ID: 1144808656

View in Genome Browser
Species Human (GRCh38)
Location 17:17984553-17984575
Sequence CCTAGCAGGGAGAAGGTGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 266}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144808641_1144808656 30 Left 1144808641 17:17984500-17984522 CCTTCTGCTGGCCTCTTAGGAGC 0: 1
1: 0
2: 0
3: 15
4: 209
Right 1144808656 17:17984553-17984575 CCTAGCAGGGAGAAGGTGATGGG 0: 1
1: 0
2: 2
3: 25
4: 266
1144808647_1144808656 5 Left 1144808647 17:17984525-17984547 CCTCACATCTGGTGAGGGGCAAT 0: 1
1: 0
2: 5
3: 9
4: 200
Right 1144808656 17:17984553-17984575 CCTAGCAGGGAGAAGGTGATGGG 0: 1
1: 0
2: 2
3: 25
4: 266
1144808642_1144808656 19 Left 1144808642 17:17984511-17984533 CCTCTTAGGAGCATCCTCACATC 0: 1
1: 0
2: 1
3: 18
4: 115
Right 1144808656 17:17984553-17984575 CCTAGCAGGGAGAAGGTGATGGG 0: 1
1: 0
2: 2
3: 25
4: 266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144808656 Original CRISPR CCTAGCAGGGAGAAGGTGAT GGG Intronic
901869120 1:12127135-12127157 CCCAGGAGAGAGAAGGTGCTTGG - Intronic
902819674 1:18936298-18936320 CCTTGCATGGAGCAGATGATGGG + Intronic
903537945 1:24079814-24079836 CCTAGCATGGAGCAGGATATGGG + Intronic
905554708 1:38873130-38873152 CCGAGCAGGAAGAAGGCGCTGGG + Intronic
905619987 1:39436634-39436656 CCTAGAAGTGAGAGAGTGATGGG + Intronic
905665675 1:39761634-39761656 GCCAGCAGGGAGAAGGGGCTGGG - Intronic
905749514 1:40450161-40450183 CCCAGCGGGGAGAGGGTGAGCGG + Exonic
906288127 1:44601678-44601700 CCTAGCAGAGAGAGGGGGACAGG + Intronic
907524504 1:55046387-55046409 ACTAGCAGGGACAAGGTGGGAGG + Intronic
907887942 1:58610940-58610962 CCTAGCTGTGAGAAGGTGGTGGG - Intergenic
913463182 1:119111556-119111578 TCCAGCAGGGAGAAGGGGAAAGG - Intronic
914425012 1:147567771-147567793 CCTAGCAGGGGGAGGGGGAAGGG - Intronic
917881212 1:179337707-179337729 CCTAGTAGTGAAAAGGTCATTGG + Intronic
918611363 1:186496123-186496145 ACTGGCAAGGAGAAGGTGAAAGG + Intergenic
921529675 1:216265898-216265920 GATAGCAGGGAGAAGGGGATAGG + Intronic
921932203 1:220763901-220763923 CCTAGCAGAGAAATGGTGACTGG + Intronic
922563745 1:226587715-226587737 CCCAGCAGAGAGAAGGTGTATGG - Intronic
924205446 1:241707088-241707110 ACTAGCTGGGAGAAGGGGTTGGG - Intronic
1064534698 10:16346645-16346667 CATAGTAGGGAGAAGGGGCTGGG - Intergenic
1066474366 10:35730635-35730657 CCTAGCATGCAGAAAGTGCTTGG - Intergenic
1070801428 10:79246567-79246589 CCCAGCAGGGAGAAGGATTTCGG + Intronic
1071280553 10:84098582-84098604 CCTAGAAGGAAGAATTTGATTGG + Intergenic
1071503516 10:86219543-86219565 CAGAGCAGGGAGAAGGGGAGCGG - Intronic
1071961314 10:90810921-90810943 CCTAGGATGTAGAAGGTGTTGGG - Intronic
1072213620 10:93269711-93269733 CCTAGTTGGGAGAAGATGAGAGG + Intergenic
1074908639 10:117887145-117887167 CCCAGGAGGGAGAAGGGGAGAGG - Intergenic
1075046500 10:119150348-119150370 CCTGGCAGGCAGGAGGTGCTGGG + Intronic
1076708125 10:132313409-132313431 CCTAGCATGGAGCAGGTGCTTGG - Intronic
1077173522 11:1178743-1178765 CCCAGAAGGGAGAAGGGAATGGG + Intronic
1077709276 11:4519763-4519785 CCTTGGAGGTAGAATGTGATGGG - Intergenic
1078143192 11:8706339-8706361 CCTAGCAGGGACATCGTGATTGG + Intronic
1078896374 11:15600583-15600605 CCTGGCAGGCAGAAAGGGATTGG - Intergenic
1081419463 11:42856430-42856452 CCTACCCAGGAGTAGGTGATAGG - Intergenic
1082190091 11:49232560-49232582 AGCAGCAGGGAGAAGTTGATGGG - Intergenic
1084250939 11:67898362-67898384 CCAAGCAGGGAGTACGTGACTGG + Intergenic
1084453676 11:69254890-69254912 CTGAGCAGAGAGTAGGTGATGGG + Intergenic
1084821901 11:71697690-71697712 CCAAGCAGGGAGTACGTGACTGG - Intergenic
1086676038 11:89608372-89608394 AGCAGCAGGGAGAAGTTGATGGG + Intergenic
1087105458 11:94402751-94402773 CCTAGAAGGGACAAGGTGCTAGG + Intergenic
1087112740 11:94488783-94488805 CCTACCAGAGAGCAGATGATAGG + Intronic
1087546483 11:99590785-99590807 CCTAGCATGGTCAAGATGATTGG - Intronic
1089750537 11:120648254-120648276 ACTGGCAGAGGGAAGGTGATGGG + Intronic
1090492153 11:127174073-127174095 ACTGGCTGGGAGTAGGTGATTGG + Intergenic
1090776301 11:129968782-129968804 CCCAGCAGGGGGATGGTGAGTGG - Intronic
1091829495 12:3539675-3539697 CGGAGCAGGGAGAAGGAGATGGG - Intronic
1093567999 12:20631722-20631744 CTTAGCAGGAAGAATGTAATGGG + Intronic
1094030816 12:26009749-26009771 TTTAGCAAGGTGAAGGTGATTGG + Intronic
1094124916 12:27013972-27013994 CCTAGCAGGGAGATGGTGCTGGG - Intronic
1095122044 12:38430884-38430906 GCTGGGAGGCAGAAGGTGATGGG + Intergenic
1095712916 12:45309146-45309168 CATGAAAGGGAGAAGGTGATTGG + Intronic
1096716055 12:53492366-53492388 CCTGGCACGCAGAAGGTGCTCGG + Intronic
1096805760 12:54140295-54140317 CCTGGCAGCGAGCAGGTGCTCGG - Intergenic
1097054731 12:56242715-56242737 CCGAGCAGGGAGGCAGTGATGGG + Exonic
1100756713 12:97759211-97759233 TCCAGCAGAGAGAAGGTGTTTGG + Intergenic
1101156576 12:101933311-101933333 AATAGCAGGGAGAATGTAATGGG - Intronic
1102454380 12:113062833-113062855 CCCAGCAGGGGAAAGGTGAGGGG - Intronic
1105338283 13:19495362-19495384 GCTTGCAGCGAGAAGGAGATAGG - Intronic
1106988629 13:35387884-35387906 CCTTGCAGGGAAAAGGCGAAGGG - Intronic
1108202895 13:48059891-48059913 CCTAGGATGTAGAAGGTGTTGGG - Intronic
1112237027 13:97645811-97645833 CCTAGGATGTAGAAGGTGTTGGG - Intergenic
1112538880 13:100286455-100286477 CAGAGCAGGTAGCAGGTGATCGG + Intronic
1113352400 13:109542315-109542337 CCTCGCAGGGAGAAGGCAAGAGG + Intergenic
1113667319 13:112149732-112149754 CCTCACAGGGGGAAGGTGGTGGG - Intergenic
1114141738 14:19919670-19919692 TCTAGCAGGGAGAATGTAAGTGG + Intergenic
1114320319 14:21541737-21541759 AGGAGCAAGGAGAAGGTGATTGG + Intergenic
1116962219 14:50978141-50978163 CCTTGCAGGGAGAAGGGCAGGGG + Intronic
1117748885 14:58900250-58900272 GCTAGCAGGAAGAAGCTAATGGG - Intergenic
1118105123 14:62650079-62650101 CCTAGCAGGCAGAAGGAGAGAGG + Intergenic
1119321121 14:73731080-73731102 CCTAGCAGGGAGAAGTAGGAGGG - Intronic
1120627489 14:86846905-86846927 CCTAGAAGAGATAATGTGATGGG + Intergenic
1120700771 14:87696672-87696694 CTTACCATGGAGAAGTTGATAGG - Intergenic
1121644194 14:95506718-95506740 CCCAGCAAGCAGAAGGTGCTGGG - Intergenic
1122095787 14:99370468-99370490 GCTATCAGGCAGAAGGTTATAGG + Intergenic
1122875844 14:104664524-104664546 CCTAGCAGGGAGGTGAAGATGGG - Intergenic
1122925419 14:104897361-104897383 CCTAGCAGGGAGAAGGAACTGGG - Intergenic
1125522310 15:40355015-40355037 CCTAGGAGGCAGAAGGAGACTGG + Intronic
1125572501 15:40731722-40731744 CCAAGCAGGTAGATGGTGAAGGG - Intronic
1125605545 15:40937936-40937958 CCTCCCTGGGAGAAGGCGATGGG - Intronic
1127376937 15:58393643-58393665 CCTAGAAAGGAGAAGCTAATAGG + Intronic
1128244183 15:66121653-66121675 CCCAGCAGGTAGCAGGTGAAAGG + Intronic
1128325387 15:66720725-66720747 TCTAGCACGGGGAAGGGGATGGG + Intronic
1129258058 15:74345402-74345424 CAGAGCAGGGAGGAGGTGAGAGG - Intronic
1129320104 15:74769995-74770017 CCTGGCATGGAGCAGGTGCTCGG - Intergenic
1131349269 15:91682158-91682180 CCATGCAGGGAGAAGATCATGGG + Intergenic
1131390575 15:92044598-92044620 CCTAGGAGGAGGAAGGTGAGGGG - Intronic
1132387029 15:101407998-101408020 CCTAGCGGGGAGACCGTGAAAGG - Intronic
1133228378 16:4354403-4354425 CCCAGCAGTGCGCAGGTGATTGG + Intronic
1133876063 16:9735664-9735686 CCAAGGGAGGAGAAGGTGATCGG + Intergenic
1137901695 16:52275722-52275744 CAAAGCAGTGAGAAGGTGCTGGG + Intergenic
1140276844 16:73517021-73517043 GCTAGCAGGCAGAAGTTGAAAGG - Intergenic
1140422475 16:74831935-74831957 CCCAGGAAGGAGAAAGTGATTGG + Intergenic
1141859031 16:86704101-86704123 CATTGCAGGGAGAAGCTGATGGG + Intergenic
1143353111 17:6303884-6303906 CCAAGCAGGGACTAGGTGCTGGG - Intergenic
1144808656 17:17984553-17984575 CCTAGCAGGGAGAAGGTGATGGG + Intronic
1145012903 17:19379694-19379716 CCTAGAAGGGAGGTGTTGATAGG + Intronic
1146501999 17:33372539-33372561 CCAAGTAGGGAGAAGATGCTGGG - Intronic
1146594542 17:34157336-34157358 CCTAGCAGGGACAGGGAGCTGGG - Intronic
1146992064 17:37283405-37283427 CCTGGGAGGGGGAAGGAGATGGG + Exonic
1147132893 17:38419385-38419407 CCCAGCATGGAGCAGGTGAGCGG + Intergenic
1147559984 17:41502820-41502842 GCAAGCAGGAAGAAGGTGGTGGG + Intronic
1148166435 17:45487114-45487136 CTTAGCAGGGGAAAGGTGACTGG + Intronic
1148463101 17:47849274-47849296 CCTAGCATGGAGAGGAAGATGGG - Intronic
1148896958 17:50844412-50844434 CCTAGCAGGCTGGAGGTGCTGGG - Intergenic
1150004926 17:61463559-61463581 CCCAGCAGGGAGAAGGAGAGGGG + Intronic
1150397605 17:64833514-64833536 CTTAGCAGGGGAAAGGTGACTGG + Intergenic
1150443622 17:65211349-65211371 CCCAGCATGGACAAGGGGATGGG - Intronic
1150950193 17:69795067-69795089 CTTAGCAGGGGGAAGAAGATAGG - Intergenic
1151163248 17:72183499-72183521 GCTAGCAGGGGGATGGTGGTGGG - Intergenic
1153257995 18:3192078-3192100 CAGAGCAGGGAGAAGATGTTAGG + Intronic
1156198108 18:34798488-34798510 GGAAGCAGGGAGAAGGTGAGAGG - Intronic
1160487611 18:79308687-79308709 CCCAGCAGGTAGAAGGTCAGGGG + Intronic
1160487621 18:79308723-79308745 CCCAGCAGGTAGAAGGTCAGGGG + Intronic
1160487630 18:79308759-79308781 CCCAGCAGGTAGAAGGTCAGGGG + Intronic
1160487637 18:79308795-79308817 CCCAGCAGGTAGAAGGTCAGAGG + Intronic
1160487646 18:79308831-79308853 CCCAGCAGGTAGAAGGTCAGGGG + Intronic
1160487655 18:79308867-79308889 CCCAGCAGGTAGAAGGTCAGGGG + Intronic
1160487664 18:79308903-79308925 CCCAGCAGGTAGAAGGTCAGGGG + Intronic
1160487674 18:79308939-79308961 CCCAGCAGGTAGAAGGTCAGGGG + Intronic
1160487683 18:79308975-79308997 CCCAGCAGGTAGAAGGTCAGGGG + Intronic
1160487693 18:79309011-79309033 CCCAGCAGGTAGAAGGTCAGGGG + Intronic
1160487702 18:79309047-79309069 CCCAGCAGGTAGAAGGTCAGGGG + Intronic
1160487712 18:79309083-79309105 CCCAGCAGGTAGAAGGTCAGGGG + Intronic
1160487722 18:79309119-79309141 CCCAGCAGGTAGAAGGTCAGGGG + Intronic
1160487731 18:79309155-79309177 CCCAGCAGGTAGAAGGTCAGGGG + Intronic
1160487738 18:79309191-79309213 CCCAGCAGGTAGAAGGTCAGAGG + Intronic
1160487747 18:79309227-79309249 CCCAGCAGGTAGAAGGTCAGGGG + Intronic
1160487757 18:79309263-79309285 CCCAGCAGGTAGAAGGTCAGGGG + Intronic
1160487766 18:79309299-79309321 CCCAGCAGGTAGAAGGTCAGGGG + Intronic
1160487775 18:79309335-79309357 CCCAGCAGGTAGAAGGTCAGGGG + Intronic
1160487784 18:79309371-79309393 CCCAGCAGGTAGAAGGTCAGGGG + Intronic
1160487794 18:79309407-79309429 CCCAGCAGGTAGAAGGTCAGGGG + Intronic
1160487804 18:79309443-79309465 CCCAGCAGGTAGAAGGTCAGGGG + Intronic
1160487813 18:79309479-79309501 CCCAGCAGGTAGAAGGTCAGGGG + Intronic
1160487831 18:79309551-79309573 CCCAGCAGGTAGAAGGTCAGGGG + Intronic
1160487840 18:79309587-79309609 CCCAGCAGGTAGAAGGTCAGGGG + Intronic
1160487849 18:79309623-79309645 CCCAGCAGGTAGAAGGTCAGGGG + Intronic
1160487858 18:79309659-79309681 CCCAGCAGGTAGAAGGTCAGGGG + Intronic
1161865234 19:6828363-6828385 CCCCGCAGGGAGAAGGGGAGGGG + Intronic
1162080361 19:8214358-8214380 CCCCGCAGGGAGAAGGTGATGGG + Intronic
1165029507 19:32987520-32987542 CTTTGCAGTGAGAGGGTGATGGG - Intronic
1165691219 19:37865171-37865193 CCTTGAAAGGAGAAGCTGATTGG + Intergenic
1166361216 19:42253760-42253782 CCGAGCAGGGGGATGGGGATGGG + Intronic
1166701725 19:44886065-44886087 CCTGGCAGGGAGAAGCTGGCTGG + Intronic
1166965795 19:46528778-46528800 CCTAGCATGGAGGCGGTGAGTGG - Intronic
1167064736 19:47176367-47176389 CCTAGTGGGGACAAGGTGCTTGG + Intronic
1167466653 19:49653792-49653814 CCTGGCAGGGAGAGGTTTATAGG + Intronic
1168367314 19:55799615-55799637 TTTAGCTGGGAGAATGTGATAGG + Intronic
925280758 2:2682965-2682987 GCTAGCGGGGGGAAGGTGAAGGG + Intergenic
926008073 2:9388321-9388343 CCCAGCTGGTAGAAGCTGATGGG - Exonic
926120094 2:10237131-10237153 AGTGGCAGGGAGGAGGTGATGGG + Intergenic
929055963 2:37876006-37876028 CCTAGCACAGAGTAGGTGCTTGG - Intergenic
931334594 2:61326752-61326774 CCTAGCATGCAGAAGGTCAATGG + Intronic
932296045 2:70624128-70624150 CCTAGGATGTAGAAGGTGTTGGG - Intronic
932331705 2:70901590-70901612 GCTTGCAGGAAGAAGGTGCTGGG - Intronic
932468900 2:71941141-71941163 TCTAGCCGGGAGACGGTGGTGGG - Intergenic
932692294 2:73923162-73923184 CCCAGAAGGGAGAATCTGATTGG - Intergenic
932781647 2:74562254-74562276 GGTAGCAGGGGGAAGGTGCTGGG + Exonic
933655892 2:84886698-84886720 CATATCAGGAAGAAGGTGTTAGG - Intronic
936516615 2:113185277-113185299 CCAGGCAGGGAGAAGGGGAAAGG - Intronic
937345238 2:121121275-121121297 CCTGGCAGGGAGCTGGTGCTGGG - Intergenic
938256517 2:129863663-129863685 GCAAGCAGGGAGGAGGTGATTGG - Intergenic
938383724 2:130850534-130850556 CCTTGCAGGGGGGAGGTGTTGGG - Intronic
939442290 2:142264488-142264510 CCAGGGAGGGAGAAGGTGTTTGG + Intergenic
941052129 2:160746888-160746910 CCCAGCAGGGAGAAAGGGCTTGG - Intergenic
941224246 2:162826422-162826444 CCTAGAAGGGAAAAGGTGAATGG - Intronic
941662808 2:168212797-168212819 CCCAGGAGGGAGAGGATGATCGG - Intronic
942166912 2:173250370-173250392 CACAGCAGGGAGAAGGAAATAGG + Intronic
946606926 2:221415615-221415637 CCTAGGAGGAAGGAGGTGGTTGG - Intergenic
948510005 2:238457838-238457860 CCAATCAGGGAGAAGGGAATGGG - Intergenic
948802707 2:240440089-240440111 GCCAGGAGGGAGAAGGTGCTGGG + Intronic
1168819860 20:765536-765558 CCCAGCAGGGTGAAGATGATGGG + Exonic
1170488077 20:16840499-16840521 CCTAGAAGAGAGAAGCTGGTTGG + Intergenic
1171346785 20:24471168-24471190 CCTAGCACGGAGAAGTTGGCCGG - Intronic
1172231820 20:33341811-33341833 CCTGGCAGGGAGAAAGTGCAGGG + Intergenic
1172605061 20:36208439-36208461 CCTGGCCGGGTGAAGGTGACTGG - Intronic
1172642508 20:36449247-36449269 CCTAGCAGAAAGAAGCTGAGTGG - Intronic
1172997036 20:39078534-39078556 CCCAGCAGGGAGGAGCTGACAGG - Intergenic
1173669675 20:44789993-44790015 CCCAGCAGGGAGACTGGGATGGG + Intronic
1173755590 20:45512877-45512899 GCAAACAAGGAGAAGGTGATGGG - Intronic
1176735275 21:10540514-10540536 GCTTGCAGGGAGAAGGAGATAGG + Intronic
1176938915 21:14900197-14900219 CCTAAGAGGGAGAATCTGATTGG - Intergenic
1178634927 21:34294132-34294154 CCTAGAAGAGAGAAGTTGATTGG + Intergenic
1178768878 21:35483864-35483886 CCTTGCAGAGAGAAAGTGATGGG - Intronic
1179370784 21:40804487-40804509 GCTAGCAGGCAGAGGGTGGTAGG - Intronic
1179722747 21:43324744-43324766 CCTGGCAGGGAGGAGCTGAAGGG + Intergenic
1182289692 22:29267963-29267985 CCCTGCAGGGAGACGGAGATCGG - Exonic
1182577737 22:31284584-31284606 CCAAGCAGTGAGAAGGGGCTAGG - Intronic
1183108805 22:35633147-35633169 CCTGCCAGGAAGAAGGGGATGGG - Intronic
1184635084 22:45821458-45821480 CCTAGCAGGGAGAGGAGGTTGGG - Intronic
1184734657 22:46391033-46391055 CCTGGTAGGGAAAAGGCGATCGG + Intronic
1184780963 22:46649225-46649247 CTCAGCAGGGAGCAGGTGCTTGG + Intronic
1185190502 22:49433253-49433275 CCCAGCAGGGAGAGGGTGGATGG - Intronic
1185190518 22:49433334-49433356 CCCAGCAGGGAGAGGGTGGATGG - Intronic
1185190549 22:49433456-49433478 CCCAGCAGGGAGAGGGTGGATGG - Intronic
949318653 3:2785213-2785235 CCTTGCAGGCAGAAGGTCATGGG - Intronic
950240485 3:11365683-11365705 CCTAGCTGGCAGAAGGTGGGTGG - Intronic
953913660 3:46905118-46905140 CCTCGCAGGGAGATGGTGACAGG + Intergenic
960959286 3:123057849-123057871 CTTAGTGGGGAGAAGGTGTTGGG + Intergenic
961288173 3:125823676-125823698 CCAAGCAGGGAGTATGTGACTGG - Intergenic
961633682 3:128319590-128319612 CCTAGGAGGCAGAAGGCGATGGG - Intronic
961898882 3:130192357-130192379 CCAAGCAGGGAGTACGTGACTGG + Intergenic
962893261 3:139691768-139691790 CCTGTCAGGGACAAGGGGATGGG + Intergenic
966067028 3:175831191-175831213 CCTAGGATGTAGAAGGTGTTGGG - Intergenic
966427293 3:179792936-179792958 TTGAGCAGGGAAAAGGTGATGGG + Intergenic
968259208 3:197305920-197305942 GCTAGCAGGAAGAAGGAGGTGGG - Intergenic
968808827 4:2791138-2791160 CCTAGCAGGGAGGAAGAGATAGG - Intergenic
969121350 4:4913717-4913739 CCTAGCATGGGGAAGCTGCTGGG + Intergenic
969447108 4:7251688-7251710 CCAGGCAGGAAGAAGGGGATGGG + Intronic
970982258 4:22113538-22113560 TCTAGCAAGGAGAATATGATAGG - Intergenic
972803528 4:42503925-42503947 CCAGGAAGGGAGATGGTGATGGG - Intronic
972922379 4:43959896-43959918 CCTTGGAAGGAGAAGGTGTTAGG + Intergenic
973818983 4:54645948-54645970 CCCAGCAGGGAGAAGGGGACAGG - Intergenic
977681713 4:99805084-99805106 CCTAGGATGGACAAGCTGATGGG - Intergenic
978561606 4:110039645-110039667 CGGACCAGGTAGAAGGTGATTGG - Intergenic
979848928 4:125552433-125552455 CATAGCAGGGAGATTATGATAGG + Intergenic
981838158 4:149079664-149079686 TCAAGCAGGGAGAAGGAGACAGG - Intergenic
982414002 4:155110677-155110699 CCTAGGATGTAGAAGGTGTTGGG + Intergenic
985241940 4:187939625-187939647 CATAACAGGGAGAGGGAGATTGG + Intergenic
989721379 5:44532628-44532650 CCAAGCAGGGAGAAGAAGAAAGG + Intergenic
993472231 5:88319860-88319882 CTAATCAGGGAAAAGGTGATTGG + Intergenic
994682459 5:102906279-102906301 GCTAGCTGGGAGGAGGTGGTAGG - Intronic
996958838 5:129219037-129219059 CATAGCATGGAGAAGGTGTATGG + Intergenic
999372336 5:151063643-151063665 CCAAGGAGGGAGAAGGTGGTGGG + Exonic
1000049053 5:157546426-157546448 CCTCTCAGGGATATGGTGATAGG - Intronic
1001029801 5:168253954-168253976 CCCAACAGGGAGAAAGGGATAGG - Intronic
1004183365 6:13399909-13399931 AGTAGCAGGGAGAAGGAGAAGGG + Intronic
1004252601 6:14034432-14034454 GCGAGGAGGGAGAAGGTGAGAGG + Intergenic
1005110919 6:22280589-22280611 CACAGCAGGCAGAAGGGGATGGG + Intergenic
1005494714 6:26378181-26378203 CCTAGCAGGCAGCAGTTGAAAGG - Exonic
1005499207 6:26415076-26415098 CCTAGCAGGCAGCAGTTGAAAGG - Exonic
1005503899 6:26453284-26453306 CCTAGCAGGCAGCAGTTGAAAGG - Exonic
1007111999 6:39318178-39318200 CCCAGAAGGGAGAAGGAAATCGG - Intronic
1007278484 6:40692908-40692930 AATCACAGGGAGAAGGTGATGGG + Intergenic
1007770112 6:44185504-44185526 CAGAGCAGGTAGCAGGTGATTGG - Intergenic
1008667690 6:53732405-53732427 CCTAGCAGTGATAAGCTGGTGGG + Intergenic
1009675180 6:66810733-66810755 CCTATCAGGAAGAAGGAGAGTGG - Intergenic
1013953189 6:115809938-115809960 CCAAGCAGGAAGGAAGTGATGGG + Intergenic
1013967468 6:115972129-115972151 CCTATAAGGGAGAATGTGGTGGG - Intronic
1015165410 6:130195834-130195856 CCTAGGATGTAGAAGGTGTTGGG - Intronic
1016376969 6:143431022-143431044 CTTAGGAGGCAGCAGGTGATTGG - Intronic
1017889694 6:158628120-158628142 CCGAGTAGGGAGAGTGTGATGGG + Intronic
1019104561 6:169657508-169657530 GCTACCAGGCAGAAGGTGAAAGG + Intronic
1019520323 7:1457982-1458004 CCTTGCAGGCAGAAGATGCTGGG - Intronic
1022263609 7:28731776-28731798 CATAGAAGGGAAAAGCTGATTGG - Intronic
1024374189 7:48619028-48619050 CCAGGCAGGCAGAATGTGATTGG - Intronic
1026070992 7:67119476-67119498 CTCAGAAGGGAGAAGGTGGTGGG - Intronic
1026839721 7:73663351-73663373 CCTAGCAGTAAGAAGGTAATTGG + Intergenic
1027767582 7:82364646-82364668 TCTAGCAGGAAGAATCTGATTGG - Intronic
1029654230 7:101913709-101913731 CCTAGCAGGGTGGGGGTGCTGGG - Intronic
1030769650 7:113457957-113457979 ACATACAGGGAGAAGGTGATTGG + Intergenic
1032638180 7:133734321-133734343 TTAAGCAGGGAGATGGTGATGGG + Intronic
1034895780 7:154875579-154875601 CCCCGCAGGGAGAAGGTGGGAGG + Intronic
1036251141 8:7163546-7163568 CCAAGCAGGGAGTACGTGACTGG + Intergenic
1036366347 8:8123914-8123936 CCAAGCAGGGAGTACGTGACTGG - Intergenic
1036577815 8:10044943-10044965 CTTAGCAGGGAAAAGGAGAATGG + Intergenic
1037753834 8:21699041-21699063 GCTATGAGGGAGAAGGTGATTGG - Intronic
1037950251 8:23014916-23014938 CCTGGCATGGAGGAGGAGATGGG - Intronic
1041280468 8:56205733-56205755 CCTAGCAATGTGAAGGTGTTAGG - Intronic
1043393334 8:79812290-79812312 CCTGGAAGGGAGAAGGGGAAGGG + Intergenic
1043938189 8:86167401-86167423 CCTAGCAGAGTAAAGGAGATTGG - Intergenic
1046019719 8:108650173-108650195 CCTGGCATGGGGAAGATGATGGG - Intronic
1046799546 8:118410517-118410539 ACTACCAGGAAGATGGTGATTGG - Intronic
1047031150 8:120882499-120882521 CCTCTCAGGAAGAAGGTGTTTGG - Intergenic
1047306279 8:123655348-123655370 ACAAGCAGGGAGCAGGTGAGAGG + Intergenic
1048954997 8:139528689-139528711 TCTATCAGGGAGAGGGTGAGTGG + Intergenic
1049372228 8:142273391-142273413 TCCAGGAGGCAGAAGGTGATGGG - Intronic
1051602507 9:18889475-18889497 CAGGGCAGGGAGAAGGTGACAGG - Intronic
1052720446 9:32166743-32166765 CCTAGGATGTAGAAGGTGTTGGG + Intergenic
1056502744 9:87225845-87225867 ACTGGCAGGCAGAAGGTGAGTGG - Intergenic
1057008078 9:91578274-91578296 CCTTTCAGGGAGAAAGGGATCGG + Intronic
1059353411 9:113682025-113682047 CCTAGCAGGCAGCAGGAGAAAGG - Intergenic
1060104675 9:120866192-120866214 CCTAGGAGTGAGAAGATTATGGG - Intronic
1060554478 9:124501212-124501234 CCTGGCAGGGAGATGGTGACCGG + Intronic
1061479986 9:130892925-130892947 CATGGCATGGAGAAGGGGATCGG + Intergenic
1062454619 9:136629683-136629705 CCAAGAAGGGAGAAGGGGCTGGG - Intergenic
1186258359 X:7747314-7747336 CCTACCTGGGACAAGGTGACAGG + Intergenic
1186276220 X:7940972-7940994 TCTGGCAGAGAGAATGTGATTGG + Intergenic
1186471908 X:9828250-9828272 CGGACCAGGTAGAAGGTGATTGG - Intronic
1187715388 X:22097455-22097477 CAGAGCAGGAAGAAGGTGAAAGG + Intronic
1188463183 X:30451314-30451336 CCTAGGATGTAGAAGGTGTTGGG + Intergenic
1189845100 X:45128668-45128690 CCTAGCAGGGAGAACTTGGGTGG + Intergenic
1189942985 X:46146056-46146078 GATTGCAGGGAGAAGGAGATAGG - Intergenic
1190025642 X:46920032-46920054 CCAAGCAGGTAGAGGGTGAGAGG + Intronic
1190026157 X:46925210-46925232 CCTGGGAAGGAGAATGTGATAGG - Intronic
1190211363 X:48451162-48451184 CCAAGCTGGGAGCAGGAGATGGG - Intergenic
1191041776 X:56089310-56089332 CCAAGCAGGGAAAAAGTGAGCGG + Intergenic
1192544267 X:72000215-72000237 CCTCGCACAGAGAAGGTGCTGGG - Intergenic
1194467252 X:94248216-94248238 CCAAAAAGGGAGAAGGTGACAGG + Intergenic
1194721626 X:97346981-97347003 CAGAGAAGGAAGAAGGTGATGGG - Intronic
1196638393 X:118031027-118031049 AGGAGCAGGGAGTAGGTGATAGG + Intronic
1196667216 X:118329437-118329459 ACAAGCAGGGAGGAGGAGATAGG - Intergenic
1199084575 X:143614007-143614029 CCTAGCAGGTGTGAGGTGATAGG - Intergenic
1199482087 X:148308937-148308959 CCGGGCAGGGAGAAGGTTGTGGG + Intergenic
1202593275 Y:26510038-26510060 GCTTGCAGTGAGAAGGAGATAGG + Intergenic