ID: 1144819484 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 17:18061709-18061731 |
| Sequence | ATAGTCTAACCTAGACTTGC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 70 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 3, 4: 66} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1144819484_1144819488 | 30 | Left | 1144819484 | 17:18061709-18061731 | CCAGCAAGTCTAGGTTAGACTAT | 0: 1 1: 0 2: 0 3: 3 4: 66 |
||
| Right | 1144819488 | 17:18061762-18061784 | AGAACCCCCTGATGCTTAACAGG | 0: 1 1: 0 2: 0 3: 1 4: 64 |
||||
| 1144819484_1144819485 | 2 | Left | 1144819484 | 17:18061709-18061731 | CCAGCAAGTCTAGGTTAGACTAT | 0: 1 1: 0 2: 0 3: 3 4: 66 |
||
| Right | 1144819485 | 17:18061734-18061756 | GATCCTATATTTTTCTCGAGTGG | 0: 1 1: 0 2: 0 3: 4 4: 75 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1144819484 | Original CRISPR | ATAGTCTAACCTAGACTTGC TGG (reversed) | Intronic | ||