ID: 1144803614

View in Genome Browser
Species Human (GRCh38)
Location 17:17949123-17949145
Sequence ATGCCATGCGTTTCTCACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 105}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144803613_1144803614 -10 Left 1144803613 17:17949110-17949132 CCATGTGGGTTTCATGCCATGCG 0: 1
1: 0
2: 0
3: 4
4: 92
Right 1144803614 17:17949123-17949145 ATGCCATGCGTTTCTCACACAGG 0: 1
1: 0
2: 0
3: 6
4: 105
1144803611_1144803614 -6 Left 1144803611 17:17949106-17949128 CCCTCCATGTGGGTTTCATGCCA 0: 1
1: 0
2: 0
3: 15
4: 146
Right 1144803614 17:17949123-17949145 ATGCCATGCGTTTCTCACACAGG 0: 1
1: 0
2: 0
3: 6
4: 105
1144803612_1144803614 -7 Left 1144803612 17:17949107-17949129 CCTCCATGTGGGTTTCATGCCAT 0: 1
1: 0
2: 1
3: 12
4: 175
Right 1144803614 17:17949123-17949145 ATGCCATGCGTTTCTCACACAGG 0: 1
1: 0
2: 0
3: 6
4: 105
1144803608_1144803614 17 Left 1144803608 17:17949083-17949105 CCTTAATTGAGTGTTCTCAGGGA 0: 1
1: 0
2: 1
3: 10
4: 112
Right 1144803614 17:17949123-17949145 ATGCCATGCGTTTCTCACACAGG 0: 1
1: 0
2: 0
3: 6
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144803614 Original CRISPR ATGCCATGCGTTTCTCACAC AGG Intronic