ID: 1144818780

View in Genome Browser
Species Human (GRCh38)
Location 17:18056344-18056366
Sequence CTGAGTATCCAGAAGGTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 141}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144818780 Original CRISPR CTGAGTATCCAGAAGGTTGG GGG Intronic
901453542 1:9350742-9350764 GTGAGTTTCCAGGAGGTGGGAGG - Intronic
904325782 1:29726996-29727018 CTGAGGCTCCTGTAGGTTGGGGG + Intergenic
904406995 1:30297921-30297943 TGGAGAATTCAGAAGGTTGGAGG - Intergenic
905273912 1:36805084-36805106 CTGGGGATCCAGAAGATCGGGGG - Exonic
907684224 1:56594303-56594325 CTGAATAACTAGAAGGATGGAGG + Intronic
911076000 1:93875727-93875749 CTGAGTATCAAGCAGTTGGGTGG - Exonic
912463016 1:109849575-109849597 CTGAGTAACAAGAAGCTAGGTGG - Intergenic
912744865 1:112237747-112237769 CTGAGTAATCAGAGGGTAGGAGG - Intergenic
916663907 1:166948180-166948202 CAGAAGATCCAGAGGGTTGGGGG - Intronic
919706682 1:200682963-200682985 TTGAGAATCCAGAAGGATGGGGG + Intergenic
922889799 1:229052943-229052965 CTGAGTTTTCAGAAGGTTCAAGG - Intergenic
1063131001 10:3176592-3176614 CTGGGTTTCCAGAAAGTAGGAGG - Intergenic
1064980740 10:21164139-21164161 CTGAGTACCCAGAATGTTTTAGG - Intronic
1066449175 10:35512455-35512477 CTGAGTAGCCAGAAAGATGGGGG + Intronic
1067696072 10:48536488-48536510 CTGAGTAACTAGCAGGTGGGGGG - Intronic
1069904987 10:71726907-71726929 TTGTGTATACAGAAGGTTTGTGG - Intronic
1070567590 10:77615424-77615446 CTGAGGCTGCAGAAGGTGGGTGG + Intronic
1072895199 10:99360360-99360382 CTTAGTATCAAGAGGGTTGCAGG - Intronic
1074168505 10:110908543-110908565 TTGAGGATCCTGAAGGATGGGGG + Intronic
1077465782 11:2733058-2733080 CTGAGGCTCCAGAAGGTAAGGGG - Intronic
1078531618 11:12140877-12140899 CTCAGTCTAGAGAAGGTTGGTGG - Intronic
1081031802 11:38093850-38093872 ATGAGAATCCAGAATTTTGGAGG + Intergenic
1082100852 11:48171831-48171853 GTGTGTTCCCAGAAGGTTGGAGG + Intergenic
1084482939 11:69432536-69432558 CTGAGAAGCCAGAATGTGGGTGG + Intergenic
1085297751 11:75440441-75440463 CTGAGCATGCAGAAGGCAGGTGG - Intronic
1085567781 11:77530460-77530482 GGGAGACTCCAGAAGGTTGGAGG - Intronic
1086815305 11:91363014-91363036 TTGAGTATCTACAAGGATGGAGG - Intergenic
1087630851 11:100648420-100648442 CTGATTATCCAGAATGTTGCAGG - Intergenic
1088716812 11:112555865-112555887 CTGAGCAGCCAGAAGGGTGAGGG - Intergenic
1092367912 12:7892291-7892313 CTGAGAATTCACAAGGGTGGGGG + Intergenic
1093546059 12:20349705-20349727 CTGAGAATCCAGAAAGGTAGAGG + Intergenic
1094500689 12:31018356-31018378 CTGGGAATCAAGGAGGTTGGAGG - Intergenic
1096510044 12:52122641-52122663 CTGAGTAGCCAGGAGGTTTATGG + Intergenic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1097041481 12:56158505-56158527 CTGAGGACCCGAAAGGTTGGAGG + Intronic
1099357488 12:81657205-81657227 CTGGGTCTCCAGAAGATTGGCGG - Intronic
1103980338 12:124732963-124732985 CTGAGTTCCCAGAAGGTGGTCGG + Intergenic
1104171459 12:126285637-126285659 CTGAGTCACCAGGAAGTTGGTGG + Intergenic
1107188090 13:37547379-37547401 CTTAGAGTCCAGAGGGTTGGTGG + Intergenic
1107693530 13:42977382-42977404 CTAACTATACAGAAGGTTGGTGG - Intronic
1110303307 13:73954655-73954677 GTGAGCATCCAGAGTGTTGGTGG - Intronic
1113429730 13:110239698-110239720 CTGAATATGCAGAAGGTGGCAGG + Intronic
1113611950 13:111652985-111653007 CTGTGTATCCAGGAAGATGGAGG + Intronic
1114482961 14:23046837-23046859 CAGAGGACCCAGAAAGTTGGTGG + Intergenic
1118722608 14:68604986-68605008 CTGAGGAGCCACAAGGTTGCTGG - Intronic
1120581077 14:86249901-86249923 ATGAATATCCAGATGTTTGGAGG - Intergenic
1122079086 14:99254477-99254499 CTGGGTATCAGGAAGGTTGCTGG + Intronic
1122141611 14:99666387-99666409 CTGTGTGTGCAGAGGGTTGGGGG + Intronic
1123022636 14:105408811-105408833 CTGAGTAGACAGAATGCTGGTGG - Intronic
1124700750 15:31909886-31909908 CTGGGTACCCAGAAGGCAGGGGG + Intergenic
1124889305 15:33717388-33717410 CTGAGTATCTGAAAAGTTGGTGG - Intronic
1125457982 15:39880063-39880085 CTGAGTCTTGAGAAGGTTGAAGG - Intronic
1127035921 15:54917647-54917669 CTGAAGATCCAGAAGGTTCCTGG - Intergenic
1127922136 15:63502706-63502728 CGGAGGAAACAGAAGGTTGGTGG + Intergenic
1129011863 15:72426843-72426865 TAGAGTATCCAGAAAGTTAGGGG - Intergenic
1132506474 16:312078-312100 CTAAGAAACCAGTAGGTTGGTGG - Intronic
1133873242 16:9709265-9709287 CTGAGAACCCAGAAGGCAGGAGG - Intergenic
1136183374 16:28570253-28570275 CAGTGTGTCCAGAAGGTAGGAGG + Intronic
1139206494 16:65034206-65034228 CTGAGTTACCAGAAGCTAGGAGG + Intronic
1139698993 16:68695677-68695699 CAGAGTATCCAAAGGGTAGGGGG + Intronic
1140564959 16:76031215-76031237 CTGAGTATGATGAAAGTTGGAGG - Intergenic
1141711109 16:85699396-85699418 CTGAGAAGCCAGAAGGAAGGGGG + Intronic
1143884217 17:10053940-10053962 CTACGGATCCAGAAGCTTGGAGG - Intronic
1144818780 17:18056344-18056366 CTGAGTATCCAGAAGGTTGGGGG + Intronic
1145288506 17:21523832-21523854 CTAAGCATCCAGAATGCTGGAGG - Intergenic
1146624532 17:34425245-34425267 CTGCATCTCCAGAGGGTTGGGGG + Intergenic
1146635981 17:34505055-34505077 CCAAGTATTGAGAAGGTTGGTGG - Intergenic
1147542810 17:41375085-41375107 CTGAGAATCAGGAAGGCTGGTGG - Intronic
1148151879 17:45401969-45401991 CTCAGTACCTAGAAGGTTTGAGG - Intronic
1151447003 17:74173380-74173402 CTGAGTAGCCAAAGGGGTGGAGG + Intergenic
1152089566 17:78239248-78239270 CTGAGTCCCCAGCAGGTGGGAGG + Exonic
1154469043 18:14680503-14680525 CTGAGTATGCAGAACCTTGTGGG - Intergenic
1158582223 18:58693686-58693708 CTGAGTAACCAGATGGATGGTGG + Intronic
1161612096 19:5248806-5248828 CTGAGGCTCCAGGAGGATGGGGG - Intronic
1162522841 19:11192253-11192275 GTCAGTATCCAGAAAGTGGGAGG - Intronic
1163628072 19:18402241-18402263 CTGAGGATCCGGAGGTTTGGGGG + Intergenic
1163628347 19:18403671-18403693 CTGGGGATCCAGAAGTCTGGGGG + Intergenic
1165397465 19:35573467-35573489 CTGAACATCCAGAATGGTGGAGG - Intergenic
1166272719 19:41726692-41726714 CAGAGTTTCCACAAGGCTGGTGG + Intronic
1168721746 19:58558266-58558288 CTGCGGATCCAGAAGGGTAGGGG - Exonic
925429324 2:3777685-3777707 CTGAGTTTTCAGAAGGTCTGAGG + Intronic
925714879 2:6774771-6774793 CTGATAATCCAGGAGGCTGGGGG - Intergenic
926559889 2:14405166-14405188 CTGATTTTGCAAAAGGTTGGTGG - Intergenic
926998608 2:18768419-18768441 CAAAGTAGCCAGAAGGTAGGGGG - Intergenic
927870587 2:26620376-26620398 CTGAGCAGCCTGTAGGTTGGCGG - Intronic
930548294 2:52798368-52798390 CTGAAAATCCAGATGGTTGTAGG - Intergenic
932417867 2:71584513-71584535 CTGAGCTTCCTGAAGGTAGGAGG + Intronic
937105526 2:119308763-119308785 CTAAGTCTTCAGAAGGGTGGTGG - Intronic
937387017 2:121444007-121444029 GTAAATATCCTGAAGGTTGGTGG + Intronic
938247998 2:129793843-129793865 CTGAGTGTAAAGAAGGCTGGGGG - Intergenic
947105424 2:226663430-226663452 CAGAGTTTCCAGGAAGTTGGGGG - Intergenic
947454056 2:230237027-230237049 CTGAGTTTCCAAGAGGTTTGTGG - Intronic
948471307 2:238182074-238182096 ATGAGGATACAGAAGGCTGGAGG - Exonic
1169383584 20:5128751-5128773 GTGAGTATGCAGATGTTTGGAGG + Intronic
1170511274 20:17079554-17079576 CTGTGTATCAGGAAAGTTGGTGG + Intergenic
1174613114 20:51815272-51815294 CTGAGCATCCAAAAGGTTGCAGG + Intergenic
1176805476 21:13477157-13477179 CTGAGTATGCAGAACCTTGTGGG + Intergenic
1177107202 21:16974611-16974633 ATAAGGATCCAGCAGGTTGGTGG + Intergenic
1184489276 22:44799806-44799828 CTGAGAATCCAGGGGGTGGGGGG + Intronic
1184977633 22:48074163-48074185 CTGAGGATCAAGAAGGAAGGTGG - Intergenic
954464466 3:50646403-50646425 CTGAGGCTCAAGAAGGTTAGGGG - Intronic
955369179 3:58336283-58336305 CTGAGTCACCAGAAGGATGAAGG + Intronic
956145073 3:66183929-66183951 CTGAGTGTCTAGTAGGTTAGGGG - Intronic
957125087 3:76148577-76148599 GGGAGGCTCCAGAAGGTTGGTGG - Intronic
957480376 3:80784901-80784923 CTCAGTATTCAGGAGGTTTGAGG + Intergenic
966068732 3:175848452-175848474 GTGATTATCCAGCAGATTGGGGG - Intergenic
966943374 3:184760619-184760641 CTGCTTAGCCAGAAGGTTTGGGG - Intergenic
967221926 3:187254717-187254739 ATGAGTTTGCAGGAGGTTGGGGG + Intronic
972292409 4:37701913-37701935 ATGGGTAACCAAAAGGTTGGTGG - Intergenic
977872250 4:102105952-102105974 CTGACTATCCAGAATGGGGGAGG - Intergenic
979707816 4:123741866-123741888 CTGAGCATCCAGAGGGTATGAGG - Intergenic
980916161 4:139035091-139035113 CTGAGCGACCAGAAGGATGGAGG - Intronic
982053272 4:151524795-151524817 CTGAGTATCAGTATGGTTGGGGG + Intronic
984361849 4:178744020-178744042 CTGATGATGCAGAATGTTGGTGG + Intergenic
985648802 5:1098088-1098110 CTGGGTGTGCAGAGGGTTGGAGG - Intronic
989053133 5:37341144-37341166 CTGAGAATCCAGGAGGTAAGCGG + Exonic
989424079 5:41275521-41275543 CTGGGTATGCAGAAGTTTGCTGG + Intergenic
991995376 5:72381267-72381289 CTAAGTATAAAGAATGTTGGGGG + Intergenic
993745837 5:91595990-91596012 CTGGGCCTGCAGAAGGTTGGGGG - Intergenic
994607356 5:101985747-101985769 CTGAATATCTAGAAAATTGGTGG - Intergenic
996382898 5:122880075-122880097 CAAAGTAAACAGAAGGTTGGAGG - Intronic
999247007 5:150160421-150160443 CTGAGTGTCCAGGAGGTAGGGGG - Intergenic
1000915085 5:167071896-167071918 CTGATTTTCCAGACGGTTGGGGG - Intergenic
1007229239 6:40336868-40336890 CAGAGCAACCAGAAGGATGGGGG + Intergenic
1011133501 6:84075286-84075308 CTGTGTATCCAGAAGGAAAGAGG + Intronic
1011449077 6:87473422-87473444 CTGAGCATCCACAGGGTAGGAGG - Intronic
1013660520 6:112291688-112291710 CTGAGAAGCCAAAGGGTTGGAGG - Intergenic
1014612782 6:123565224-123565246 CTGAGTCTGCAGAAGCTTGAAGG + Intronic
1025249706 7:57343663-57343685 CTGAGCATCTGGAAGGATGGGGG + Intergenic
1027475585 7:78627305-78627327 CTGAATATTCAGAAGTATGGTGG - Intronic
1028839504 7:95412704-95412726 GAGAGTAATCAGAAGGTTGGTGG + Intronic
1029795481 7:102889984-102890006 ATTAGTATCCAGAAAGTGGGGGG + Intronic
1030120476 7:106105756-106105778 CTGGGTATCCTGAAGGTAAGGGG + Intronic
1030957150 7:115868391-115868413 GTGAGTAACCAGAAGTCTGGGGG + Intergenic
1031723640 7:125208815-125208837 CCGTATATTCAGAAGGTTGGGGG + Intergenic
1034914228 7:155023590-155023612 CTGAGGATACAGGCGGTTGGGGG - Intergenic
1037916038 8:22774003-22774025 CTGAGTATCTCGGAGGTTGGAGG - Intronic
1039288523 8:36068806-36068828 CTCAGTGTCCAGAAGGCTGGTGG - Intergenic
1040994734 8:53390168-53390190 TTGAATATCTAGAAGCTTGGGGG + Intergenic
1043063675 8:75538874-75538896 CAGAGTATTCATAAGGTTTGTGG + Intronic
1045330582 8:101152681-101152703 CAGAATATCCAGAAGGCTAGTGG - Intergenic
1047773957 8:128053811-128053833 CTGAGCAACCAGAAGGGTTGGGG + Intergenic
1048491265 8:134895978-134896000 CTGAACAACCAGAAGGATGGTGG - Intergenic
1049966765 9:787083-787105 TTTAGGCTCCAGAAGGTTGGGGG - Intergenic
1062378740 9:136276654-136276676 CAGAGAATCCAGAAAGCTGGAGG + Intergenic
1187648723 X:21375917-21375939 CTGAGGATCCAAGGGGTTGGTGG - Intronic
1191669427 X:63735340-63735362 CTTTGTTTCCAGAAGGTAGGAGG + Intronic
1192964801 X:76165928-76165950 CTAAGTATGCACAAGGTTGAAGG + Intergenic
1195373772 X:104205509-104205531 CTGAGTATGCAGAAAATTTGTGG - Intergenic
1197774901 X:130112186-130112208 CTGAGTATCCAGGAGGTCTCAGG - Intergenic
1198361570 X:135900734-135900756 CGGAATCTCCATAAGGTTGGAGG + Intronic