ID: 1144819488

View in Genome Browser
Species Human (GRCh38)
Location 17:18061762-18061784
Sequence AGAACCCCCTGATGCTTAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 64}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144819484_1144819488 30 Left 1144819484 17:18061709-18061731 CCAGCAAGTCTAGGTTAGACTAT 0: 1
1: 0
2: 0
3: 3
4: 66
Right 1144819488 17:18061762-18061784 AGAACCCCCTGATGCTTAACAGG 0: 1
1: 0
2: 0
3: 1
4: 64
1144819486_1144819488 2 Left 1144819486 17:18061737-18061759 CCTATATTTTTCTCGAGTGGTCC 0: 1
1: 0
2: 0
3: 4
4: 70
Right 1144819488 17:18061762-18061784 AGAACCCCCTGATGCTTAACAGG 0: 1
1: 0
2: 0
3: 1
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144819488 Original CRISPR AGAACCCCCTGATGCTTAAC AGG Intronic