ID: 1144804421

View in Genome Browser
Species Human (GRCh38)
Location 17:17954931-17954953
Sequence GGGGCTGAGCAAATGGATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 285}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144804421 Original CRISPR GGGGCTGAGCAAATGGATGG AGG (reversed) Intronic
900406641 1:2495768-2495790 GCGGCTGAGCAGGTGGCTGGAGG + Intronic
901210094 1:7519771-7519793 GGGGGTGACCAGATAGATGGTGG - Intronic
901673790 1:10871103-10871125 GAGGCTGGGGAAATGGCTGGGGG + Intergenic
901683263 1:10928668-10928690 GTTGCTGAGCACAGGGATGGCGG + Intergenic
903124708 1:21239717-21239739 GGCGCTGGACAAATGGATGATGG + Intronic
903192161 1:21662942-21662964 GGGCCTGAGCAATTGGATGCAGG - Intronic
903951303 1:26997503-26997525 GGGGCTGAGCAGTTTGTTGGAGG + Intronic
904557584 1:31375158-31375180 GGGGCTGGGCTAATGGCTGCTGG + Intronic
905276041 1:36818929-36818951 GGGAGTGAGCACATGGCTGGTGG + Intronic
905329154 1:37180031-37180053 GTGGCTGAGCAGAGTGATGGAGG - Intergenic
906278394 1:44535702-44535724 GGAGCTGCGCAGAAGGATGGCGG - Intronic
906952978 1:50349452-50349474 GGAGCTGAGCAGATAGATGGTGG - Intergenic
907474476 1:54696475-54696497 GGGGCTGAGGGAATGGAACGGGG - Intronic
908993096 1:70118031-70118053 GAGGCTGAGGAAATAAATGGTGG - Intronic
912570663 1:110618749-110618771 GGGCCTGAGCAACTGGATGAGGG - Intronic
912959376 1:114181542-114181564 GGGGCTGAGCCTACAGATGGGGG + Intergenic
914852960 1:151328282-151328304 AGGGCTGGGCATATGGATGCTGG - Intergenic
916839382 1:168584254-168584276 GGGGCTGAGCAGGTACATGGGGG - Intergenic
918012640 1:180602269-180602291 GGGGTTGAGGACATAGATGGAGG + Intergenic
920511690 1:206556838-206556860 GGGGGTGAGGAAGTGGATGGGGG + Intronic
920771070 1:208886136-208886158 GGGACTGAGCAATAGGAAGGTGG + Intergenic
920818847 1:209361485-209361507 GGATGTGAGGAAATGGATGGAGG + Intergenic
924923654 1:248657681-248657703 AGGGCTGAGCGAAGGGAGGGAGG + Intergenic
1065770813 10:29076420-29076442 GGGTCTGTCCAAATGGAAGGAGG - Intergenic
1065849031 10:29771528-29771550 GGGGATGATCAAATGTATTGCGG - Intergenic
1066242995 10:33555887-33555909 GAGGCTGAGCAGATAGATGTTGG + Intergenic
1069623056 10:69849648-69849670 GGGGCTGAAGACAAGGATGGCGG + Intronic
1069882890 10:71604647-71604669 TGGCCTGAGCAAAAGGGTGGAGG - Intronic
1070744864 10:78927564-78927586 GGGGCTGGCCAAGTGGGTGGAGG + Intergenic
1070748591 10:78950381-78950403 GCAGGTGTGCAAATGGATGGTGG + Intergenic
1071567484 10:86679324-86679346 GGGGGTGAGCATAAGGAAGGTGG - Intronic
1072807913 10:98436558-98436580 AGAGCTGAGAGAATGGATGGAGG - Intronic
1073061962 10:100738527-100738549 GGGGCTGAGCGTCTGGATGAGGG - Intronic
1073143329 10:101262963-101262985 GGGGCTTGGCAAAGGGATTGGGG + Intergenic
1075214580 10:120520865-120520887 GGGGCTGAGGAAAGAGCTGGGGG + Intronic
1075301713 10:121330636-121330658 GAGGGAGAGAAAATGGATGGAGG - Intergenic
1076684002 10:132188502-132188524 GAGGCTCTGCAAATGCATGGTGG + Intronic
1077132284 11:979035-979057 GGGGCTGGGCCAAGGGCTGGAGG + Intronic
1077358396 11:2129040-2129062 GGGGCTGAGCACCTGGAAGCAGG - Intergenic
1077394713 11:2315281-2315303 GGAGGAGAGCAAATGGCTGGAGG + Intronic
1077511113 11:2963646-2963668 GGGCCTGGGCTAATGGATGAGGG - Intronic
1077677060 11:4204432-4204454 GGGGCTGCTCAGATGGATGCTGG - Intergenic
1078252297 11:9626159-9626181 GGGGCAAAGAAATTGGATGGTGG - Intergenic
1078586863 11:12599404-12599426 GTGGCTGAGGAATTGGGTGGAGG - Intergenic
1079153676 11:17924429-17924451 GGGTCTGTGCAAAGGAATGGTGG + Intronic
1081626439 11:44658804-44658826 AGGGCTGAGCAGAGGGAGGGAGG + Intergenic
1083264735 11:61541446-61541468 GGGGGTGGGCGAATGGCTGGTGG + Intronic
1084221870 11:67686566-67686588 GTGGTTGAGCATATAGATGGGGG + Intergenic
1084934435 11:72579424-72579446 TGGGATGGGCAAATGGGTGGGGG - Intronic
1084968170 11:72755201-72755223 GGGGCTGAGCCGCTGGAGGGGGG - Intronic
1085517055 11:77117715-77117737 AGGCCTGAGTAAGTGGATGGTGG - Intronic
1087237227 11:95733483-95733505 GGGTCTGAGGAAATGGAGGAGGG - Intergenic
1088799665 11:113293923-113293945 GAGGCAGAGAAAAAGGATGGGGG + Intergenic
1089226321 11:116925413-116925435 GGGGCTGAGCTAAAGAATGCAGG + Intronic
1089812056 11:121140388-121140410 GGGGCAGAGCACATGCCTGGAGG - Intronic
1090458669 11:126870661-126870683 TGAGCTGTGCAAATAGATGGCGG - Intronic
1090640588 11:128726180-128726202 GGGGCTGAGCCAGCGGTTGGGGG - Intronic
1091801066 12:3324725-3324747 TTGGCTGAGTAAATGGAAGGTGG + Intergenic
1091801207 12:3325903-3325925 GGGGCTGAGCATATGGCTCTGGG + Intergenic
1091944178 12:4520434-4520456 GAGGCAGAGCAAAAGTATGGAGG + Intronic
1093411823 12:18877122-18877144 GGGGCAGGGCATAGGGATGGAGG + Intergenic
1093430050 12:19074148-19074170 GGAGTTGAGCAAATTGATGGTGG + Intergenic
1096657923 12:53103309-53103331 GGAGCTGGGCATCTGGATGGTGG + Intergenic
1097731959 12:63138537-63138559 ACGGCTAAGTAAATGGATGGTGG - Intergenic
1101403880 12:104411625-104411647 GGGGCTGAGCAGAGGGGTCGGGG - Intergenic
1101847355 12:108373193-108373215 GGGGATGAAAAAAAGGATGGAGG + Intergenic
1102542804 12:113634817-113634839 GGGGGTGAGCAGAAGGGTGGGGG - Intergenic
1102720231 12:115009526-115009548 GGGTTTGAGCAGATGGATGGTGG + Intergenic
1106772594 13:32976245-32976267 GGGGCTGTGCAAGGGGTTGGTGG - Intergenic
1107035845 13:35901697-35901719 GGGCCTGAGGAGAAGGATGGAGG - Intronic
1107819352 13:44272265-44272287 AGGATTGAGCAAATGGCTGGGGG - Intergenic
1110651593 13:77948527-77948549 GAGGCTTTGCAAATGGATGATGG + Intergenic
1111528306 13:89502628-89502650 ACGGATGAGTAAATGGATGGGGG - Intergenic
1113539097 13:111092894-111092916 TGGGCTGGCCAAGTGGATGGTGG + Intergenic
1113878197 13:113607740-113607762 GGGGCTGTGCCAGTGGGTGGCGG + Intronic
1114234793 14:20814313-20814335 GGGACAAAGCACATGGATGGGGG + Intergenic
1114463326 14:22902276-22902298 GTGACTGAGCGACTGGATGGTGG - Exonic
1118714917 14:68552418-68552440 GGGGCTTTGCAAATGTTTGGGGG - Intronic
1118776092 14:68974974-68974996 GGGGCTGGGCACCTGGCTGGGGG - Intronic
1119557789 14:75566908-75566930 GGGGCTGAGCAGAGGGAAGGAGG + Intergenic
1121100847 14:91249105-91249127 GGTGCTGAGCAAGGGGATGCAGG + Intronic
1121507148 14:94485999-94486021 GGGGCAGGGCAAGTGGACGGTGG - Intergenic
1122053934 14:99079489-99079511 GAGGGTGAGAAAAGGGATGGTGG - Intergenic
1122625083 14:103080937-103080959 GGTGCTGAGCGGATGGATGAAGG + Intergenic
1122628976 14:103098876-103098898 GCGGCTAAGCAGCTGGATGGAGG - Intergenic
1123939876 15:25211660-25211682 GGGGCTGAGCACCTGGCTGACGG - Intergenic
1123942248 15:25222212-25222234 GGAGCTGAGCACCTGGATGATGG - Intergenic
1123944110 15:25230712-25230734 GGGGCTGAGCACCTGGCTGATGG - Intergenic
1123945282 15:25235948-25235970 GGGGCTGAGCACCTGGCTGATGG - Intergenic
1123946558 15:25241612-25241634 GGGGCTGAGCACCTGGCTGATGG - Intergenic
1125996268 15:44164123-44164145 GGGGCTGAAGAAATGAAAGGTGG - Intronic
1126676111 15:51160414-51160436 GGGGCTGAGAAGATGGATTAGGG + Intergenic
1128252227 15:66171488-66171510 GGGGCTGGGGACATGGGTGGGGG + Intronic
1128566735 15:68705713-68705735 GGGGCTAAGCCCAGGGATGGGGG - Intronic
1129250425 15:74305804-74305826 GGGGCTGCACAAATGAGTGGAGG - Intronic
1129866102 15:78909994-78910016 TGGGCTGAGCCCATGGATTGTGG - Intergenic
1130180275 15:81620143-81620165 GCAGTTAAGCAAATGGATGGTGG - Intergenic
1133010131 16:2905911-2905933 GGGTCTGAGCCAATGGAAGGGGG + Intergenic
1136608440 16:31352094-31352116 GGGGCTGAGGAGATGGGTGACGG + Intergenic
1137448612 16:48549764-48549786 GGGCCTGGGCAGAGGGATGGGGG - Intronic
1137536827 16:49333640-49333662 GGTGCTGAGCTGACGGATGGAGG - Intergenic
1139529630 16:67536799-67536821 GGGGCTGTGCCAATGGAGGGCGG - Intronic
1139853099 16:69962309-69962331 GGGGATGGACAGATGGATGGAGG - Intronic
1139882070 16:70185217-70185239 GGGGATGGACAGATGGATGGAGG - Intronic
1139931014 16:70526065-70526087 TGGGCTGAGCAAAAGCAGGGTGG - Intronic
1140060764 16:71567749-71567771 GAGTCTGAGGAAATGGTTGGGGG + Exonic
1140162208 16:72508809-72508831 GGGCATGAGCAAATGGAAGGGGG + Intergenic
1140370439 16:74410288-74410310 GGGGATGGACAGATGGATGGAGG + Intronic
1140492034 16:75345534-75345556 GAGGCTGAGCAAGAGGAAGGAGG + Intronic
1141642002 16:85346878-85346900 GTGGATGAGCGGATGGATGGTGG + Intergenic
1141642871 16:85351529-85351551 GGGGCTGCTCATAGGGATGGGGG + Intergenic
1141854847 16:86673943-86673965 AGGGATGAACAGATGGATGGGGG - Intergenic
1141854934 16:86674282-86674304 GTGGATGAACAAATGAATGGTGG - Intergenic
1142141886 16:88476222-88476244 GAGGCTGTGCAGAGGGATGGAGG - Intronic
1142152351 16:88518250-88518272 GTGGGTGAGTAGATGGATGGTGG + Intronic
1142208986 16:88798739-88798761 CCAGCTGATCAAATGGATGGAGG + Intergenic
1142990244 17:3725251-3725273 GGGGCTTAGCAAATACATAGAGG - Exonic
1143237993 17:5419668-5419690 CGGGCTGAGCAACTGGAGTGAGG - Exonic
1144626468 17:16846654-16846676 GGGGCTCAGCTATAGGATGGGGG + Intergenic
1144804421 17:17954931-17954953 GGGGCTGAGCAAATGGATGGAGG - Intronic
1144879965 17:18426057-18426079 GGGGCTCAGCTATAGGATGGGGG - Intergenic
1145152268 17:20518327-20518349 GGGGCTCAGCTATAGGATGGGGG + Intergenic
1146496746 17:33329427-33329449 AGGCCTGAGCTAATGGGTGGAGG + Intronic
1147776754 17:42907375-42907397 GGGGGTGAACGGATGGATGGGGG + Intronic
1148217416 17:45840565-45840587 GGGGGTGGGCACAGGGATGGGGG + Intergenic
1148755448 17:49970688-49970710 GGGGGTGAGCAATTAGATGGAGG - Intronic
1149623283 17:58061931-58061953 GATGCTGAGCAAATGGGTTGTGG - Intergenic
1150874218 17:68950766-68950788 GTGGCTGAGAAAATGGATTCTGG + Intronic
1151764552 17:76125446-76125468 GGGAGTGAGCAAAGGCATGGAGG - Intergenic
1152141884 17:78541243-78541265 GGGGGTGAGCAGATGGGTGGGGG + Intronic
1155157715 18:23171345-23171367 GGTGCTTAGCAAATGAAGGGTGG + Intronic
1155256152 18:23999797-23999819 GGGGCTGAGCAAATGTGGGGAGG + Intronic
1155615580 18:27717335-27717357 GAGACTGTGTAAATGGATGGAGG + Intergenic
1157543670 18:48532125-48532147 GGGGCTGAGCAATGGGGAGGAGG - Intergenic
1160667023 19:335725-335747 GGGGCTGAGAAGGTGGAGGGCGG - Intronic
1161137599 19:2629211-2629233 AAGGTTGAGCAAATGGATAGGGG + Intronic
1161250325 19:3276501-3276523 GGGGCTGAGCATATAGGGGGTGG + Intronic
1161422772 19:4184876-4184898 GTGATTGGGCAAATGGATGGAGG + Intronic
1161489751 19:4555439-4555461 GGGGCTGATCAGATGGAGGTTGG + Intronic
1161857888 19:6776197-6776219 ATGGATGAGCAGATGGATGGAGG - Intronic
1161916090 19:7229275-7229297 GCAGATGAGCAAGTGGATGGAGG + Intronic
1165063974 19:33218590-33218612 GGGGCTGTGGACAGGGATGGGGG + Intronic
1165099001 19:33427320-33427342 GGTGCTGAGGACCTGGATGGTGG - Intronic
1165808773 19:38597658-38597680 GGGGCTGAGGGAAGGGATGGAGG - Intronic
1165839384 19:38778812-38778834 GGGGCTGAGCAAGGTCATGGTGG + Intergenic
1166030792 19:40125628-40125650 GGGGGTGAGGAAATGGAGGGAGG + Intergenic
1167254375 19:48418527-48418549 GAGGCTGGGGAAATGGTTGGTGG + Intronic
1168050233 19:53824289-53824311 GAGGCTGAGCCAGTGGTTGGAGG + Exonic
1168311982 19:55465068-55465090 TGGGCTGAGCAGAGGGAGGGAGG - Intergenic
1168549416 19:57280653-57280675 GGGGCTGAGGAGACGGAGGGCGG - Exonic
1168553676 19:57320677-57320699 GGGGCTGAGGAGACGGAGGGCGG - Exonic
1168714473 19:58518943-58518965 CTGGCTGAGCAAAGGGACGGCGG - Intronic
925141326 2:1551445-1551467 GGTGCTGAGCACACGGAGGGCGG - Intergenic
926125747 2:10270676-10270698 GGAGCTGAGAAACTGGCTGGAGG - Intergenic
926531704 2:14055344-14055366 GGGGCTGCTCCAATTGATGGTGG + Intergenic
926687659 2:15710442-15710464 GGGGCTGAGCAGCTGGCAGGTGG + Intronic
927561525 2:24077048-24077070 GGGGCTGAGGAAAGTGGTGGAGG + Intronic
929136109 2:38625270-38625292 GGCACTGAGAAAATTGATGGTGG + Intergenic
929776528 2:44934059-44934081 GGGGCTGGGCAAAAGGAGAGAGG + Intergenic
932142626 2:69293226-69293248 GGGAATGAGCAAATGCATGAAGG + Intergenic
932869358 2:75381264-75381286 GGGGCAGAGCAAGGGGGTGGGGG + Intergenic
934614777 2:95764259-95764281 GGGGCAGAGCCAGTGGATGGAGG - Intergenic
934646126 2:96060235-96060257 GGGGCAGAGCCAGTGGATGGAGG + Intergenic
934839529 2:97616318-97616340 GGGGCAGAGCCAGTGGATGGAGG + Intergenic
936087886 2:109481650-109481672 GGGGCTGGACATGTGGATGGAGG + Intronic
936937769 2:117854568-117854590 GAGGGTGAGCAAATGCCTGGAGG - Intergenic
936978815 2:118245053-118245075 GGAGCTGGTTAAATGGATGGGGG + Intergenic
937484099 2:122295843-122295865 TGGCTTGAGCACATGGATGGGGG - Intergenic
940770185 2:157831125-157831147 GGGGCTGAGAAAATGGGTAGTGG - Intronic
940878095 2:158918673-158918695 GGGCCTGAGCAAATGTCTGATGG + Intergenic
941499258 2:166249103-166249125 GGGGCCGTGCAAATATATGGAGG - Intronic
942060026 2:172220717-172220739 GGGTTTGAGAAAATGGATAGAGG + Intergenic
942562002 2:177229719-177229741 GTGGCTGAAGAAAGGGATGGGGG - Intronic
942657585 2:178230165-178230187 GGATCTGAGCAAAAGGATGTGGG - Intronic
947251266 2:228107240-228107262 GGGGCTGAGATAATGGATTCAGG - Intronic
949001489 2:241616745-241616767 GCGGCTAAGCAACTAGATGGAGG + Intronic
1170873452 20:20229573-20229595 CTGGGTAAGCAAATGGATGGAGG + Intronic
1171320678 20:24241610-24241632 GGGGCCTAGCAGATGGTTGGGGG - Intergenic
1171380542 20:24730972-24730994 GGGGCTGGGTAACTGGGTGGAGG - Intergenic
1172230850 20:33334499-33334521 GAGGGTGGGCAGATGGATGGTGG + Intergenic
1173549722 20:43924129-43924151 GGGGATGAGCATATGGAAGAGGG + Intronic
1175903587 20:62369334-62369356 GGAGCTGAGCGTATGGAGGGCGG + Intergenic
1177778183 21:25593382-25593404 GAGGCTGAGAAAATGGATCCAGG + Intronic
1179026961 21:37686886-37686908 GGGGTTGAAAAAATGGAGGGTGG + Intronic
1179049250 21:37874721-37874743 AGGCCTGAGCAAATGGAAGAAGG - Intronic
1179414200 21:41185297-41185319 GGGGCTAAACAAATGGAGGAAGG + Intronic
1181620797 22:24089948-24089970 GGGGCTCAGGAAATGGCTGATGG - Intronic
1181623947 22:24109623-24109645 GTAGCTGAGCAAAGGGTTGGTGG + Intronic
1182048585 22:27296300-27296322 CGGGCTGAGCAACTGCACGGTGG - Intergenic
1183926458 22:41209871-41209893 AGGGCTGAGCAAATGCAGCGGGG - Exonic
1184855182 22:47142691-47142713 GGGGATGGGTAGATGGATGGGGG - Intronic
1184946392 22:47807260-47807282 GGTGCTGAGTGGATGGATGGAGG + Intergenic
1184970946 22:48019432-48019454 GGGTCTGAGGAAATGGGAGGTGG + Intergenic
950684327 3:14605646-14605668 GGGGCTGATCCAATAGCTGGGGG + Intergenic
950739837 3:15041416-15041438 GTGGCTGAGTGAATGGATGCTGG + Intronic
951588777 3:24241421-24241443 GTGGCAGAGCAAATGGCTGTAGG - Intronic
952402040 3:32972152-32972174 GTGGTTGAGCATATAGATGGGGG - Intergenic
954080266 3:48209471-48209493 CGGCCTGAGCAAAGGCATGGTGG - Intergenic
955005265 3:54962779-54962801 AGGGCTGGGCAAATGGAAGTAGG + Intronic
955029751 3:55204786-55204808 GGGGTAGAGCACATGGATAGAGG - Intergenic
956209678 3:66789940-66789962 GGGCATGGACAAATGGATGGTGG + Intergenic
956704649 3:71988989-71989011 GAAGCTGAGCAAATATATGGAGG - Intergenic
959847885 3:111055494-111055516 TGCGCTAAGGAAATGGATGGAGG + Intergenic
959857378 3:111175173-111175195 GGGGACAAGCAGATGGATGGCGG - Intronic
965586649 3:170324974-170324996 GGGGATGGGCAAGTGGATGAGGG + Intergenic
965635972 3:170781060-170781082 GGGGATTAGCATATGGAAGGTGG + Intronic
967893359 3:194378893-194378915 AGGGCTGAGCAAAGGCCTGGAGG + Intergenic
967964853 3:194953031-194953053 GGGGCTCAGCATCTGGATGGTGG - Intergenic
968691036 4:1990313-1990335 CAGGCTGAGGAAATGGATGTGGG - Intronic
969106622 4:4811407-4811429 AGGGATGAGGAAATGGAGGGAGG - Intergenic
969319893 4:6405411-6405433 AGTGCTGAACAAATGAATGGGGG + Intronic
969526052 4:7704648-7704670 GGGGCTGAGCAGAAGGAAGCCGG - Intronic
969675881 4:8614131-8614153 GGGGCTGAACAACTGCAAGGTGG - Intronic
970503935 4:16707740-16707762 GAGGCTGAGCAGCTGGATGTTGG - Intronic
971396095 4:26228928-26228950 GGAGCTGAGTAAATGGAGGTGGG - Intronic
976519200 4:86006752-86006774 GGGGATAAGCAAATAGATGAAGG - Intergenic
976838758 4:89406815-89406837 GGGGCTCAGTAACTTGATGGAGG + Intergenic
977152074 4:93525305-93525327 GGGCCTGAGCAAAGGCATGAAGG + Intronic
977152281 4:93527798-93527820 AGGGCTGTGGAGATGGATGGTGG - Intronic
978657435 4:111080735-111080757 GGGGCTGAGGAAATATTTGGGGG + Intergenic
979549582 4:121975815-121975837 GGGATTGTGCAAATGCATGGAGG - Intergenic
981188026 4:141828038-141828060 TGGGCCTAGGAAATGGATGGGGG + Intergenic
983082634 4:163406018-163406040 GGGGAGGAGCAAAAGGATGGGGG - Intergenic
985550874 5:532968-532990 TGGGCTGAGCAAAGGGCTCGGGG + Intergenic
986129791 5:4918626-4918648 TGGGCTGAGAAGATGGATAGAGG + Intergenic
986176623 5:5358077-5358099 GGGTCCCAGGAAATGGATGGTGG + Intergenic
986438635 5:7759342-7759364 GAGGCTGAGCAGGTGGCTGGAGG - Intronic
987295905 5:16551201-16551223 AGGGCTGAGAAAATGGAGGTAGG - Intronic
993145211 5:84085800-84085822 GGGACAGAGCACATGGAGGGAGG - Intronic
993302917 5:86235591-86235613 GAGGATGAGGAAAAGGATGGGGG + Intergenic
994157805 5:96523124-96523146 GAGGCTGAGCCAATGGATGGAGG - Intergenic
997398135 5:133580904-133580926 GGGGCTGTGCAGATTGAAGGAGG - Intronic
997465998 5:134088456-134088478 GGGGCTGACCACAGGCATGGAGG + Intergenic
997823838 5:137089051-137089073 GGGGCTGAGCAGGAGAATGGAGG + Intronic
999230941 5:150061455-150061477 GGGGATGAGGGAAGGGATGGGGG - Intronic
999977937 5:156930343-156930365 GGGGTTGAGCAATGTGATGGAGG + Intronic
1001833888 5:174813690-174813712 GGAGCAGAGAAAATGGAGGGAGG - Intergenic
1001869218 5:175136014-175136036 GGGGCTGAGCACAGGAATGAGGG + Intergenic
1002067665 5:176660213-176660235 GTGGATGAGTGAATGGATGGAGG - Intergenic
1002349148 5:178570739-178570761 CAGGCTGAGCACATGGAGGGGGG + Intronic
1002399070 5:178981170-178981192 GGGGCTGTGCATCTGGATGGAGG - Exonic
1002465070 5:179404136-179404158 GAGGAGGAGCAGATGGATGGGGG + Intergenic
1002472236 5:179442400-179442422 GTGGGTGAACAAATGGATGAAGG + Intergenic
1002472264 5:179442578-179442600 GTGGGTGAACAAATGGATGAAGG + Intergenic
1002539997 5:179900306-179900328 GGGGAAGAGCAAAGGGATGAGGG + Intronic
1003972587 6:11313350-11313372 ATGGCTGAGTAGATGGATGGTGG + Intronic
1005089147 6:22038121-22038143 GGGGCTAAGTATATGGATGGTGG + Intergenic
1006007090 6:31011039-31011061 GGTGCTGGGGAAATGGAGGGGGG + Intronic
1006866984 6:37216555-37216577 TGGGATGAGCACCTGGATGGAGG + Intronic
1007371012 6:41427310-41427332 GGGGCTCAGCAATTGGCAGGTGG - Intergenic
1007502690 6:42310743-42310765 GGGGCTTGACAAATGGTTGGGGG - Intronic
1011243906 6:85301549-85301571 GTGGCTGGTCACATGGATGGAGG - Intergenic
1013183961 6:107741298-107741320 GGTGCTAAGCAGATGGAGGGAGG - Intronic
1013190591 6:107801715-107801737 GGGGGTTAGCACATGGAGGGTGG + Intronic
1016314459 6:142771027-142771049 GGTGCTGAGCAAAGGGATGTGGG + Exonic
1017449293 6:154539083-154539105 GGCACTGAACAAATGCATGGAGG + Intergenic
1018095694 6:160385501-160385523 GGGGCTGAGCACCTGAAGGGAGG - Intronic
1019182423 6:170198967-170198989 GGGGCTGAGAATGGGGATGGAGG + Intergenic
1019379471 7:713319-713341 GGGGCTGGGCAGGTGGGTGGAGG - Intronic
1019587608 7:1813762-1813784 GAGGCTGAGAAAATGGAGAGTGG - Intergenic
1020806369 7:12795120-12795142 GGGGTTGTACATATGGATGGTGG - Intergenic
1021468421 7:20972341-20972363 GTGCCTGAGCAATTGGATGGGGG + Intergenic
1021924804 7:25523943-25523965 AGGCCTGAGCAAAGGGAAGGGGG + Intergenic
1023448809 7:40259693-40259715 TGGGTTGAGCAAATGAATGTCGG - Intronic
1026543745 7:71303487-71303509 GGGTCTGTGTAAATGGATGAGGG + Intronic
1028902633 7:96118483-96118505 GGAGCTCAGCAAATGGTTGTGGG + Intergenic
1029690137 7:102175683-102175705 GGGGCTGAGCCACAGGAGGGGGG - Intronic
1030611695 7:111697046-111697068 TGTGCTGAGCAAATGAAAGGGGG - Intergenic
1031096613 7:117427864-117427886 GGGGCAGATGAAAAGGATGGCGG - Intronic
1031870298 7:127083600-127083622 GGGGCTTAGGAAAGGGATGATGG - Intronic
1032217434 7:129968653-129968675 GGGGCTTAGCAAATCTAAGGAGG - Intergenic
1034271616 7:149805920-149805942 GGGGCTGAGCAAGTGGACCAGGG - Intergenic
1037726562 8:21487368-21487390 GGGGCTGAGGCTAGGGATGGGGG - Intergenic
1038118008 8:24579475-24579497 GAGGCTGAGGAAATAGAAGGTGG + Intergenic
1038395509 8:27242957-27242979 GGGGCAGACCAGAGGGATGGTGG - Intronic
1039261855 8:35780451-35780473 AGGGCCGAGGAAAAGGATGGAGG + Intronic
1040462590 8:47663071-47663093 GTGGCTGAGAAACTGGAAGGAGG - Intronic
1046003173 8:108445566-108445588 GGGGATGAGGAAAGGGAAGGGGG - Intronic
1048276692 8:133071394-133071416 AGGCCTGAGGAAAGGGATGGAGG + Intronic
1048290663 8:133178989-133179011 GGGGATGGGGAGATGGATGGAGG - Intergenic
1048979783 8:139697083-139697105 GTGGGTGAACAGATGGATGGTGG + Intronic
1048994753 8:139787461-139787483 GGGGCAGAGCCAAGGGAAGGTGG + Intronic
1049218189 8:141417361-141417383 GGTGCTGAGTAAATTCATGGAGG + Intronic
1049473777 8:142787684-142787706 TGGGCTGAGCAGGTGGATGGGGG - Intergenic
1049750193 8:144279401-144279423 GTGGCTGAGCACATGGCTGGTGG - Intronic
1049762885 8:144338835-144338857 GGGGCTGAGAGGGTGGATGGAGG - Intergenic
1050351273 9:4742498-4742520 GTAGCTGAGTGAATGGATGGGGG + Intergenic
1052245177 9:26325575-26325597 GAGGCTCTGCAAATGGATAGAGG - Intergenic
1053011394 9:34635790-34635812 GGGGCCAAACACATGGATGGTGG - Exonic
1053443534 9:38135020-38135042 GGGGCTCCGCAGAGGGATGGGGG + Intergenic
1055042795 9:71893532-71893554 ATGGCTGAGCACATGGAGGGTGG - Intronic
1055788345 9:79895148-79895170 GGGGCTGAGCAATCCCATGGAGG - Intergenic
1056741626 9:89261275-89261297 GGGGCTGAGCCCCTGGATAGTGG - Intergenic
1057131620 9:92657971-92657993 GGGGGTGAGCTCCTGGATGGTGG - Intronic
1057211996 9:93205491-93205513 GGGGCTGACCAGCAGGATGGGGG - Intronic
1057561327 9:96130292-96130314 GAGGCTGAGCAAATTAAGGGGGG + Intergenic
1058578112 9:106425313-106425335 GAGGCAGAGCAATTGGAGGGTGG - Intergenic
1061534219 9:131237627-131237649 GAGGAGGAGCAATTGGATGGAGG + Intergenic
1062418961 9:136469863-136469885 GTGGCTGAGCAGTTGGATGTAGG - Intronic
1185726742 X:2427658-2427680 GGGGCTGAGAAAATTCAAGGAGG + Intronic
1185983940 X:4809795-4809817 GGTGTTCAGGAAATGGATGGCGG - Intergenic
1188004425 X:25007323-25007345 GGGGCTGAGCGGGTGGGTGGCGG + Exonic
1189013959 X:37076805-37076827 GTGGCTGAGGAAATGAAGGGAGG - Intergenic
1189491502 X:41474488-41474510 GTGGCTGAGGGACTGGATGGAGG + Exonic
1189650811 X:43187635-43187657 GTAACTGAGTAAATGGATGGTGG + Intergenic
1190552959 X:51603626-51603648 ATGTCTGAGGAAATGGATGGGGG - Intergenic
1192199895 X:69060226-69060248 GGGGCTTAGCAGAGGGAAGGGGG + Intergenic
1195524284 X:105868703-105868725 GGGGCGGGGGAAGTGGATGGGGG - Intronic
1196808041 X:119605985-119606007 GGGGCGGAGAAGATGGCTGGAGG - Intergenic
1197115962 X:122834121-122834143 GAGGCTGAGCCCATGGATGAAGG + Intergenic
1197400966 X:125990581-125990603 TGGTCTGTGCAACTGGATGGAGG - Intergenic
1199677706 X:150201597-150201619 GGGGCTCAGCCAAAAGATGGAGG + Intergenic
1200165702 X:154033726-154033748 GGGGCTGAGAACACGGAGGGTGG - Intronic
1200216000 X:154368546-154368568 GGGGCTGAGGAAGAGGAAGGTGG + Intronic