ID: 1144819485

View in Genome Browser
Species Human (GRCh38)
Location 17:18061734-18061756
Sequence GATCCTATATTTTTCTCGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 75}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144819477_1144819485 21 Left 1144819477 17:18061690-18061712 CCCACGGGCCCGCCATCACCCAG 0: 1
1: 0
2: 0
3: 12
4: 82
Right 1144819485 17:18061734-18061756 GATCCTATATTTTTCTCGAGTGG 0: 1
1: 0
2: 0
3: 4
4: 75
1144819476_1144819485 22 Left 1144819476 17:18061689-18061711 CCCCACGGGCCCGCCATCACCCA 0: 1
1: 0
2: 0
3: 14
4: 181
Right 1144819485 17:18061734-18061756 GATCCTATATTTTTCTCGAGTGG 0: 1
1: 0
2: 0
3: 4
4: 75
1144819483_1144819485 3 Left 1144819483 17:18061708-18061730 CCCAGCAAGTCTAGGTTAGACTA 0: 1
1: 0
2: 0
3: 5
4: 83
Right 1144819485 17:18061734-18061756 GATCCTATATTTTTCTCGAGTGG 0: 1
1: 0
2: 0
3: 4
4: 75
1144819480_1144819485 12 Left 1144819480 17:18061699-18061721 CCGCCATCACCCAGCAAGTCTAG 0: 1
1: 0
2: 3
3: 9
4: 174
Right 1144819485 17:18061734-18061756 GATCCTATATTTTTCTCGAGTGG 0: 1
1: 0
2: 0
3: 4
4: 75
1144819482_1144819485 9 Left 1144819482 17:18061702-18061724 CCATCACCCAGCAAGTCTAGGTT 0: 1
1: 0
2: 0
3: 8
4: 152
Right 1144819485 17:18061734-18061756 GATCCTATATTTTTCTCGAGTGG 0: 1
1: 0
2: 0
3: 4
4: 75
1144819479_1144819485 13 Left 1144819479 17:18061698-18061720 CCCGCCATCACCCAGCAAGTCTA 0: 1
1: 0
2: 0
3: 12
4: 138
Right 1144819485 17:18061734-18061756 GATCCTATATTTTTCTCGAGTGG 0: 1
1: 0
2: 0
3: 4
4: 75
1144819484_1144819485 2 Left 1144819484 17:18061709-18061731 CCAGCAAGTCTAGGTTAGACTAT 0: 1
1: 0
2: 0
3: 3
4: 66
Right 1144819485 17:18061734-18061756 GATCCTATATTTTTCTCGAGTGG 0: 1
1: 0
2: 0
3: 4
4: 75
1144819478_1144819485 20 Left 1144819478 17:18061691-18061713 CCACGGGCCCGCCATCACCCAGC 0: 1
1: 1
2: 1
3: 11
4: 226
Right 1144819485 17:18061734-18061756 GATCCTATATTTTTCTCGAGTGG 0: 1
1: 0
2: 0
3: 4
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144819485 Original CRISPR GATCCTATATTTTTCTCGAG TGG Intronic