ID: 1144814654

View in Genome Browser
Species Human (GRCh38)
Location 17:18025531-18025553
Sequence CACCCTAGTAGGGCACAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 121}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144814644_1144814654 0 Left 1144814644 17:18025508-18025530 CCTTTCCTCCCTCACCTTCCTCT 0: 1
1: 3
2: 37
3: 412
4: 3022
Right 1144814654 17:18025531-18025553 CACCCTAGTAGGGCACAGGGAGG 0: 1
1: 0
2: 0
3: 10
4: 121
1144814646_1144814654 -8 Left 1144814646 17:18025516-18025538 CCCTCACCTTCCTCTCACCCTAG 0: 1
1: 0
2: 3
3: 78
4: 748
Right 1144814654 17:18025531-18025553 CACCCTAGTAGGGCACAGGGAGG 0: 1
1: 0
2: 0
3: 10
4: 121
1144814645_1144814654 -5 Left 1144814645 17:18025513-18025535 CCTCCCTCACCTTCCTCTCACCC 0: 1
1: 1
2: 19
3: 232
4: 1949
Right 1144814654 17:18025531-18025553 CACCCTAGTAGGGCACAGGGAGG 0: 1
1: 0
2: 0
3: 10
4: 121
1144814643_1144814654 4 Left 1144814643 17:18025504-18025526 CCAGCCTTTCCTCCCTCACCTTC 0: 1
1: 2
2: 32
3: 307
4: 2223
Right 1144814654 17:18025531-18025553 CACCCTAGTAGGGCACAGGGAGG 0: 1
1: 0
2: 0
3: 10
4: 121
1144814647_1144814654 -9 Left 1144814647 17:18025517-18025539 CCTCACCTTCCTCTCACCCTAGT 0: 1
1: 0
2: 3
3: 56
4: 521
Right 1144814654 17:18025531-18025553 CACCCTAGTAGGGCACAGGGAGG 0: 1
1: 0
2: 0
3: 10
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144814654 Original CRISPR CACCCTAGTAGGGCACAGGG AGG Intronic
903008588 1:20314654-20314676 GACATTAGTAGGGGACAGGGTGG + Intronic
903602598 1:24553663-24553685 CACTCTAGAAGGGAGCAGGGTGG - Intergenic
906665911 1:47621853-47621875 CAGGCTAGTGGGGCACAGGGTGG + Intergenic
907970667 1:59377773-59377795 GATCCTGGGAGGGCACAGGGTGG + Intronic
909990993 1:82222391-82222413 CATCCTAGCAGGGGGCAGGGTGG + Intergenic
911072248 1:93841506-93841528 AAGCCTAGTAGGGCTCAGGAAGG - Intronic
914759107 1:150584349-150584371 CACAGTAGTAGGGCATAGGCTGG - Intergenic
922252694 1:223864351-223864373 CCCCGTAGAAGGGCACAGTGTGG + Intergenic
1063609874 10:7553289-7553311 CAAACGAGTAGGGCACAGGGTGG + Intergenic
1066043706 10:31578574-31578596 TACCCTAAGAGGGCACAGGATGG - Intergenic
1069527743 10:69188363-69188385 CACCCCAGCAAGGCATAGGGAGG - Intronic
1069714148 10:70509772-70509794 CTCTCTAGGAGGGCACAGGTTGG + Intronic
1076814824 10:132909563-132909585 GGCCCTAGTGGGGCCCAGGGAGG - Intronic
1077110617 11:860535-860557 CACCCTGGCAGGGCCCACGGAGG - Intronic
1080646757 11:34193317-34193339 CACCCTGGAAGGGTGCAGGGAGG + Intronic
1083544359 11:63537891-63537913 CAGCCCAGAGGGGCACAGGGAGG + Intronic
1088164380 11:106915324-106915346 CAACCTTATAGGGGACAGGGAGG + Intronic
1088452390 11:109996100-109996122 GTCCCTGGTAGGGCACAAGGAGG + Intergenic
1093363287 12:18259100-18259122 CACTCTATTAGGCAACAGGGTGG + Intronic
1099419743 12:82442080-82442102 CACCCTAGTAGGGGAAACGAGGG - Intronic
1100998695 12:100332018-100332040 CACCATAGTAGAGCACAGCCTGG - Intronic
1102415664 12:112760321-112760343 CAACCTTGTAGGGCATAGGGAGG + Intronic
1104992769 12:132635386-132635408 CACCATTGGAGGGCACAGGCAGG - Intronic
1105307582 13:19180049-19180071 CAGCCTCGGAGAGCACAGGGCGG - Intronic
1106081458 13:26503915-26503937 TAGCCTAGTGGGGCAGAGGGAGG - Intergenic
1108222684 13:48252941-48252963 CAGGTTAGAAGGGCACAGGGAGG + Intronic
1108337818 13:49464081-49464103 CACCCTAATAGGTGAAAGGGAGG + Intronic
1108997593 13:56753816-56753838 CACCCTTGTAGAGAACAGGAAGG - Intergenic
1114769127 14:25408664-25408686 CAAACCATTAGGGCACAGGGTGG + Intergenic
1119474683 14:74920253-74920275 CACCCTGGGAAGGGACAGGGTGG + Intronic
1121121124 14:91376535-91376557 AGCCCTGGTGGGGCACAGGGAGG + Intronic
1122228946 14:100295526-100295548 CTCCGTAGCAGGGGACAGGGAGG - Intronic
1124139415 15:27064172-27064194 CTCCCCAGGAGGGCGCAGGGTGG + Intronic
1124271110 15:28281601-28281623 CTCCCTGGAAAGGCACAGGGTGG + Intronic
1124909889 15:33909263-33909285 CACCCAAGTGTGGCACAGGCTGG + Intronic
1127621226 15:60736672-60736694 TACTCTAGTAGGGGACAGCGAGG - Intronic
1131341754 15:91608882-91608904 CACCTGAGCAGGGCACAGGCAGG + Intergenic
1131402185 15:92134058-92134080 CACCCCAGTAGGGCAGTGGTTGG + Intronic
1133502330 16:6378085-6378107 CATCTTAGGCGGGCACAGGGTGG - Intronic
1137435779 16:48453391-48453413 CAACCTTGTAGGGCACAGGCAGG + Intergenic
1142884385 17:2903737-2903759 CTCCCTAGTTGGCCACAGGGAGG + Intronic
1143278612 17:5733068-5733090 TAACCTAGTAGGGGAAAGGGAGG - Intergenic
1143346438 17:6252848-6252870 CACCAAAGTTGGGCACAGGCAGG - Intergenic
1144128331 17:12222664-12222686 CAGCATGGTAGAGCACAGGGAGG - Intergenic
1144504125 17:15815733-15815755 CACCCAAGCAAGGCACAGAGGGG - Intergenic
1144633869 17:16891362-16891384 CACCCAAGGAAGGCACAGAGGGG - Intergenic
1144814654 17:18025531-18025553 CACCCTAGTAGGGCACAGGGAGG + Intronic
1145167985 17:20631240-20631262 CACCCAAGCAAGGCACAGAGGGG - Intergenic
1148199349 17:45739788-45739810 AACCTTAGGAGGGCAGAGGGAGG - Intergenic
1151856347 17:76724986-76725008 CTCCCCAGTAGGGCCCAGGCAGG + Intronic
1152539858 17:80969450-80969472 AACCCTTGAAGGACACAGGGCGG + Intergenic
1152750991 17:82062319-82062341 CAGGCTAGTGGGGCACTGGGGGG + Intronic
1157717252 18:49896468-49896490 CAGAGGAGTAGGGCACAGGGAGG + Intronic
1160843652 19:1157268-1157290 AACCCTAGTGGGACACTGGGTGG + Intronic
1161255765 19:3308383-3308405 CAGCCTTATAGGTCACAGGGAGG - Intergenic
1164788581 19:30957293-30957315 CACCCTTGGAGGGCAAAGAGTGG + Intergenic
1166978637 19:46620020-46620042 CACCCCGGCAGGGCCCAGGGTGG + Intergenic
1167524102 19:49972957-49972979 CCCCTTAGCAGGGCACAGGGAGG + Intergenic
927097403 2:19757937-19757959 AACCCTATTAGGCCACAGAGAGG - Intergenic
927393661 2:22624782-22624804 AACCCAAGTAGGGCACATGATGG + Intergenic
928442114 2:31301122-31301144 AACCCTAGTAGGGTCCAGAGTGG + Intergenic
933219383 2:79670293-79670315 CTCCCTACAAGAGCACAGGGAGG + Intronic
935601516 2:104927120-104927142 CACCATGTTAGGGCACAGTGAGG - Intergenic
937262635 2:120596238-120596260 CATCCTGGAAGGGCAGAGGGTGG - Intergenic
938132830 2:128732130-128732152 TCCCCTAGAAGGGCACAGAGGGG + Intergenic
943526198 2:189020571-189020593 CCCCCTCGAAGAGCACAGGGAGG - Intergenic
945809678 2:214533521-214533543 CTCCCTTGTAGGGCATAGAGGGG + Intronic
1170449458 20:16467168-16467190 CACCCTAGTGTGGGACAGGATGG - Intronic
1171387578 20:24780627-24780649 CACCCGATTAGGGCAAAGGCTGG - Intergenic
1171879222 20:30604249-30604271 CACTCTTGCAGGGCACTGGGAGG - Intergenic
1172763424 20:37337558-37337580 CAGCTCAGTGGGGCACAGGGAGG + Intergenic
1173809207 20:45946142-45946164 CTCCCCAGGAGGGAACAGGGAGG + Intronic
1175385498 20:58592423-58592445 CACTCTGGAAGTGCACAGGGTGG - Intergenic
1175726385 20:61321294-61321316 CACCTTAGGAGGGCAGAGGGAGG + Intronic
1175928805 20:62484008-62484030 CACCCTCGTCAGGCTCAGGGTGG + Intergenic
1175935550 20:62512247-62512269 CACTCTGCTCGGGCACAGGGAGG - Intergenic
1178531992 21:33383412-33383434 CCCCCTAGCAGGACACAGTGAGG - Intergenic
1180902862 22:19387117-19387139 CACCCCAGCAGAGCACAGAGGGG + Intronic
1181427920 22:22856118-22856140 CACCCTAGAAGGGCTGAAGGGGG + Intronic
1183048973 22:35245694-35245716 CACTCTAGCAGGGCAAAGAGGGG + Intergenic
1184368934 22:44070308-44070330 TCCCCTAGCAGGGCCCAGGGAGG - Intronic
1184690353 22:46114600-46114622 CAGGCCAGGAGGGCACAGGGGGG - Intergenic
950693808 3:14682519-14682541 CCCCATAGTAGGGCAAGGGGAGG - Intronic
952289661 3:32003098-32003120 CACCAGAGTGGGGCAGAGGGTGG + Intronic
952342168 3:32455784-32455806 CCCCCTAGGAGGGCAAAGGTGGG + Intronic
956933653 3:74074837-74074859 CCTCCTAATAGGGCACAGGAAGG - Intergenic
961325647 3:126107722-126107744 GACCCTGGGAGGGCAGAGGGAGG - Intronic
964637224 3:158871023-158871045 CACCTTAGTAGAGCTGAGGGTGG - Intergenic
968131334 3:196194482-196194504 CACACTAGTTGGGCACAGAGAGG + Intergenic
972710167 4:41587619-41587641 TAACCCAGCAGGGCACAGGGTGG - Intronic
974750299 4:66131399-66131421 CACCATAGTTTGGCACAGGCAGG - Intergenic
990486240 5:56261622-56261644 CACCCTGGAATGGCACAGGCAGG - Intergenic
990604897 5:57399030-57399052 CACCTGATTAGGGCTCAGGGTGG - Intergenic
997828765 5:137131072-137131094 CACCATAGTAGGGCCCATCGGGG - Intronic
1000325349 5:160167959-160167981 TTCCCTATTAGGGAACAGGGTGG + Intergenic
1001632222 5:173183830-173183852 GACCCAAGCAAGGCACAGGGAGG - Intergenic
1003184736 6:3820983-3821005 CAGCAAAGCAGGGCACAGGGAGG + Intergenic
1005166593 6:22929072-22929094 CAGCCTAGTAGAGCACAGAGTGG + Intergenic
1006392488 6:33766651-33766673 CACCATGGTGGGGCACAGGCGGG - Intergenic
1006422163 6:33941793-33941815 CATCCCTGTAGGGCACAGGTAGG + Intergenic
1006929821 6:37680958-37680980 GGCCCCAGTAGGGGACAGGGAGG - Intronic
1007350675 6:41271456-41271478 CACTCTAGCAGGGCACAGAAGGG - Intronic
1007394642 6:41570531-41570553 TCCCCTAGGAGGGCAGAGGGCGG + Intronic
1012382710 6:98639471-98639493 CATTTTAGTAGGGCACATGGTGG - Intergenic
1013625904 6:111936740-111936762 CACCCTAGTGGGTAACAGGCTGG + Intergenic
1014432864 6:121390226-121390248 CCCCTTAGCAGGGCACAGGGAGG + Intergenic
1017600583 6:156076488-156076510 CACTCTATTATGGCACAGGTAGG - Intergenic
1022045270 7:26617735-26617757 CACCCTAGCAGGGGACAGTAGGG - Intergenic
1023989185 7:45117959-45117981 TACCCAAGTAGGGTACAGGCTGG + Intergenic
1032984738 7:137325443-137325465 CATCCCAGCAGGGCACATGGAGG + Intronic
1033575692 7:142682092-142682114 CTCACTAGTAGAGCACAAGGAGG - Intergenic
1034275099 7:149820579-149820601 GTCCCCAGTAGGGCAGAGGGAGG + Intergenic
1035264777 7:157684840-157684862 CGGCCCAGGAGGGCACAGGGCGG - Intronic
1035394584 7:158526747-158526769 CAACCCTGTGGGGCACAGGGAGG + Intronic
1037865884 8:22441556-22441578 CACCCTAGGAGGGCTCGGAGGGG + Intronic
1041100571 8:54392676-54392698 CACCAGAGGTGGGCACAGGGAGG - Intergenic
1041318620 8:56590798-56590820 CACCCTAGAAGGGAAGAGGCTGG - Intergenic
1048314307 8:133350813-133350835 CACAGTGGTAGGGGACAGGGAGG - Intergenic
1048384285 8:133897305-133897327 CACTCTAGTAGGGCAGACGTAGG + Intergenic
1049216110 8:141409170-141409192 TCCCCTAGCAGGGCCCAGGGAGG - Intronic
1049715325 8:144087119-144087141 CTACAGAGTAGGGCACAGGGAGG - Intergenic
1053552356 9:39097390-39097412 CTTACAAGTAGGGCACAGGGTGG + Intronic
1053816478 9:41917553-41917575 CTTACAAGTAGGGCACAGGGTGG + Intronic
1054106738 9:61061235-61061257 CTTACAAGTAGGGCACAGGGTGG + Intergenic
1054614119 9:67269890-67269912 CTTACAAGTAGGGCACAGGGTGG - Intergenic
1058299838 9:103358411-103358433 GACCCTAGTTGGCCACAGTGGGG - Intergenic
1060831952 9:126722712-126722734 AACCAGAGTAGGGCACAGGCCGG + Intergenic
1061793759 9:133071668-133071690 CACCCGTGGGGGGCACAGGGGGG - Exonic
1186473894 X:9842485-9842507 CACCGTGGTAGGGCACACAGCGG + Intronic
1190572681 X:51800278-51800300 CACCCTGGCACTGCACAGGGTGG + Intergenic
1193681521 X:84525298-84525320 CACACGTGTAGGGCACAGGACGG + Intergenic
1196883805 X:120224015-120224037 CTCCCTCGAAGAGCACAGGGAGG + Intergenic