158-16369180 CATCTTCCTCCTCTTTGTCCTGG + Intronic
902565586 1:17309240-17309262 CTTATTGCTCCTCTTTTTCCAGG + Intronic
903697508 1:25218972-25218994 ATTATTCTTGGTCTTTGTTCTGG + Intergenic
906050810 1:42869973-42869995 CTTCTGCCTGCTTTTTATTCTGG - Intergenic
906734397 1:48110687-48110709 CTGGTTCCTTCTCTTTGTTCAGG - Intergenic
907417241 1:54323041-54323063 CTTCTGCCTTGTCTTTGTTCTGG - Intronic
908234651 1:62137814-62137836 TTTCTTCCTGCTTTTTCTTCAGG + Intronic
908544628 1:65150206-65150228 CTTATTTCTGCACTTTCTTAGGG + Intronic
908615470 1:65916486-65916508 CTTATTTCTGTTCTTTGGTAAGG + Intronic
909955405 1:81772726-81772748 CTTATTTCTACTCTTTTTTTGGG - Intronic
911772082 1:101757507-101757529 CTTATTACAGCTCTTTCTTCTGG - Intergenic
911885977 1:103300099-103300121 CATTTTCCTGCTCTTGATTCTGG - Intergenic
912456845 1:109803753-109803775 CTAATTCCTGCTCTTTTTTCTGG + Intergenic
912868246 1:113278625-113278647 CTTAGACCTACTGTTTGTTCAGG + Intergenic
914822804 1:151118034-151118056 CTGCTTCCTGCTCTTTCTTTAGG - Exonic
914921035 1:151847664-151847686 TTTCTTCCTCCTGTTTGTTCTGG + Intronic
915026984 1:152840371-152840393 CTCATTCCTGGTCTCTATTCAGG - Intergenic
917196236 1:172468927-172468949 GTTATTTCAGCTCTTTCTTCAGG + Intergenic
917196265 1:172469221-172469243 GTTATTTCAGCTCTTTCTTCAGG + Intergenic
917406686 1:174714074-174714096 CTTTTTCCTGCTCTTTGTAGTGG + Intronic
917514614 1:175697311-175697333 CTGTTTGTTGCTCTTTGTTCAGG - Intronic
918537836 1:185594102-185594124 CTGATTCCTTCTTTTTATTCAGG + Intergenic
918551221 1:185744748-185744770 TTTATTCATGCACTTTCTTCAGG - Intronic
919497231 1:198288145-198288167 CTTATTCCCCTTCGTTGTTCAGG + Intronic
922858075 1:228792126-228792148 ATTATTCCTGCAATTTGTCCAGG - Intergenic
923220756 1:231890938-231890960 CTTATTCCCACTCTTTGTCACGG - Intronic
923353315 1:233129944-233129966 CTTTTTGCTGCTCACTGTTCGGG + Intronic
923942851 1:238847715-238847737 CTTCTTCCTGTTGTTTGTTAAGG - Intergenic
924325164 1:242888482-242888504 CTTATTCCTTTTCTTTCTTAAGG - Intergenic
924628186 1:245713007-245713029 CTTAGTCTTGCTCTTTGCCCAGG - Intergenic
1064413289 10:15126752-15126774 CTGAGTCCTGTGCTTTGTTCAGG - Intronic
1065661158 10:28005451-28005473 CTTATTCCATCTCTTGGTTCTGG + Intergenic
1066274376 10:33854123-33854145 CTTTTTCCTACTGGTTGTTCAGG - Intergenic
1067287549 10:44917824-44917846 CCTATTCCTTCTCAGTGTTCAGG - Intronic
1069096303 10:64263686-64263708 CTTCTGCCTGCTTTTTATTCTGG + Intergenic
1070067946 10:73056668-73056690 AATATGCCTGCTCTTTGTTGGGG - Intronic
1070353641 10:75617685-75617707 CTTGTTCTTGCTCATTTTTCAGG + Intronic
1070648751 10:78219966-78219988 CTTTCTGCTGCTCTTTGTTTGGG + Intergenic
1071811997 10:89192340-89192362 CTTCTGCCTGCTTTTTATTCTGG - Intergenic
1072057257 10:91772282-91772304 CTTCTGCCTGCTTTTTATTCTGG - Intergenic
1072210391 10:93240937-93240959 CTGATTTCTGCTCATTGTTGTGG - Intergenic
1073193900 10:101672542-101672564 CTTTTGCCTGCTCTCTGTTTAGG - Intronic
1073598333 10:104822063-104822085 TTTATTCCTTCTCTTAGTCCTGG + Intronic
1075301822 10:121331519-121331541 CTGATTCTTTCTCTTTGTTCAGG + Intergenic
1075737390 10:124672380-124672402 CTTATTCCTGCTTCCTGATCCGG - Intronic
1077313782 11:1906534-1906556 AATATTCCTGAGCTTTGTTCTGG + Intergenic
1078668583 11:13345810-13345832 CCTGTTCCTGCTCTTGGATCAGG + Intronic
1079001181 11:16758120-16758142 TTTATACCTGCTCTGTGTTAGGG + Intergenic
1079157821 11:17964938-17964960 CTGTTTCCTGCTCCTTGTACAGG - Intronic
1079411293 11:20190227-20190249 CTCACTCCTACTCTTTCTTCAGG + Intergenic
1079452591 11:20610182-20610204 ATTATCGCTGTTCTTTGTTCGGG + Intronic
1080218064 11:29868255-29868277 CTAATTTCTGCTCTCTGTCCTGG + Intergenic
1081106011 11:39070724-39070746 CTTCTGCCTGCTTTTTATTCTGG + Intergenic
1081186546 11:40049601-40049623 CAGATTCCTGCTCTGTTTTCAGG + Intergenic
1081574816 11:44312331-44312353 CTCATTCCTGCACTTTTGTCTGG + Intergenic
1082734818 11:56844815-56844837 CTGATTCCTGCTCTTTCTCCTGG + Intergenic
1083136498 11:60682619-60682641 TTTATTCCTCCTCTTTTTTTTGG - Intergenic
1083945968 11:65922879-65922901 CTTATTCCTGCTCTTGCTGATGG - Intergenic
1084550877 11:69840960-69840982 CTTCTCTCTGCTCTTTGTTCAGG - Intergenic
1088016115 11:105062248-105062270 CATATTTCTACTCTTTGTTAAGG - Intronic
1088080102 11:105901710-105901732 GTGATACCTGCTCTTTTTTCTGG + Intronic
1088208187 11:107419355-107419377 AATATTCCTGAGCTTTGTTCTGG - Intronic
1088600630 11:111471566-111471588 CTGATCCCTGCTCTTTTCTCCGG + Intronic
1089128871 11:116196247-116196269 CTTTCTCCTGCTCTTCCTTCAGG - Intergenic
1089133377 11:116229816-116229838 TTGATTCCTGCTCACTGTTCCGG - Intergenic
1089662929 11:119997384-119997406 CTTATTCCTACTCTTTAATTTGG + Intergenic
1090210101 11:124913839-124913861 CTTCTGCCTGGTTTTTGTTCTGG + Intergenic
1091871813 12:3897940-3897962 CTTATTTTGGCTCCTTGTTCAGG - Intergenic
1092009570 12:5098214-5098236 CTTCTTCCTGCTCCATGTGCTGG - Intergenic
1092586633 12:9907468-9907490 CTGATTCCTTCTACTTGTTCGGG + Intronic
1092978794 12:13772664-13772686 CCTCTTCTTGCTCTTAGTTCAGG - Intronic
1094404741 12:30105381-30105403 CTTTTTCCTGGTCTGTGTTCAGG - Intergenic
1095504938 12:42886168-42886190 AGTATTCCTGAGCTTTGTTCTGG + Intergenic
1097053164 12:56235637-56235659 CCTCTTCCTGCTCTTTGTGCTGG + Exonic
1097722558 12:63039124-63039146 TTAATTTCTGCTCATTGTTCTGG + Intergenic
1098487424 12:71037619-71037641 TTTTTTCCTGCTCTTTGAACAGG - Intergenic
1098632823 12:72745228-72745250 CTTCTTCCTTCTTTTTGTTTAGG - Intergenic
1099941424 12:89193799-89193821 CATATTCCTGTTCTGTTTTCTGG - Intergenic
1099944718 12:89231505-89231527 CTTATTCCTTCTCCTTGTCCAGG + Intergenic
1101193867 12:102362696-102362718 CTTCTGCCTGCTTTTTATTCTGG - Intergenic
1101476631 12:105055850-105055872 CTTATTCCTTCCTGTTGTTCAGG - Intronic
1101645834 12:106630122-106630144 CTTTTTCCTGCTATTTTTTTGGG + Intronic
1101675181 12:106910737-106910759 CATATTCCTGCCCTTAGGTCTGG - Intergenic
1102542149 12:113628936-113628958 TTGATTCCTTCTCTTTGTCCAGG + Intergenic
1102790175 12:115638179-115638201 CTTCTGCCTGCTTTTTATTCTGG + Intergenic
1103031388 12:117616441-117616463 CCTATGCCTGCTCTTTTCTCTGG + Intronic
1103691875 12:122781776-122781798 GTTATCCCAGCTCTTTGTTTGGG + Intronic
1104117866 12:125766963-125766985 CTTATTCCTTGTCTTAGTTTAGG + Intergenic
1104344067 12:127980021-127980043 CTTATTCCTTCTATCTATTCAGG + Intergenic
1104374027 12:128248210-128248232 CTTACTGCTGCTCATTGTTTGGG + Intergenic
1105326618 13:19376214-19376236 CTTCTTCCTTCTCTTTAATCTGG - Intergenic
1105866926 13:24469092-24469114 CTTCTTCCTTCTCTTTAATCTGG + Exonic
1106500576 13:30324648-30324670 CTTCTTCCTGCCCCTTGTTATGG - Intergenic
1107503292 13:41003219-41003241 CTTTTTTGTGCTCTTTGTTGGGG - Intronic
1108561232 13:51646221-51646243 CTTCTGCCTGTTCTTTGTCCAGG + Intronic
1111803552 13:93009472-93009494 TTTAATCCTGGTCTTTATTCAGG + Intergenic
1112154379 13:96801332-96801354 CTTATTTTTGCTCTTAATTCTGG + Intronic
1114926637 14:27409434-27409456 TTTCTTCCTGCTTTATGTTCCGG + Intergenic
1115015983 14:28614782-28614804 CTAATTCCTGCTCATTCTTTAGG + Intergenic
1116754513 14:48929304-48929326 CTTCTGCCTGCTTTTTATTCTGG - Intergenic
1116968610 14:51041376-51041398 CATTTCCCTGCACTTTGTTCTGG - Intronic
1120070764 14:80099806-80099828 CTAATTGCTGCTCTTTATTTGGG - Intergenic
1120222898 14:81755121-81755143 CATATTCTTGAGCTTTGTTCTGG - Intergenic
1120961499 14:90129239-90129261 CTTATTCCTTCTCCTGGTTTGGG + Intronic
1122047908 14:99036422-99036444 CCTTCTCCAGCTCTTTGTTCTGG + Intergenic
1123216171 14:106811054-106811076 CTGGGTCCTGCTCTTTCTTCAGG - Intergenic
1124382700 15:29180006-29180028 CTTCTTCCTGCTCCTGATTCTGG - Intronic
1124705735 15:31962466-31962488 CATATTCCTGCTCTTCTTTCAGG + Intergenic
1124847530 15:33306431-33306453 CTTTTCTCTGCTTTTTGTTCAGG - Intergenic
1125214856 15:37259936-37259958 CTCCTGCCTGCTCTTTCTTCTGG + Intergenic
1127316751 15:57802788-57802810 CTTTTTCTTGCTAATTGTTCTGG - Intergenic
1127773073 15:62245871-62245893 CCTCTTCCTGCTCTTGGTTCAGG + Intergenic
1127773118 15:62246170-62246192 CCTCTTCCTGCTCTTCGTTCAGG + Intergenic
1127773170 15:62246488-62246510 CCTCTTCCTGCTCTTGGTTCAGG + Intergenic
1128087206 15:64894554-64894576 CTAAATCCTGCTCATTGTTTAGG - Intronic
1128341608 15:66826183-66826205 TGTAGTTCTGCTCTTTGTTCCGG - Intergenic
1128471190 15:67954939-67954961 CTTCTGCCAGCTCTTTCTTCAGG + Intergenic
1129041765 15:72693277-72693299 CTTATTCCACTCCTTTGTTCTGG + Intronic
1130581431 15:85140594-85140616 CTTCTTCCTGCTCTCCCTTCTGG - Intergenic
1132920129 16:2384686-2384708 CTTGTTCCTGATCTTTGTGGGGG + Intergenic
1133606090 16:7389480-7389502 CTGATTCTTGATCTTTGTTCTGG + Intronic
1135022592 16:18975339-18975361 CTTATTCCTTCTCTGTGTCCTGG - Intergenic
1135724121 16:24841368-24841390 CTTATTCTTGCTCTTTAGTGTGG - Intergenic
1136057417 16:27700705-27700727 CTTCTTCCTGCTCCTTGATCAGG - Intronic
1137682742 16:50364948-50364970 CTCTTACGTGCTCTTTGTTCCGG - Intronic
1138252396 16:55511835-55511857 CTCATTCCAACTCTTTCTTCAGG + Intronic
1138819514 16:60242267-60242289 CTTATTCCTACTCTTCATACTGG + Intergenic
1138833186 16:60401170-60401192 CTTTTTTCTGCTTTTTATTCTGG + Intergenic
1139166757 16:64575364-64575386 CATATGCTTGCTTTTTGTTCTGG + Intergenic
1140672451 16:77292479-77292501 TTGATTCCTGCTCATTTTTCAGG + Intronic
1140723960 16:77795584-77795606 TTCATTCCTGCTCTTCCTTCAGG - Intronic
1141265188 16:82490105-82490127 CTTCTGCCTGCTTTTTATTCTGG - Intergenic
1144535425 17:16084354-16084376 CATCTTCCTTCTCTTTGTCCTGG - Intronic
1144802566 17:17940576-17940598 CTTATTCCTGCTCTTTGTTCAGG - Intronic
1145241435 17:21242889-21242911 CTTATTGCTCCTCTTGGCTCTGG + Exonic
1147749226 17:42718379-42718401 CCATTTCCTTCTCTTTGTTCTGG - Intronic
1149092837 17:52804568-52804590 CTTATTGCTGGTCATTATTCTGG + Intergenic
1150118145 17:62573545-62573567 CTTAAACCTGCTCTTTCTTTAGG + Intronic
1150750368 17:67856433-67856455 CTTTTTCCTATTCTTTGTTTTGG + Intronic
1151172661 17:72260462-72260484 CTTATTACTGCTCTTTGTCCAGG - Intergenic
1151462750 17:74264458-74264480 CTTTTTCCTTCTTTTTCTTCTGG + Intergenic
1151605826 17:75134922-75134944 CTTCTACCTCCCCTTTGTTCTGG - Intergenic
1152322390 17:79615098-79615120 CTCGTTCCTGCTCTTTTTTATGG - Intergenic
1153847518 18:9063138-9063160 CTTATTCCTGCTGCTTCTTCAGG + Intergenic
1155130238 18:22927368-22927390 TTTATTTCTGCTATTTGTGCTGG - Intronic
1157550293 18:48576534-48576556 CTTATTTCTGCTGTTTGTGTTGG - Intronic
1158446652 18:57528032-57528054 CTTATCTCTGCTCTGTGTCCGGG + Intergenic
1159777173 18:72616505-72616527 CTGATTCTTGGTCTTTGTTCTGG + Intronic
1159896511 18:74001800-74001822 CTTATTGCTGCTGGTTATTCAGG + Intergenic
1160048536 18:75409762-75409784 GTCATTCCTCCACTTTGTTCCGG + Exonic
1161186694 19:2926324-2926346 CTTTTTCCAGCTCTTTCTCCCGG - Intergenic
1165587655 19:36933784-36933806 TTTATTCATCCTCTTTGTTTTGG + Intronic
1167384019 19:49153629-49153651 CTTCTTCCTCCTCCTGGTTCAGG + Exonic
1167904597 19:52648435-52648457 TTTTTTCCTTCACTTTGTTCTGG - Intronic
925207127 2:2016278-2016300 CATCTTCTTGCTCTGTGTTCTGG - Intronic
926390464 2:12386027-12386049 CTTCTGCCTGCTTTTTATTCTGG - Intergenic
926656759 2:15416056-15416078 CGTATGCCTTCTCTTTGCTCTGG - Intronic
926944479 2:18171763-18171785 CTAATTCCTGATCTTTGTTTGGG + Intronic
927035535 2:19171377-19171399 CTTCTGCCTGCTTTTTATTCTGG + Intergenic
927308723 2:21603869-21603891 CTAATTCCTTCTCTTCTTTCTGG + Intergenic
927702918 2:25279336-25279358 CTTATTCCAGGTCTCTTTTCAGG - Intronic
929328348 2:40646669-40646691 CTTATTCCTGATTTGGGTTCAGG + Intergenic
929713896 2:44291878-44291900 CTTTCTCCTCCTCTTTGTACTGG + Intronic
932870373 2:75392553-75392575 CTTCTGCCTGCTTTTTATTCTGG + Intergenic
932870929 2:75396974-75396996 CTTTTGCCTGCTTTTTATTCTGG + Intergenic
933012677 2:77088106-77088128 CTCTTTTCTCCTCTTTGTTCAGG - Intronic
933130294 2:78664346-78664368 GATATTCCTGAGCTTTGTTCAGG + Intergenic
933291978 2:80448039-80448061 TTTATTACTGCACTTAGTTCTGG + Intronic
934067180 2:88350891-88350913 CTTCTTCCTGCCACTTGTTCTGG + Intergenic
935222899 2:101029861-101029883 CAAATTCCATCTCTTTGTTCTGG - Intronic
937552192 2:123107970-123107992 TTTATTGCTGCTGATTGTTCAGG + Intergenic
938762796 2:134440584-134440606 CTTATTCCAGCTCAGTGTTGAGG - Intronic
940324511 2:152411265-152411287 ATTATGCCTGCTGTTTGTTAGGG - Intronic
941182899 2:162283153-162283175 TTTATTCCTGTTGTTTGTTTTGG + Intronic
941961502 2:171258016-171258038 AATATACCTGATCTTTGTTCTGG - Intergenic
942881696 2:180869566-180869588 CTCTTTCCTGTTCTTTGCTCTGG + Intergenic
943845620 2:192642761-192642783 CTTTTTCATGATCTTTATTCTGG - Intergenic
945661453 2:212690798-212690820 CTTAGTCCTGCTCTGTGCTCTGG + Intergenic
946121210 2:217516530-217516552 TTTATTCCTACTCTTTTTTTTGG - Intronic
947057448 2:226122664-226122686 CTTCTGCCTGCTTTTTTTTCTGG + Intergenic
1169894716 20:10490560-10490582 CTACTTCCTGCTCTTTTTTTGGG + Intronic
1170121159 20:12913765-12913787 TTTTTTCCTTCTCTTTCTTCAGG - Intergenic
1172079241 20:32326255-32326277 CTTAGTCCTGCTTTTTATCCTGG + Intronic
1173184947 20:40833467-40833489 CTTATGCCTGGACTTTGCTCTGG - Intergenic
1173369849 20:42425942-42425964 CTTTTTCCACCTCTATGTTCTGG - Intronic
1174971578 20:55281507-55281529 ATTATTTCTGCTCTTTCTCCAGG - Intergenic
1175270656 20:57731606-57731628 CTTTCTTCTGCTCTTTGTCCTGG + Intergenic
1176893538 21:14348240-14348262 CTTAAACCTCCTCTTTGTCCAGG + Intergenic
1177017161 21:15806403-15806425 CTTTTTCCTTGTCTTTTTTCTGG + Intronic
1177216018 21:18130041-18130063 CCTATTCCTTCTCCTTGCTCCGG - Intronic
1177316226 21:19464604-19464626 ATTATTCGTGATCTTTGTTCAGG - Intergenic
1177760907 21:25401321-25401343 CTTCTGCCTGCTTTTTTTTCTGG - Intergenic
1178057718 21:28818156-28818178 CTTCTGCCTGCTTTTTATTCTGG - Intergenic
1178245741 21:30949803-30949825 CTTATTTCTGATCTTTGGTTGGG - Intergenic
1178620345 21:34168803-34168825 ATTTTTCATGCTCATTGTTCAGG + Intergenic
1178684988 21:34703569-34703591 TTAATTCCTTCTTTTTGTTCAGG - Intronic
1179021972 21:37648719-37648741 CTTCTTCCTGCTATTTCTTGGGG + Intronic
1179217275 21:39378383-39378405 CAGACTCCTGCTCTTTGTTTTGG + Intergenic
1179312004 21:40204863-40204885 CTTTTTCCTGCTTTGTGTTATGG + Intronic
1181143308 22:20823979-20824001 ATTTTTCTTGCTCTTTGTTGGGG - Intronic
1181414940 22:22752600-22752622 CTTCTTCCTGCTCCTGGTTCAGG - Intronic
1181470584 22:23136914-23136936 CTCTTTCCTGCTCTGTGATCTGG - Intronic
1182009326 22:26987104-26987126 CTGACTCCTGCTCATTCTTCAGG + Intergenic
1183562060 22:38582917-38582939 CTAATTCCTGCTCTTCCTCCAGG - Exonic
1185214870 22:49592981-49593003 CTTACTCCTCCCTTTTGTTCTGG - Intronic
1203292524 22_KI270736v1_random:9155-9177 AATATTCCTGGGCTTTGTTCTGG - Intergenic
949866554 3:8552144-8552166 CTTAGTCCTGTCCTTGGTTCAGG - Intronic
950416674 3:12872889-12872911 CCCGTTCCTGCTCTTTGTTGGGG - Intergenic
951724745 3:25744788-25744810 CTTCTTCCTGATGTTTGGTCTGG + Intronic
951759274 3:26127558-26127580 CTTATTCCTGCTTTCTCTTGTGG + Intergenic
954568804 3:51623284-51623306 CTTATTTCTGATCTTTGATTGGG + Intronic
954848833 3:53583148-53583170 CTTATTTGTGATGTTTGTTCAGG + Intronic
955209446 3:56927012-56927034 TTTATTTCTGGTCTGTGTTCTGG - Intronic
957154342 3:76528500-76528522 CTAATTCCTGCCAGTTGTTCAGG - Intronic
959285490 3:104403511-104403533 CAAATTCCTGCTCTTTCTTTAGG - Intergenic
959849468 3:111071031-111071053 ATTTTTCCTGCTCTTTTTTCTGG - Intronic
960313831 3:116151382-116151404 CTCATTCCTGCTTCTTGTACTGG - Intronic
960722736 3:120640720-120640742 CTTTTTCGTGCTGTTTGTTTGGG + Intronic
961646968 3:128397850-128397872 CTGATTCCTCCTCCTAGTTCTGG + Intronic
962928107 3:140013400-140013422 CTTGTTCCGGCTCTTTGTTTTGG + Intronic
964977647 3:162639596-162639618 CTTCTGCCTGCTTTTTATTCTGG + Intergenic
965670163 3:171139904-171139926 CTTATTCCTGCTGCTTGCACAGG - Intronic
967195024 3:187018598-187018620 CTTCTGCCTGCTTTTTATTCTGG + Intronic
967667629 3:192191875-192191897 TTTATCCCTGCTATTTGTTTAGG - Intronic
967766268 3:193282747-193282769 TTTATTCTTGCTTTTTGTTAAGG - Intronic
967863118 3:194168321-194168343 CTTACTGCTGCTCTTTGTTCTGG - Intergenic
968379573 4:79486-79508 CTTTTTCCAGCTGTGTGTTCTGG + Intronic
968955856 4:3718855-3718877 CTTATTCGTGGTCTTTGTTCTGG + Intergenic
970210566 4:13705815-13705837 CTGATTCCTGCTGTTCTTTCAGG + Intergenic
970287660 4:14536151-14536173 CGTACTCCAGCTGTTTGTTCAGG + Intergenic
971631872 4:29002986-29003008 TTTCTTCCTTCTCTTTCTTCTGG + Intergenic
972747168 4:41946873-41946895 CTTAATCCTGCTTTTGGGTCAGG + Intronic
973559920 4:52124924-52124946 CTTCTCCCTGCTCTGTGCTCTGG + Intergenic
974326219 4:60418714-60418736 CTGCTGCCTGCTCTTTCTTCTGG + Intergenic
975876196 4:78839826-78839848 CTTCTGCCTGCTTTTTATTCTGG + Intronic
975954534 4:79821895-79821917 CTTCTTCCTGCTCTTTGCTATGG - Intergenic
977930875 4:102747371-102747393 CTTCTGCCTGCTTTTTATTCTGG + Intronic
979026452 4:115583632-115583654 CTTCTGCCTGCTTTTTATTCTGG + Intergenic
979121814 4:116912387-116912409 TTTATTCCTAATCCTTGTTCTGG - Intergenic
980375673 4:131945089-131945111 CTTATTTTCTCTCTTTGTTCAGG + Intergenic
981690036 4:147498250-147498272 ACTTTTCCTGCTTTTTGTTCTGG + Intronic
981873500 4:149514843-149514865 TTTCTGCCTGCTCTATGTTCTGG - Intergenic
983476834 4:168222298-168222320 CTTCTTCCTCCTTTTTATTCAGG - Intronic
984101755 4:175495519-175495541 CTTCTTCCTGGTCTATGCTCTGG + Intergenic
984302035 4:177933331-177933353 CTTCTTCTTGCTTTTTGTTTAGG + Intronic
984846219 4:184110176-184110198 CTTCTTTCTGTTCTTTGTTTCGG + Intronic
985429430 4:189864774-189864796 TCTATTCCAGCTCTTTGTCCTGG - Intergenic
986938018 5:12916212-12916234 CTTCTTCCTGCTTTATATTCTGG + Intergenic
987692124 5:21280913-21280935 CTTTTTCCTTCTCTTTTTTAAGG - Intergenic
988232703 5:28501619-28501641 CTTCTGCCTGCTTTTTATTCTGG + Intergenic
989180877 5:38575785-38575807 CTCATCCCTGCTCTGGGTTCTGG + Intronic
990334587 5:54759619-54759641 CTTTTCCCTGCTCTGTGTCCAGG - Intergenic
990515795 5:56529894-56529916 CTGGTTCCTGCTTTTTGTCCTGG + Intronic
991669109 5:69029599-69029621 GATATTCCTGTTCTGTGTTCAGG + Intergenic
991963062 5:72064962-72064984 CTTACACCTGCTCTTGGCTCTGG - Intergenic
992242451 5:74786044-74786066 CTTCTGCCTGCTTTTTATTCTGG - Intronic
992243282 5:74792376-74792398 CTTCTGCCTGCTTTTTATTCTGG - Intronic
993277214 5:85875783-85875805 CTAGTTCCTACTCTTTGTTTGGG - Intergenic
993284067 5:85966728-85966750 CTTAATCCTCCTCTTTCTTCAGG - Intergenic
993449894 5:88060609-88060631 CTGACTCCTGCTCATTCTTCAGG + Intergenic
994312601 5:98292362-98292384 CATAGTCCTGCTCTTTGCCCAGG - Intergenic
994337217 5:98581482-98581504 CTAATTCCTGGACTGTGTTCAGG + Intergenic
994815863 5:104587471-104587493 CTTATTCAGGCTGTTGGTTCAGG + Intergenic
994878480 5:105455660-105455682 CTTCTGCCTGCTCCTTTTTCTGG + Intergenic
995077531 5:108004551-108004573 CTTTTTCCTCCTCTTTGCCCAGG - Intronic
995152397 5:108864426-108864448 CTTTTCTCTGCTCTTTGCTCTGG + Intronic
995211704 5:109547674-109547696 CTTTTTTCTGCTTTTTGTTGTGG - Intergenic
996230318 5:121055896-121055918 CTTCTGCCTGCTTTTTATTCTGG + Intergenic
996700041 5:126441575-126441597 CATATTCCTTCTCTTTATTTAGG + Intronic
997112902 5:131094868-131094890 CTTATTTTTTTTCTTTGTTCGGG - Intergenic
997368227 5:133339303-133339325 CCTATTCCTGCTCCCTATTCAGG - Intronic
997516741 5:134495400-134495422 CTTATTCCTGAGCTTTGGTGAGG - Intergenic
997555181 5:134791267-134791289 CTTATATATGCTCTTTGCTCAGG + Intronic
999165550 5:149546200-149546222 CTTATCCTTGCTCTTTACTCAGG + Intronic
999505593 5:152192555-152192577 CTTATTCCTGAGCTTTGTGGGGG + Intergenic
999936963 5:156497336-156497358 CTTATTCCCTCTCTGTGTTGAGG + Intronic
1000895309 5:166848081-166848103 AATCTTCCTGCTCTTGGTTCTGG - Intergenic
1001825069 5:174737852-174737874 CATTTTCCTGCTCTTTGTAAGGG - Intergenic
1002493798 5:179598508-179598530 CTGGTTCCTGCTCTTTCTTGTGG + Intronic
1003264847 6:4556488-4556510 CTTCTGCCTGCTTTTTATTCTGG + Intergenic
1004050416 6:12072565-12072587 CTTTTTCCAGCTCTCTCTTCTGG + Intronic
1004980531 6:21018364-21018386 CTTATTTCTGGTTTTTGTGCAGG + Intronic
1005706517 6:28459975-28459997 CTCCTTCCTTCTCTTTATTCAGG - Intergenic
1005808623 6:29499350-29499372 CCTATTACTGCCATTTGTTCAGG + Intergenic
1006832953 6:36979830-36979852 CTTATTCCTTCTTTTTTTACAGG - Intronic
1007105015 6:39277767-39277789 CTGATTCCAGCACTGTGTTCTGG - Intergenic
1008719457 6:54330920-54330942 CTTGTTACTGGTCTTTGTGCAGG - Intronic
1010835516 6:80583063-80583085 CCTAAACCTGCTCTTAGTTCAGG - Intergenic
1012273584 6:97244544-97244566 CTTCTGCCTGCTCTTTATTCTGG - Intronic
1012412034 6:98969587-98969609 CTTATACCTGTTTTTTGCTCTGG - Intergenic
1014077823 6:117257160-117257182 CTTTTTCCTCCTGCTTGTTCAGG + Intergenic
1014408517 6:121083927-121083949 CTCATTCCTTCACCTTGTTCTGG + Intronic
1016114602 6:140264311-140264333 TTTATTTCTGCTCTGTTTTCCGG - Intergenic
1016339239 6:143043690-143043712 CTTATTCCTGATCATTTTTATGG - Intergenic
1016354328 6:143201705-143201727 CTTAATTCTCCTCTTTGTTACGG + Intronic
1016637569 6:146311858-146311880 ATTTTTCCTGCTCTATTTTCTGG + Intronic
1016938641 6:149466946-149466968 TTAATTGCTGCTCTTTTTTCAGG + Intronic
1017114320 6:150962680-150962702 CTTCTACCTGCTCATTTTTCTGG - Intronic
1017857118 6:158359575-158359597 CTTCTGCCTGCTTTTTATTCTGG + Intronic
1018465334 6:164038903-164038925 ATTTTTCCTGCTCTATTTTCTGG + Intergenic
1018807049 6:167269925-167269947 CTTTTTCCTGCTTTTTGTACAGG + Intergenic
1018878924 6:167855509-167855531 CTTATTCTTGCAGTTTGGTCAGG + Intronic
1020151848 7:5688096-5688118 GCTATTCCTGCTCTATGTCCTGG + Intronic
1020567455 7:9816318-9816340 CTTCTGCCTGCTTTTTATTCTGG + Intergenic
1021462195 7:20901036-20901058 CTTTTTCCTGCTCTAGGCTCTGG + Intergenic
1023734758 7:43224915-43224937 CTTATCCCTGCCCTTTTTCCAGG - Intronic
1025962396 7:66234249-66234271 CTAATTCCTACTCATTCTTCAGG + Intronic
1026681652 7:72471661-72471683 CTTATTCCTGAGCTTTATTTTGG + Intergenic
1027654107 7:80907417-80907439 TTTATTCCTGCTTAATGTTCTGG + Intronic
1028198522 7:87934495-87934517 CTTCTTGCTGCTCTGTGTCCTGG + Exonic
1028317023 7:89415395-89415417 TTTATTTCTTCTCTTTGTTTTGG + Intergenic
1030380831 7:108810146-108810168 ATCATTCATGCTCTTTGTCCAGG - Intergenic
1030670962 7:112336537-112336559 GTTAATCCTGTTCTGTGTTCGGG + Intronic
1030767125 7:113423938-113423960 CTTATTCCGGGTCTTGGTTTTGG + Intergenic
1030791120 7:113730197-113730219 CTTCTGCCTGCTTTTTATTCTGG - Intergenic
1030986789 7:116251099-116251121 CTTATTAGTGCTCTTTTTTCAGG - Intronic
1031461322 7:122052976-122052998 CTTATTGGTGCTCTTTCATCTGG - Intronic
1031481822 7:122287301-122287323 CTTCTGCCTGCTTTTTATTCTGG + Intergenic
1031779512 7:125943402-125943424 CTTCTGCCTGCTTTTTATTCTGG - Intergenic
1031788628 7:126069405-126069427 TTTCTTCCTCCTCTTTCTTCTGG - Intergenic
1031849152 7:126842671-126842693 ATTATGCCTGCTCTCTGGTCTGG - Intronic
1031933153 7:127707403-127707425 TTTACTCTCGCTCTTTGTTCTGG + Intronic
1032305435 7:130729719-130729741 CTAATTCCTGGTCTTGGATCTGG + Intergenic
1032763396 7:134966276-134966298 CTTTCTCATGCTCTTAGTTCTGG + Intronic
1033052021 7:138014295-138014317 GTTCTTCCTTCTCTTTTTTCTGG - Intronic
1034044893 7:147917410-147917432 CTCCTTCCAGCTCTCTGTTCTGG + Intronic
1035111417 7:156485521-156485543 CTTATTGATGCTATGTGTTCTGG - Intergenic
1037643323 8:20768603-20768625 CTTATGTCTGCTCTTCATTCTGG - Intergenic
1037800860 8:22034506-22034528 CTTTTTCCAGCTTTTTTTTCTGG - Exonic
1039180510 8:34861011-34861033 CAGATTCCTGGTCTTTGTGCAGG - Intergenic
1039822022 8:41142801-41142823 CATATTCTTGCTCTGTGTTCTGG - Intergenic
1040136730 8:43862987-43863009 CTTCTTCCTGGTTTTTGTCCGGG - Intergenic
1040614516 8:49020831-49020853 CTTCTTCCTGCTTTTTATTCTGG + Intergenic
1040814248 8:51491039-51491061 CTTCTGCCTGCTTTTTATTCTGG - Intronic
1041107083 8:54454298-54454320 CTTATTGTTGTTCTTTGTTCAGG + Intergenic
1041717562 8:60945831-60945853 CTAAATCCAGTTCTTTGTTCAGG + Intergenic
1042350420 8:67771872-67771894 CTCCTCCCTGCTCTCTGTTCTGG + Intergenic
1042989625 8:74624342-74624364 CATATTCTTGATCTTTCTTCTGG + Intronic
1043886291 8:85604433-85604455 CTTCTGCCTGCTTTTTATTCTGG + Intergenic
1044039172 8:87343978-87344000 CTTTTTCATGCTCTTTGCTTAGG + Intronic
1046694203 8:117320194-117320216 AATATTCTTGATCTTTGTTCTGG - Intergenic
1047238304 8:123061833-123061855 CTTCTGCCTGCTTTTTATTCTGG - Intronic
1048024516 8:130573323-130573345 CTTCTGCCTGCTTTTTATTCTGG - Intergenic
1048126507 8:131641359-131641381 CTTCTGCCTGCTTTTTTTTCTGG - Intergenic
1048437415 8:134431477-134431499 CTTTGTCCTGATCTCTGTTCAGG - Intergenic
1049008771 8:139873760-139873782 CATATTCCTGTCCTTTGTACTGG + Intronic
1050511291 9:6398672-6398694 CATATTCTGGCTCTTTGTTTTGG + Intergenic
1050639023 9:7645651-7645673 CTTCTGCCTGCTTTTTATTCTGG - Intergenic
1051004429 9:12325705-12325727 CTTCTGCCTGCTTTTTATTCTGG + Intergenic
1051527687 9:18065253-18065275 CTTATTCCATCTCTGTGTACAGG - Intergenic
1051596130 9:18825972-18825994 CTGTTTCCTCCTCTTTGTACTGG + Intronic
1051769414 9:20560137-20560159 CTTATTCCTGCTGAGGGTTCTGG + Intronic
1052755062 9:32532643-32532665 CTAATTCCTTCTCATTCTTCAGG - Intergenic
1053543894 9:39002760-39002782 CATGATCCTCCTCTTTGTTCTGG + Intergenic
1053640718 9:40075755-40075777 CTTATTTTCTCTCTTTGTTCAGG + Intergenic
1053765417 9:41389717-41389739 CTTATTTTCTCTCTTTGTTCAGG - Intergenic
1053808325 9:41826257-41826279 CATGATCCTCCTCTTTGTTCTGG + Intergenic
1054321408 9:63671738-63671760 CTTATTTTCTCTCTTTGTTCAGG + Intergenic
1054544034 9:66300877-66300899 CTTATTTTCTCTCTTTGTTCAGG - Intergenic
1054622267 9:67361171-67361193 CATGATCCTCCTCTTTGTTCTGG - Intergenic
1055574762 9:77649357-77649379 CTTATGCCTGCTCTTAGTAGAGG - Intergenic
1055743262 9:79412918-79412940 TATATTCCTGATCTTTCTTCAGG + Intergenic
1055778673 9:79795119-79795141 CTTATTCCTGCCCTTCCTTTGGG - Intergenic
1056253719 9:84776832-84776854 ATTATGCCTGCTCTTTGTTTTGG + Intronic
1058408205 9:104701071-104701093 CTTATTTCAGCTCTTTATTGTGG - Intergenic
1059497503 9:114721572-114721594 CTTCTCCCTGCTCTGTGTGCTGG + Intergenic
1059508206 9:114819088-114819110 ATCCTTCTTGCTCTTTGTTCAGG - Intergenic
1059880962 9:118688302-118688324 CTTCTGCCTGCTTTTTATTCTGG - Intergenic
1062704432 9:137928480-137928502 TTTATTCCTCCTCTGTTTTCTGG + Intronic
1185998575 X:4981850-4981872 CTTATTTTTGCTCATTTTTCAGG + Intergenic
1186032450 X:5384597-5384619 CTTCTGCCTGCTATTTATTCTGG + Intergenic
1186114729 X:6293357-6293379 CTTCTGCCTGCTTTTTATTCTGG + Intergenic
1186209385 X:7233650-7233672 ATAATTGCTGCTCTTTTTTCAGG - Intronic
1187326035 X:18289812-18289834 CTGCTTTTTGCTCTTTGTTCAGG - Intronic
1187584202 X:20641767-20641789 CTTATTCCTGCATTTTATTCAGG + Intergenic
1187657473 X:21493754-21493776 CTTATTTCTTCTCTTTCTTTTGG + Intronic
1187692880 X:21889053-21889075 CTTATTCCTTTTCATTGTTCAGG + Intergenic
1187724296 X:22186569-22186591 GTTATTTCTTCTATTTGTTCAGG - Intronic
1188933499 X:36144670-36144692 CTTCTTCTGTCTCTTTGTTCTGG - Exonic
1189670198 X:43400320-43400342 GGTATTGCTGCTCTTTATTCAGG - Intergenic
1190025392 X:46917527-46917549 CTTATTCCTGCTCATTCTCAAGG - Intronic
1191660226 X:63641869-63641891 CTTCTGCCTGCTTTTTATTCTGG - Intronic
1192627223 X:72742824-72742846 ATTTTTCCTGAGCTTTGTTCTGG + Intergenic
1192654485 X:72977989-72978011 ATTTTTCCTGAGCTTTGTTCTGG - Intergenic
1194168532 X:90553301-90553323 CTTACTGCTGCTCATTGTTTGGG - Intergenic
1194428240 X:93766494-93766516 CTTACTCCTGCTCCATGTCCTGG + Intergenic
1194491537 X:94555948-94555970 CTTCTGCCTGCTTTTTATTCTGG - Intergenic
1196126587 X:112108367-112108389 ATTATTCTTGCTCTTTGATTGGG + Intergenic
1197037606 X:121895355-121895377 CTTTTTCCTGCTTTTTATTCTGG - Intergenic
1197356729 X:125444880-125444902 CTCATTCCTCCTCATTGTGCTGG + Intergenic
1198384383 X:136114659-136114681 CTTTTTCCAGCTCTGGGTTCAGG + Intergenic
1198793198 X:140368139-140368161 CTTAATCCTTCTCTTCCTTCAGG + Intergenic
1198933554 X:141884251-141884273 CTTCTGCCTGCTTTTTATTCTGG - Intronic
1199517938 X:148699839-148699861 CTTATACTTGCTCTTTATTTTGG - Intronic
1200514773 Y:4131085-4131107 CTTACTGCTGCTCATTGTTTGGG - Intergenic
1201222690 Y:11787498-11787520 CTTATTCCTTTTCTTTCTTAAGG - Intergenic
1201668989 Y:16494078-16494100 TTTATTTCTGTTGTTTGTTCAGG - Intergenic
1201960091 Y:19670924-19670946 CTTATTGCTGTTTTTTGGTCAGG - Intergenic
1202605189 Y:26633413-26633435 CTTCTTCCTTCTCTTTAATCTGG + Intergenic