ID: 1144823025

View in Genome Browser
Species Human (GRCh38)
Location 17:18088641-18088663
Sequence CTGTGTACTAAGATGGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 228}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144823025_1144823029 12 Left 1144823025 17:18088641-18088663 CCCTGCTCCATCTTAGTACACAG 0: 1
1: 0
2: 0
3: 14
4: 228
Right 1144823029 17:18088676-18088698 AGATGGCCTTTACAAAGCACTGG 0: 1
1: 0
2: 0
3: 11
4: 149
1144823025_1144823028 -5 Left 1144823025 17:18088641-18088663 CCCTGCTCCATCTTAGTACACAG 0: 1
1: 0
2: 0
3: 14
4: 228
Right 1144823028 17:18088659-18088681 CACAGCTGAGTTAAATTAGATGG 0: 1
1: 0
2: 1
3: 18
4: 197
1144823025_1144823030 13 Left 1144823025 17:18088641-18088663 CCCTGCTCCATCTTAGTACACAG 0: 1
1: 0
2: 0
3: 14
4: 228
Right 1144823030 17:18088677-18088699 GATGGCCTTTACAAAGCACTGGG 0: 1
1: 0
2: 3
3: 11
4: 134
1144823025_1144823032 20 Left 1144823025 17:18088641-18088663 CCCTGCTCCATCTTAGTACACAG 0: 1
1: 0
2: 0
3: 14
4: 228
Right 1144823032 17:18088684-18088706 TTTACAAAGCACTGGGCACATGG 0: 1
1: 0
2: 1
3: 42
4: 289

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144823025 Original CRISPR CTGTGTACTAAGATGGAGCA GGG (reversed) Intronic
901348735 1:8572341-8572363 CTGTGTGCTAAAATGGAGGAAGG - Intronic
901723569 1:11220606-11220628 ATGTTTAATAAGATGGAGGAAGG + Intronic
901840843 1:11952992-11953014 CTGTGTCCTCAGATGGTGGAAGG + Intronic
902066222 1:13690409-13690431 TTGTGTACTCAGTTGGAGTATGG - Intergenic
903207205 1:21791515-21791537 CTGTGTACTTGGACAGAGCAGGG + Intergenic
904208591 1:28871193-28871215 CTTGGTACCAAGATGGAGCCTGG - Intergenic
908738882 1:67307512-67307534 CTGTCTCATAAGACGGAGCAAGG - Exonic
908869088 1:68587480-68587502 CTTTGTACTTAGATGGTGCCTGG + Intergenic
911517555 1:98885816-98885838 CTGTGTATTAATATGAAGTAGGG + Intergenic
911747166 1:101452739-101452761 CTGTGTACTAAGAGGCAAAATGG + Intergenic
914077492 1:144369066-144369088 CTGTGTCCTCACATGGAGGAAGG + Intergenic
914101687 1:144597439-144597461 CTGTGTCCTCACATGGAGGAAGG - Intergenic
915940849 1:160117367-160117389 CCTTGCTCTAAGATGGAGCAGGG - Intronic
916587553 1:166161765-166161787 TTGTTTACTAAGATGAAGAATGG + Intronic
916626651 1:166565335-166565357 CTATGGAGAAAGATGGAGCAGGG - Intergenic
917072546 1:171168483-171168505 CAGAGTATTAAGAGGGAGCAAGG - Intergenic
918077796 1:181183538-181183560 CTGTGTCCTAAGAAGGAGGATGG + Intergenic
918185772 1:182126517-182126539 CTGTGTTCTGAGATAAAGCAAGG - Intergenic
919534801 1:198774234-198774256 TTGTGTGCTAAGAAGGACCAGGG + Intergenic
919743935 1:200996892-200996914 CTGTGTACTGAGATGGGAGAGGG - Intronic
920064045 1:203252758-203252780 CTGTGTCATAACATGGAGGATGG + Intronic
920724986 1:208426668-208426690 CTGTGTCCTCACATGGAGGAAGG + Intergenic
921162677 1:212484207-212484229 CTGTTTACAAAGATGGGACAGGG - Intergenic
923737214 1:236621894-236621916 CTGTGTGCCAGGAAGGAGCATGG + Intergenic
1063459808 10:6207941-6207963 CTGAGTCCTAAGATGGTGCTTGG + Intronic
1064722920 10:18247938-18247960 CTGTGTTCTAATATGGTGGAAGG + Intronic
1065127563 10:22588400-22588422 CTTGGTACTAAGATGCAACAGGG - Intronic
1066174575 10:32890650-32890672 CTGTGTCCTCAGATGGTGGAAGG + Intergenic
1067158557 10:43803145-43803167 CTGTGCCCTCACATGGAGCAAGG + Intergenic
1068286251 10:54939796-54939818 TTGTGTCCTCAGATGGTGCAAGG + Intronic
1068662339 10:59635579-59635601 CTGTGCAGTAAGTTGGGGCAAGG - Intergenic
1072015342 10:91341339-91341361 CCAGGTACTGAGATGGAGCAGGG + Intergenic
1073828072 10:107348844-107348866 CCATACACTAAGATGGAGCAGGG - Intergenic
1074705767 10:116128871-116128893 CTTTGTACAAAGTTGGAACAGGG + Intronic
1079325688 11:19489396-19489418 CTGTGTACTATGATGTGGGAAGG + Intronic
1079877790 11:25881529-25881551 CTGTGTCCTAACATGGTGAAAGG - Intergenic
1080861154 11:36151306-36151328 TTGTGTAGTAAGATGGGCCAGGG + Intronic
1081027302 11:38031879-38031901 CTATGTACTACTATGAAGCAAGG - Intergenic
1084970863 11:72771391-72771413 CTGAGTCCAAAGATGGGGCAAGG - Intronic
1085877039 11:80420831-80420853 TTGTGTAATAAGAGGCAGCATGG - Intergenic
1087570443 11:99920694-99920716 CTGTGTACTCACATGGTGGAAGG + Intronic
1089026468 11:115275381-115275403 ATGTGTCCTAAGATGGGGAAGGG - Intronic
1090641637 11:128734335-128734357 CTGAGTACTCAGATGGAAGAAGG + Intronic
1090770952 11:129919517-129919539 TTGTTCACTATGATGGAGCATGG + Intronic
1093376084 12:18429590-18429612 CTGTGGACTAAGAGGGGGAAGGG - Intronic
1093904701 12:24676811-24676833 CTGTGTCCTTACATGGAGAAAGG + Intergenic
1095547509 12:43388908-43388930 CTGTGTTCTCATATGGAGGAAGG + Intronic
1096038179 12:48491283-48491305 CTGTGTCCTCACATGGAGGAAGG + Intronic
1096139147 12:49227784-49227806 CTGTGGACTAGGATGGCGGAGGG + Intronic
1098529382 12:71523341-71523363 CTGGGTACTATGATGGAGATGGG - Intronic
1098817256 12:75182930-75182952 CAGTGTACTGAGATGGTGCTGGG + Intronic
1100119570 12:91353193-91353215 CTGTGTTCTCAGATGGTGGAAGG + Intergenic
1101860917 12:108481774-108481796 CTGTGTCCTCACATGGAGGAAGG - Intergenic
1106573619 13:30954001-30954023 CTGTTTACTCAGCTGGAACATGG + Intronic
1106690068 13:32105277-32105299 CTGTGTCCTCACATGGAGAAAGG - Intronic
1107325441 13:39237081-39237103 CTCTGTAGTGAGAAGGAGCATGG + Intergenic
1107634102 13:42374598-42374620 CTGTGTCCTCACATGGAGGAAGG + Intergenic
1108123246 13:47212586-47212608 TGGTGTAGGAAGATGGAGCAGGG + Intergenic
1109241010 13:59888251-59888273 CTGTGTTCTGAGATGGTGGAGGG - Intronic
1110106588 13:71684613-71684635 CTGTGCTCTACGATAGAGCATGG + Intronic
1110165778 13:72441426-72441448 CTGTATAATAAGTTGCAGCAAGG + Intergenic
1112462982 13:99619279-99619301 CTGTGTCCTCACATGGCGCAGGG - Intronic
1112719766 13:102230149-102230171 CTGTGTTCTCACATGGTGCAAGG - Intronic
1112906575 13:104429747-104429769 CTGTGTCCTAAGATGGCAGAAGG + Intergenic
1113984555 13:114303452-114303474 CTGTATACACAGATGGAGCATGG - Intronic
1116204005 14:41837431-41837453 CTCTGTCCTGAGATGGTGCATGG + Intronic
1117976949 14:61308455-61308477 CTGAGTACTAAGATGAAACTTGG - Intronic
1118811963 14:69281723-69281745 CTGTGTGCTGGGATGGAGAAAGG - Intronic
1119502276 14:75140033-75140055 CTGTGTTCTCACATGGAGGAAGG - Intronic
1119520906 14:75284420-75284442 CTGTGCAATAAGCTAGAGCAAGG - Intergenic
1119863696 14:77955807-77955829 CTGTCTACTTAGAAGGAGCTGGG + Intergenic
1120640287 14:87002578-87002600 ATGTTTACTAAGATGGAACGTGG - Intergenic
1122810674 14:104286267-104286289 CTGTGTCCTCACATGGAGGACGG + Intergenic
1124987012 15:34629693-34629715 ATGTGTACTAATATGGAAAAGGG + Intergenic
1129681429 15:77660536-77660558 CTCTGTACCAAGTGGGAGCAGGG + Intronic
1130078441 15:80710180-80710202 CAGGGTCCTAAGATGGGGCATGG + Intronic
1132025257 15:98399648-98399670 CTGTGTGCTCACATGGAGGAAGG - Intergenic
1132141974 15:99404196-99404218 CTGTCTATGAAGAAGGAGCAGGG + Intergenic
1133625168 16:7564221-7564243 CTGTGTTCTCAGATGGAAGAGGG - Intronic
1135290947 16:21237559-21237581 CTGTGTCCTCACATGGAGGAAGG + Intronic
1135804397 16:25529024-25529046 CTGTGTCCTCATATGGTGCAGGG + Intergenic
1138686236 16:58728479-58728501 CTCTGTACTAGGATGCAGGATGG - Intronic
1138973260 16:62171441-62171463 CTGTGTCCTCACATGGGGCAAGG + Intergenic
1141012163 16:80412809-80412831 CTGGGTCGTAAGATGCAGCAAGG - Intergenic
1142682686 17:1559663-1559685 CTGTTTACTAGCCTGGAGCAAGG - Intronic
1144328075 17:14200764-14200786 ATGTGTACAAAGATTGTGCAGGG + Intronic
1144823025 17:18088641-18088663 CTGTGTACTAAGATGGAGCAGGG - Intronic
1144938155 17:18916812-18916834 CTGTGTCCTCAGATGGTGGAAGG + Intronic
1145105148 17:20109216-20109238 CAGTGGAGTAGGATGGAGCAGGG + Intronic
1145254529 17:21315378-21315400 CTGTGTCCTCAGATGTAGAAGGG - Intergenic
1145322066 17:21772587-21772609 CTGTGTCCTCAGATGTAGAAGGG + Intergenic
1145924006 17:28632586-28632608 CTGTGTCCTAATATGGTGGAAGG - Intronic
1146409140 17:32566984-32567006 CTGTGAACATGGATGGAGCACGG - Intronic
1146570140 17:33945387-33945409 CTGTTAACTCAGATGGAACAAGG + Intronic
1147559611 17:41500816-41500838 CTGTGTGCTCAGATGGCCCATGG + Intergenic
1147668293 17:42162514-42162536 CTCCGTACCAAGATGGGGCAAGG - Intronic
1150600669 17:66648144-66648166 CTGTGTCCTCACATGGTGCAAGG + Intronic
1151405926 17:73886153-73886175 GTGTGGCCTGAGATGGAGCATGG - Intergenic
1152346377 17:79754855-79754877 CTGTGTCCTCACATGGAGGAAGG + Intergenic
1152387686 17:79984902-79984924 CTGTGTCCGAAGCTGGAGGATGG - Intronic
1153244184 18:3057475-3057497 CTGAGTTGTAAGCTGGAGCAAGG + Intergenic
1160232232 18:77057060-77057082 CTGGGTACTACAATGAAGCAGGG + Intronic
1161079567 19:2303790-2303812 CTGTGGCCAATGATGGAGCATGG + Intronic
1161652968 19:5496551-5496573 CAGTGTAGTCAGGTGGAGCATGG - Intergenic
1163511774 19:17739693-17739715 CAGTGGACTAAGAGGTAGCAAGG - Intergenic
1166340774 19:42135336-42135358 CCGTGTGCTTAGATGCAGCAAGG - Intronic
1168459865 19:56545531-56545553 TTGTGTAGTCAGATGCAGCATGG + Intronic
926470410 2:13248345-13248367 ATCTGTACAAAGAAGGAGCAAGG - Intergenic
927555652 2:24029646-24029668 CAGTTTACCAAGATGGAGCTGGG - Exonic
927623058 2:24682482-24682504 CTATGCACTGAGATGGAGCCAGG - Intronic
928856508 2:35808916-35808938 CTGTGTGCAAAGAGGAAGCAGGG - Intergenic
929235625 2:39602509-39602531 CTCAGTAATAAGAAGGAGCAAGG - Intergenic
929615231 2:43301517-43301539 CTGGGTACTGAGATGGAATAGGG - Intronic
930505714 2:52280990-52281012 CTGTGTTCTCAGATGGAGGAAGG + Intergenic
931457614 2:62424571-62424593 CTGTGTGACAAGATGGAGAAGGG + Intergenic
932136658 2:69237012-69237034 CTGTGTAATCAGATGGAAAAAGG + Intronic
932451915 2:71816449-71816471 CTGTGTACTAAAATGTGGCTAGG + Intergenic
934728630 2:96641897-96641919 CTGTGCATTAAGATGGAGCTGGG - Intronic
935180621 2:100687371-100687393 CTGTGTCCTCACATGGAGGAAGG - Intergenic
935277994 2:101492275-101492297 CTGCGTAGAAACATGGAGCATGG - Intergenic
936450949 2:112633704-112633726 CTGTGTCCTCAGATGAAGGAAGG - Intergenic
939477423 2:142703662-142703684 ATGTGTAATAACATGGAGAAAGG + Intergenic
939818643 2:146928252-146928274 CTGTGTAATGACATGGAGCCAGG + Intergenic
942620689 2:177842544-177842566 CTGTTTAAGAATATGGAGCAGGG + Intronic
943569784 2:189559737-189559759 CTGTGTAGGAAGAAGAAGCATGG - Intergenic
948624598 2:239261373-239261395 CCGTGTGCTGAGATGGAGCGTGG + Intronic
948852482 2:240715222-240715244 CAGTGGACCAAGATGCAGCAAGG - Exonic
1169342248 20:4805354-4805376 CTGTGGACGAAGATGGAGGAAGG + Intronic
1169696408 20:8392247-8392269 CTGTGTCCTCAGATGGGCCAAGG - Intronic
1169877159 20:10310732-10310754 CTGTGTCCTCACATGGAGGAAGG + Intergenic
1171015167 20:21534175-21534197 CTGTGTCATAATATGGAGGAAGG - Intergenic
1171318159 20:24214158-24214180 CTGTGTACTCAGATGCACCTTGG - Intergenic
1172784340 20:37456726-37456748 CTGTGTCCTTACATGGTGCAAGG + Intergenic
1174691966 20:52515506-52515528 CTGTGTACTAGGATTAAGAATGG - Intergenic
1179429828 21:41313349-41313371 GTGTTGAGTAAGATGGAGCAAGG - Intronic
1182401848 22:30084258-30084280 CTGTGTCATAACATGGAGGAAGG + Intronic
1184999660 22:48237628-48237650 CCGTGTACTGAGAAGGAGCGAGG - Intergenic
1185080092 22:48704936-48704958 CTGTGTCCTGAGATGGTGCAGGG + Intronic
949489031 3:4569599-4569621 TTGTGTAGTAAGAGGGATCATGG + Intronic
950549596 3:13658120-13658142 CTGGGTACAAAGAAGCAGCAAGG - Intergenic
951186970 3:19724393-19724415 CTGTGTCCTATAATGGAGAAGGG + Intergenic
951299794 3:20981777-20981799 CTGTGTAAGAGGTTGGAGCAGGG + Intergenic
951389075 3:22080835-22080857 CTGTGTCCTCACGTGGAGCAAGG - Intronic
953361407 3:42300562-42300584 CTGTGTCCTTAGATGGCACAAGG + Intergenic
955321512 3:57977912-57977934 TTGTGTAAAAAGGTGGAGCAAGG - Intergenic
955485015 3:59426427-59426449 CTGTCTTCAAAGATGGAGAAAGG - Intergenic
955614078 3:60787275-60787297 ATGTGTAAAAAGCTGGAGCAGGG - Intronic
960221478 3:115115017-115115039 CTTTGTAATAAGATGGAGAATGG - Intronic
961768691 3:129232140-129232162 GTTTGGACTAAGGTGGAGCAGGG - Intergenic
962408149 3:135117878-135117900 CTGTGTAGTGAGATGAAGCCAGG + Intronic
962577858 3:136771102-136771124 CTGTGTCCTCATATGGAGGAAGG - Intergenic
962826098 3:139102011-139102033 CTGTGTCCTAAGGTGGAGTGGGG + Intronic
964885140 3:161473363-161473385 CTGTGTACTCACATGGTGGAAGG + Intergenic
964898789 3:161631651-161631673 CTGTGTAATTGGATGGAGCAAGG - Intergenic
964951717 3:162303179-162303201 ATGTGTACTAAGAGGAAGAATGG + Intergenic
966008462 3:175047023-175047045 CTGTGTCCTCAGATGGTGGAAGG + Intronic
966390210 3:179444540-179444562 CTGTGTATTTAAATGGAACATGG - Intronic
966794374 3:183699251-183699273 CTGTTTACTGAGATGAAGAATGG + Intronic
967071040 3:185962491-185962513 CTGTGTACTATGATGGCTCCTGG - Intergenic
968028949 3:195466423-195466445 CTGGCTTCGAAGATGGAGCAAGG - Intergenic
970550673 4:17177960-17177982 CTGTGTCCTCACATGGAGGAAGG + Intergenic
970557574 4:17250065-17250087 CAGTGTACTAAAATGGGGAAAGG + Intergenic
971555129 4:28003739-28003761 CTGTGTGGTAAGTAGGAGCATGG + Intergenic
973755360 4:54068376-54068398 CTGTGTTCTAAGATAGTGGAAGG - Intronic
975241840 4:72068329-72068351 CTGTGTCCTAAGATGGCAGAAGG + Intronic
977127361 4:93186999-93187021 CTGTGTCCTCACATGGTGCAAGG + Intronic
977644026 4:99391026-99391048 CTGTGTACTCACATGGAAAAAGG + Intergenic
977959823 4:103072987-103073009 CTGTGTTCTCAGATGGTGGAAGG - Intronic
979994425 4:127413450-127413472 GTGTGTTCTAAGAGTGAGCAAGG - Intergenic
980530940 4:134053339-134053361 TTGTTTACTGAGATAGAGCAAGG + Intergenic
980614588 4:135202332-135202354 CTGTGTCCTCACATGGAGGAAGG - Intergenic
980615567 4:135219007-135219029 CTGTATATTAAAATGGAGCATGG - Intergenic
986487290 5:8250457-8250479 CTGTATAGCAACATGGAGCATGG + Intergenic
987394876 5:17413516-17413538 CTATGTTCCAAGATGGAGCCAGG - Intergenic
987742901 5:21933367-21933389 CAGTGTTCTAAGAGGGAACAGGG + Intronic
987815510 5:22896078-22896100 CTATATTCTAAGATCGAGCAAGG + Intergenic
989734761 5:44690501-44690523 CTGTGTCCTCACATGGAGGAAGG + Intergenic
993164584 5:84335927-84335949 CTGTTTCCTCAGATGGAGGAAGG + Intronic
993227998 5:85194366-85194388 CAGAGTACTAGGATGGGGCAGGG - Intergenic
994163271 5:96580940-96580962 TTGTGTCCTCACATGGAGCAAGG - Intronic
995793190 5:115915505-115915527 CTGGGTACTAGGATAGAGCAGGG + Intergenic
996331590 5:122335746-122335768 CATTGTACTGAGTTGGAGCAAGG + Intronic
996413454 5:123183802-123183824 CTGTTTAGTAAGAAGGAGGAAGG - Intronic
996575498 5:124973045-124973067 CTGTCTACTGAGGTGGAGCCTGG + Intergenic
996884587 5:128340543-128340565 ATGTGTTCTAGGGTGGAGCAGGG + Intronic
998098649 5:139413401-139413423 CTGGGTTCTATGATGGAGTAGGG + Exonic
1000250632 5:159491637-159491659 CTGTGGTATAAGATGGAGCTGGG - Intergenic
1002059449 5:176617807-176617829 CTCTGTCCTTAGATGGAGGAGGG - Intergenic
1005353525 6:24960341-24960363 CTGTGTCCTCACATGGAGAAGGG + Intronic
1006433257 6:34011413-34011435 CTGTGTACTAAGTGGGACAATGG - Intergenic
1008142055 6:47843407-47843429 CTGTGTCCTCACATGGTGCAAGG + Intergenic
1008469794 6:51871531-51871553 GTGGCTACAAAGATGGAGCAAGG + Intronic
1011488620 6:87868705-87868727 CTGTAGACTAAAAAGGAGCATGG + Intergenic
1013602224 6:111715580-111715602 TTGTGTACTTTGATGAAGCAAGG + Intronic
1014028108 6:116672009-116672031 GAGTGTATTAAGATGGAGTAGGG - Intergenic
1015603524 6:134933392-134933414 CTGGACACCAAGATGGAGCAGGG - Intronic
1016458013 6:144251295-144251317 CAGTGTCCTCAGAGGGAGCATGG - Intergenic
1016742185 6:147540619-147540641 CTGTGTTCTATAATGGAGAAAGG - Intronic
1018147021 6:160900798-160900820 CAGGGTACTGAGAGGGAGCATGG + Intergenic
1018777781 6:167034226-167034248 CTGTGGATTAAGAGGGATCAGGG + Intronic
1019275449 7:173269-173291 CTGTGTCCACAGATGGGGCAGGG + Intergenic
1019760676 7:2810261-2810283 CTGTGTCCTCAGATGGTGGAAGG + Intronic
1020726149 7:11817677-11817699 CAGTGTACTTAGATGGTGCCTGG - Intronic
1021534481 7:21688023-21688045 CTGTCTCCTAGGCTGGAGCACGG - Intronic
1021536203 7:21707566-21707588 GTGTGTGCTAAGATCGAGAAGGG - Intronic
1022163292 7:27733147-27733169 CTCTGTACTAAGATAGGGTACGG + Intergenic
1022407195 7:30101482-30101504 CTGTGTCCTCACATGGAGGAAGG + Intronic
1023319697 7:38980894-38980916 CTGTGTCCTGAGCTGGATCATGG - Intronic
1027942172 7:84696742-84696764 CTGGGGACTAATAGGGAGCAGGG - Intergenic
1028906519 7:96160560-96160582 CTGTGTCCTCACATGGAGGAAGG + Intronic
1029178630 7:98683470-98683492 CTGTGTCCTTACATGGAGGAGGG - Intergenic
1030498159 7:110326180-110326202 CTGCATATTAAGATGGAGCATGG + Intergenic
1030938976 7:115621088-115621110 CTGTCTTCTACCATGGAGCAAGG + Intergenic
1031482249 7:122292397-122292419 CTATGTATTAAGATGCACCAAGG + Intergenic
1034590283 7:152132532-152132554 CTGGGCACTGAGCTGGAGCACGG + Intergenic
1035719316 8:1779742-1779764 CTGTGTCCTAGCATGGAGGAGGG + Intronic
1037333908 8:17773581-17773603 CTGTGTCATAACATGGAGAAGGG + Intronic
1040889736 8:52304819-52304841 CTGTGTTCTCACATGGAGGAAGG + Intronic
1041723436 8:60996969-60996991 CTGTGTACTAAGGTGGGGACGGG - Intergenic
1047706800 8:127507160-127507182 CTGTTGCCTAAGCTGGAGCATGG - Intergenic
1047721162 8:127641006-127641028 CTGTCTCCCCAGATGGAGCATGG - Intergenic
1050392762 9:5163604-5163626 CTGTGTTTTAAGATGGATTATGG - Intronic
1051297517 9:15612009-15612031 CTGTGTCCTAACATGGTGGAAGG - Intronic
1052283237 9:26756219-26756241 CTGTGTACTCACATGGAGGAAGG + Intergenic
1054343426 9:63890374-63890396 CTGTGGACTCAGATTGAGCCAGG - Intergenic
1055516451 9:77038443-77038465 CTGTGTATTAACTTGGGGCAAGG + Intergenic
1056660752 9:88541248-88541270 ATGTCTACTGAGATTGAGCAAGG - Intronic
1058161365 9:101573591-101573613 CTGTGCAATAATATGGAGCTGGG + Intronic
1058560844 9:106227269-106227291 CTGTGTCCTCAGATGGTGGAAGG - Intergenic
1058572603 9:106363788-106363810 CTGTGTTCTCACATGGAACAAGG + Intergenic
1058843789 9:108935386-108935408 GTGTAAAGTAAGATGGAGCAAGG + Intronic
1060370000 9:123059709-123059731 CTGTGTTCTCATATGGGGCAGGG - Intronic
1060808536 9:126594923-126594945 CTGTGTCCTAACATGGTGCAAGG - Intergenic
1061272709 9:129552564-129552586 CTGTGTCCTCACATGGAGGAAGG + Intergenic
1185938513 X:4286008-4286030 CTGTGTCCTCACATGGAGGAAGG - Intergenic
1187221761 X:17334095-17334117 CTGTGTACTCAGATGATGGAAGG + Intergenic
1188717454 X:33477221-33477243 CAGAGCACTAAGAGGGAGCATGG + Intergenic
1189560234 X:42184763-42184785 CTGTGTCCTCAGATGGTGGAAGG - Intergenic
1189707234 X:43770995-43771017 GTGTTGACTAAGATGGAACATGG - Intronic
1190730027 X:53219797-53219819 CTGACTAATAAGAAGGAGCAGGG - Intronic
1198009738 X:132539403-132539425 CTGTGTCCTAACATGGTGGAAGG + Intergenic
1198024233 X:132689120-132689142 CTGTGCACTAGGATGAAGGAGGG - Intronic
1198693124 X:139306179-139306201 CTATGTTCTAACATGGAGGAAGG + Intergenic